Sep 16, 2024

Public workspaceX-ClickSeq: Custom-Primed Protocol with Single Indexing using ClickSeq Kit

  • 1ClickSeq Technologies LLC
Icon indicating open access to content
QR code linking to this content
Protocol CitationAndrew Routh, Elizabeth Jaworski 2024. X-ClickSeq: Custom-Primed Protocol with Single Indexing using ClickSeq Kit. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzjdm2lx1/v1
Manuscript citation:

CITATION
Jaworski E, Langsjoen RM, Mitchell B, Judy B, Newman P, Plante JA, Plante KS, Miller AL, Zhou Y, Swetnam D, Sotcheff S, Morris V, Saada N, Machado RR, McConnell A, Widen SG, Thompson J, Dong J, Ren P, Pyles RB, Ksiazek TG, Menachery VD, Weaver SC, Routh AL (2021). Tiled-ClickSeq for targeted sequencing of complete coronavirus genomes with simultaneous capture of RNA recombination and minority variants..

CITATION
Routh A, Head SR, Ordoukhanian P, Johnson JE (2015). ClickSeq: Fragmentation-Free Next-Generation Sequencing via Click Ligation of Adaptors to Stochastically Terminated 3'-Azido cDNAs..

CITATION
Jaworski E, Routh A (2018). ClickSeq: Replacing Fragmentation and Enzymatic Ligation with Click-Chemistry to Prevent Sequence Chimeras..

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 16, 2024
Last Modified: September 16, 2024
Protocol Integer ID: 107726
Keywords: ClickSeq, Click Chemistry, RNAseq, DNAseq, NGS, Illumina, fragmentation-free, recombination
Disclaimer
ClickSeq is a pending trademark of ClickSeq Technologies, LLC.
Abstract
ClickSeq is a simple, fragmentation-free method for the synthesis of Next-Generation Sequencing (NGS) libraries. ClickSeq derives its name by using ‘Click-Chemistry‘ in the place of common ligation enzymes to ‘click-ligate’ nucleic acids to sequencing adaptors – an essential and often problematic step in the synthesis of Next-Generation Sequencing cDNA libraries. The process takes advantage of the chain-terminating properties of 3′-azido-nucleotides, which are included the initial in vitro reverse-transcription reactions uniformly required for RNAseq. The modified nucleotides are stochastically incorporated into the nascent cDNA, yielding cDNA fragments blocked at their 3′ ends with azido groups. The 3′-azido-blocked cDNA fragments are ‘click-ligated’ onto alkyne-functionalized sequencing adaptors, which can subsequently be PCR-amplified to yield a sequencing-ready NGS library.

ClickSeq is a highly flexible and modular platform for NGS library synthesis where both RNA and DNA templates can be used as input material. ClickSeq offers many advantages over standard RNA NGS protocols as click-chemistry is utilized to attach on the required sequencing adapter, rather than commonly used enzymatic reactions. Overall, this results in increased efficiency of the protocol, fewer processing steps, and reduced time from RNA to sequencing ready libraries. Additionally, since there are no fragmentation steps typically required in common RNA-seq approaches and because in vitro template switching during RT is limited by the chain terminating azido-nucleotides, ClickSeq offers the benefit of ultra-low artifactual chimera rate, with only 3 chimeric events per million reads.

X-ClickSeq kits provide the same reagents as the ClickSeq kits, except that no primers are provided for the Reverse Transcription step. Rather, the user may use their own RT primer as per the requirements of their own assay. For example, a 9N random primer might be used instead of a 6N random primer; or a set of SARS-CoV-2 targeting tiled-primers might be used (see Jaworski et al. eLife, 2021). All other aspects of the library prep are otherwise identical to ClickSeq. The data analysis pipeline will also be altered as per the assay design.
Guidelines
Next-Generation Sequencing (NGS) is a highly sensitive technique that generates millions of data points. The quality of your input material can be translated to the final quality of your libraries at the end of this protocol, and in turn, the sequencing data. Use common sense laboratory precautions to minimize introducing contamination to your samples and follow procedures as written to ensure good yields.

RT-Primer Design The X-ClickSeq kits purposefully omit any primer in the x-Primer Mix (xPM) used in the reverse transcription step. This allows users to provide their own bespoke primer(s), as per the needs of their specific project. To be compatible with the downstream reagents and oligos, these RT primers must contain first a partial i7 sequence, followed by the template-annealing region. For example, the random/6N primer included in the standard ClickSeq kit is: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNN Thus, the user can substitute the ‘NNNNNN’ region with any sequence of interest, and/or provide many template-specific/tiled primers. The user-provided primer(s) are added to the reaction at step 3. As a result, the X-ClickSeq kit provides users with the flexibility to design their own ClickSeq-based assays. The user-provided primer(s) must be resuspended in either nuclease-free water or Tris-buffer, but must not contain EDTA or other chelators. The user-provided primer(s) should be between 10-100µM, or can be optimized on a per-sample or application-specific basis. Template-specific or Tiled primers should generally not exceed 10µM, but must be validated on a case-by-case basis.

RNA Handling

  • Work in an RNase-free environment; use RNase inhibitors to decontaminate your workspace. Follow standard aseptic techniques.
  • Wear PPE (gloves, lab coat, etc) to protect your workstation and reagents from RNases that are present on your skin. Change gloves often.
  • Use RNase-free plasticware by purchasing certified materials or by treating consumables with RNase Inhibitors.

RNA Input Guidelines

  • Most standard RNA extraction protocols are compatible with this method. Take care during the final steps of the extraction method to ensure that no salts, metal ions, or organic solvents are carried over into the final elution step. For example, ethanol contamination can reduce the efficiency of all reactions in this protocol.
  • During the RNA extraction elute your sample in RNase-free water or Tris buffer (10mM, pH 7.4). We recommend you do NOT use carrier RNA during the extraction process. These will negatively impact your final sequencing data as the carrier RNA will also be sequenced.
  • When using ClickSeq for RNAseq applications, we recommend using protocols that do not co-purify genomic DNA, since this may also provide a substrate for the RT reaction. If available, complete the specified DNase I treatment during RNA extraction.
  • The random primer of this ClickSeq kit will generate cDNA fragments off any nucleic acid in your sample. WHAT YOU PUT IN THE INTIAL REACTION (Step #1) IS WHAT YOU WILL SEQUENCE. Make sure to purify your samples prior to starting this protocol (i.e. rRNA deplete, polyA-select, or another purification method that suits your needs).
  • RNA can be quantified by any of the user’s preferred methods (UV-vis, spectrophotometer, Qubit fluorometer, etc.)
  • This protocol has been demonstrated to work with as little as 10ng up to 4µg of RNA. That quantity should be in a max of 10µl water or Tris- buffer. While it is possible to use the specified range of starting material, we have found that the optimal amount to start with is generally >100ng of RNA. Below this value, additional PCR cycles are required that will result in PCR duplication and increased adaptor-dimers in the final library.
  • A260/A280 values should be between 1.9 and 2.2
  • RIN values should be >6.0


Bead Handling

  • Follow manufacturers recommendations but generally, SPRI purification beads should be stored at +4°C. Beads tend to settle during storage so they should be resuspended thoroughly before use (by vortexing or pipetting vigorously). Beads are resuspended properly when the solution is uniform in color (light brown) and there are no visible clumps on the bottom or sides of the tube.
  • SPRI beads are magnetic and are collected by placing the sample tube on a magnetic rack. The time it takes for the beads to pellet will depend on the strength of the magnet you are using; adjust the incubation time accordingly by waiting until the solution is completely clear. Waiting longer to ensure that all the beads have pelleted will not affect overall quality of your libraries but will ensure adequate efficiency of the purification steps.
  • When discarding the supernatant of pelleted beads, take care to not disturb the beads by keeping the sample tube on the magnetic rack and do not touch the pellet with a pipette tip.
  • Ethanol carryover after the second wash step during bead purification can inhibit subsequent reactions. Visually inspect each well to ensure all ethanol has been removed.
  • Do not allow beads to over-dry, exhibited by visible cracking. This can damage the beads and reduce overall yields.

General

  • Read an entire section of the protocol before beginning to familiarize yourself with all steps. To minimize any issues, collect the necessary equipment, prepare the appropriate reagents, and pre-load the appropriate incubation temperatures on your thermocycler.
  • Enzymes should be thawed and kept on ice while in use. All other reagents can be thawed at room temperature and kept on ice while not in use. SPRI beads equilibrate to room temperature prior to use.
  • Spin down all reagent tubes prior to opening to prevent loss and to minimize cross-contamination.
  • Use calibrated pipettes and fresh tips between samples and reagents.
  • Pipette reagents and mixes carefully and in a controlled manner. Viscous reagents (such as enzyme mixes) should be pipetted slowly to ensure accuracy and the complete transfer of the reagent. Avoid frothing and the introduction of air bubbles while mixing.



Master Mixes

Steps #5 and #17 require the generation of master mixes. In order to have enough solution for all samples, include a 10% surplus per reaction when calculating the master mix.


PCR Cycle Optimization

The number of PCR cycles to perform will depend on the sample type (species, tissue, quality, etc.) so optimizations should be completed prior to processing all samples of the same type. This protocol has been extensively tested using total cellular RNA extracted from D. melanogaster (S2) cells. The provided values should be used as a reference only.

Total RNA Input PCR Cycle Number
20ng 18-21
50ng 17-20
100ng 16-19
250ng 12-18


Sequencing Guidelines

  • Final ClickSeq libraries are compatible with the Illumina sequencing platforms (NextSeq, NovaSeq, MiSeq, HiSeq, etc.) or with Element Biosciences Aviti™ systems/flowcells that are compatible with the same Illumina adaptors.
  • Final ClickSeq libraries can also be sequenced on Oxford Nanopore Technology's flowcell by straight-forward ligation of the ONT DNA sequencing (e.g. LSK109) adaptors.
  • Read 1 will include 4nt of the UMI followed by the cDNA fragment.
  • The 8nt i7 index sequences are provided in the table below.

AB
Index Sequence
D701 ATTACTCG
D702 TCCGGAGA
D703 CGCTCATT
D704 GAGATTCC
D705 ATTCAGAA
D706 GAATTCGT
D707 CTGAAGCT
D708 TAATGCGC
D709 CGGCTATG
D710 TCCGCGAA
D711 TCTCGCGC
D712 AGCGATAG


Materials

Required Reagents

  • ReagentClickSeq KitClickSeq Technologies (https://www.clickseqtechnologies.com/kits)
  • ReagentSuperScript™ III Reverse TranscriptaseThermo FisherCatalog #18080093
  • ReagentOneTaq 2X Master Mix with Standard Buffer - 100 rxnsNew England BiolabsCatalog #M0482S
  • ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317 or equivalent DNA/RNA Purification Beads
  • User-provided primer(s) used in the Reverse-Transcription step.
  • Nuclease-free water
  • 80% ethanol (made fresh)

Optional Reagents
  • ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
  • ReagentRNase H - 250 unitsNew England BiolabsCatalog #M0297S
Protocol materials
ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317
In Materials and 4 steps
ReagentOneTaq 2X Master Mix with Standard Buffer - 100 rxnsNew England BiolabsCatalog #M0482S
Materials, Step 27
ReagentClickSeq KitClickSeq Technologies LLC
Materials
ReagentSuperScript™ III Reverse TranscriptaseThermo FisherCatalog #18080093
Materials
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorThermo Fisher ScientificCatalog #10777019
Materials
ReagentRNase H - 250 unitsNew England BiolabsCatalog #M0297S
Materials, Step 8
Safety warnings
Standard molecular lab precautions should be adhered to, including standard PPE (gloves, lab coat, eye protection, etc).
Before start
Check to ensure that you have all the necessary components, materials, and equipment before beginning this protocol. The protocol can be grouped into 6 broad steps/sections:

  1. Reverse Transcription and RNA Removal: RNA is reverse transcribed by user-provided primer(s) with a partial p7 Illumina adaptor sequence. The presence of AzNTPs stochastically terminates cDNA chain extension generating a distribution of randomly sized cDNA fragments.
  2. First Bead Purification: Magnetic beads are used to remove all components of the reverse transcription reaction leaving the cDNA fragments for further processing.
  3. Click-Ligation: During this step, a sequencing adapter is attached to the azido-terminated 3’ ends of the cDNA fragments using a Click-Chemistry reaction.
  4. Second Bead Purification: SPRI beads are used to remove components of the click-ligation reaction leaving cDNA fragments that are flanked by sequencing adapters.
  5. PCR Library Amplification: At this step, PCR is used to convert the single stranded cDNA fragments to dsDNA fragments, amplify the fragments to generate enough material for sequencing, and to add the sequencing indices/barcodes (Illumina i7 adapters).
  6. Final Bead Purification: Magnetic bead purification is used to remove all components of the PCR amplification reaction from the completed barcoded libraries.





Reverse Transcription and RNA Removal
Reverse Transcription and RNA Removal
50m
50m
In a 0.2ml tube, dilute Amount100 ng -Amount1 µg of input RNA to Amount10 µL using nuclease free water.

Note
The ClickSeq protocol has been demonstrated to work with as little as 10ng up to 4µg of RNA, but will vary depending upon the nature of the target of the custom primers provided in step #3. That quantity should be in a max of 10µl water or Tris-buffer. While it is possible to use the specified range of starting material, we have found that the optimal amount to start with is generally >100ng of RNA. Below this value, additional PCR cycles are required that will result in PCR duplication and increased adaptor-dimers in the final library.

Pipetting
Add Amount2 µL of x-Primer Mix (xPM) to the diluted RNA. Mix well.

Add Amount1 µL of user-provided primer(s) to the diluted RNA. Mix well.

Note
The X-ClickSeq kits purposefully omit any primer in the x-Primer Mix (xPM) used in the reverse transcription step. This allows users to provide their own bespoke primer(s), as per the needs of their specific project. To be compatible with the downstream reagents and oligos, these RT primers must contain first a partial i7 sequence, followed by the template-annealing region. For example, the random/6N primer included in the standard ClickSeq kit is:

GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNN
Thus, the user can substitute the ‘NNNNNN’ region with any sequence of interest, and/or provide many template-specific/tiled primers. The user-provided primer(s) are added to the reaction at step 3. As a result, the X-ClickSeq kit provides users with the flexibility to design their own ClickSeq-based assays.
The user-provided primer(s) must be resuspended in either nuclease-free water or Tris-buffer, but must not contain EDTA or other chelators.

The user-provided primer(s) should be between 10-100µM, or can be optimized on a per-sample or application-specific basis. Template-specific or Tiled primers should generally not exceed 10µM, but must be validated on a case-by-case basis.

Pipetting
Mix
Critical
Incubate the mixture at Temperature65 °C for Duration00:05:00 to melt any RNA secondary structure and immediately snap cool the reaction by placing the tubes on ice for Duration00:01:00 to anneal the reverse primer.

6m
Incubation
After snap cooling, generate an RT master mix in a separate tube by combining the following components, pipette well to mix:
ABC
Per Rxn Master Mix
5X First Strand Buffer 4µl
DTT (100mM) 1µl
[optional] Recombinant Ribonuclease Inhibitor [or nuclease-free water] 1µl
SSIII Reverse Transcriptase 1µl
Generate a Master Mix of these components when preparing more than one sample at a time

Note
Recombinant Ribonuclease Inhibitor is not essential in cases where RNA quality or abundance is not a concern and can be replaced with nuclease-free water to save on reagent costs

Pipetting
Mix
Add Amount7 µL of the RT master mix to each reaction and pipette to mix.

Pipetting
Mix
Incubate the reaction in a thermocycler using the following conditions:
Temperature25 °C for Duration00:10:00
Temperature50 °C for Duration00:10:00
Temperature75 °C for Duration00:10:00
Temperature4 °C for ∞

Note
At this point it is recommended to remove the SPRI Bead reagents from 4°C storage to allow them to equilibrate to room temperature.

30m
Incubation
[optional] To remove template RNA, add Amount0.5 µL of ReagentRNase H - 250 unitsNew England BiolabsCatalog #M0297S . Pipette to mix. Incubate the reaction in a thermocycler using the following conditions:
Temperature37 °C for Duration00:20:00
Temperature80 °C for Duration00:10:00
Temperature4 °C for ∞

Note
Removal of the RNA template using RNaseH is not essential but may improve library yield in some cases. In cases where library yield is not a concern, step #7 may be omitted to save on reagent costs and prep time.

30m
Pipetting
Mix
Optional
First Bead Purification
First Bead Purification
15m
15m
Add Amount36 µL of thoroughly resuspended ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317 beads to the reaction mix. Mix well by pipetting. Incubate for Duration00:05:00 at TemperatureRoom temperature .

Note
SPRI beads tend to settle during storage and should be thoroughly resuspended by vortexing briefly prior to use. Additionally, it is important to allow the SPRI beads to equilibrate to room temperature for 30 min.

5m
Incubation
Pipetting
Mix
Pellet beads by placing the sample tubes on a magnetic rack. Allow the beads to collect for Duration00:05:00 or until the supernatant is completely clear.

5m
Incubation
Leaving the sample tubes on the magnetic rack, discard clear supernatant taking care to not disturb the pelleted beads.
Pipetting
Leaving the sample tubes on the magnetic rack, wash pelleted beads by adding Amount200 µL of freshly prepared 80% EtOH. Do not resuspend beads. After Duration00:00:30 incubation remove and discard the supernatant.

30s
Incubation
Pipetting
Repeat the EtOH washing step (#12) for a total of two washes. After the second wash make sure to remove all traces of EtOH as ethanol can impair the efficiency of subsequent steps. Visually inspect tubes for trace amounts of EtOH left over on the sides of the tubes. Tubes should be removed off the magnet and pulse spun to collect extra EtOH at the bottom of the sample tube. Place tubes back on a magnetic stand and pipette off any remaining EtOH.
Pipetting
Remove the sample tubes from the magnetic rack and resuspend the beads by adding Amount21 µL of Elution Buffer 1 (EB1). Incubate resuspended beads for Duration00:02:00 at TemperatureRoom temperature

2m
Incubation
Pipetting
Mix
Place the sample tubes back on the magnetic rack and allow beads to pellet. Transfer Amount20 µL of the supernatant to a fresh 0.2ml sample tube.

Safe stopping point: samples can be stored at Temperature-20 °C

Incubation
Pipetting
Pause
Click-Ligation
Click-Ligation
20m
20m
Add Amount15 µL of Click Mix (CM) to each sample. Pipette to mix, taking care to not introduce air bubbles.

Note
The Click-Adaptor present in the Click Mix (CM) is:
5’ Hexynyl-NNNNAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

Pipetting
Mix
In a separate tube, prepare the Click Ligation master mix, pipetting up and down 3-5 times to mix, taking care to not introduce any air bubbles. CC is blue in color and should turn clear/colorless when mixed properly. This is a time sensitive reaction so proceed immediately to the next step.

ABC
Per Rxn Master Mix
Click Accelerant (CA) 4µl
Click Catalyst (CC) 1µl
Generate a Master Mix of these components when preparing more than one sample at a time

Note
The tube containing CA should only be used one time to limit exposure to atmospheric oxygen. Discard the tube once it has been used. The ClickSeq kit provides two CA tubes.

Pipetting
Mix
Critical
Add Amount5 µL of the Click Ligation master mix to each sample tube. Once the mix has been added to all sample tubes, pipette or flick to mix, and spin down contents of the tube. Incubate the reaction at room temperature for Duration00:15:00 .

15m
Incubation
Pipetting
Mix
Second Bead Purification
Second Bead Purification
15m
15m
Add Amount64 µL of thoroughly resuspended ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317 beads to the reaction mix. Mix well by pipetting. Incubate for Duration00:05:00 at TemperatureRoom temperature
5m
Incubation
Pipetting
Mix
Pellet beads by placing the sample tubes on a magnetic rack. Allow the beads to collect for Duration00:05:00 or until the supernatant is completely clear.
5m
Incubation
Leaving the sample tubes on the magnetic rack, discard clear supernatant. Take care to not disturb the pelleted beads.
Pipetting
Leaving the sample tubes on the magnetic rack, wash pelleted beads by adding Amount200 µL of freshly prepared 80% EtOH. Do not resuspend beads. After Duration00:00:30 incubation remove and discard the supernatant.
30s
Incubation
Pipetting
Repeat the EtOH wash step (#22) for a total of two washes. After the second wash make sure to remove all traces of EtOH as ethanol can impair the efficiency of subsequent steps. Visually inspect tubes for trace amounts of EtOH left over on the sides of the tubes. Tubes should be removed off the magnet and pulse spun to collect extra EtOH at the bottom of the tube. Place tubes back on a magnetic stand and pipette off any remaining EtOH.
Incubation
Pipetting
Remove the sample tubes off the magnetic rack and resuspend the beads by adding Amount21 µL of Elution Buffer 2 (EB2). Incubate resuspended beads for Duration00:02:00 at TemperatureRoom temperature .
2m
Incubation
Pipetting
Mix
Place the sample tubes back on the magnetic plate and allow beads to pellet. Transfer Amount20 µL of the supernatant to a fresh 0.2ml PCR tube.

Safe stopping point: samples can be stored at Temperature-20 °C overnight
Incubation
Pipetting
Pause
PCR Library Amplification
PCR Library Amplification
2h 10m
2h 10m
Transfer Amount10 µL of the sample volume to a new PCR tube.
(Note: Retain the other 10µl of your sample. It can be used to repeat the PCR amplification step in the case of over- or under-cycling or for technical replicates).
Pipetting
Add Amount25 µL of ReagentOneTaq 2X Master Mix with Standard Buffer - 100 rxnsNew England BiolabsCatalog #M0482S to each sample tube.

Pipetting
Mix
Using a unique Index Primer per sample, add Amount15 µL of each respective i7 index primer (Index Primer D701-D712) to each sample tube. Pipette to mix. Take note of which index was used for each sample.

Note
The 'forward' primer in the PCR step is:
AATGATACGGCGACCACCGAG

The 'reverse' primer (i7 indexing primer) is:
CAAGCAGAAGACGGCATACGAGATxxxxxGTGACTGGAGTTCAGACGTGT
where 'xxxxxx' denotes the barcode used. Any indexing primers that conform to this 'structure' can be used here.

The 8nt i7 index sequences are provided in the table below:

AB
D701ATTACTCG
D702TCCGGAGA
D703CGCTCATT
D704GAGATTCC
D705ATTCAGAA
D706GAATTCGT
D707CTGAAGCT
D708TAATGCGC
D709CGGCTATG
D710TCCGCGAA
D711TCTCGCGC
D712AGCGATAG
i7 Indexes included in the ClickSeq Technologies Primer Box (12 Indexes)


Pipetting
Mix
Place the sample tubes in a thermocycler using the following PCR cycling program:
  • Temperature94 °C Duration00:01:00 ; Temperature53 °C Duration00:00:30 ; Temperature68 °C Duration00:10:00 ;
  • [Temperature94 °C Duration00:00:30 ; Temperature53 °C Duration00:00:30 ; Temperature68 °C Duration00:02:00 ] x 12-21 cycles;
  • Temperature68 °C Duration00:05:00 ;
  • Temperature4 °C f∞

Note
The number of PCR cycles to perform will depend on the sample type (species, tissue, quality, etc.) so optimizations should be completed prior to processing all samples of the same type. This protocol has been extensively tested using total cellular RNA extracted from D. melanogaster (S2) cells. The provided values should be used as a reference only. We recommended starting with 18 cycles when generating libraries from >100ng of high quality RNA and adjusting as needed.

AB
Total RNA Input PCR Cycle Number
20ng 18-21
50ng 17-20
100ng 16-19
250ng 12-18
Suggested PCR cycle numbers depending upon the amount of RNA provided in Step #1.


Note
In the case of over- or under-cycling, starting at step #26, the protocol may be repeated using the retained 10µl of your sample from step #25. Under-cycling will result in low yield and the PCR amplification should be repeated with a higher cycle number. Over-cycling can result in excessive PCR duplication and will result in excess library.


19m 30s
PCR
Final Bead Purification
Final Bead Purification
15m
15m
Add Amount30 µL of thoroughly resuspended ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317 to the reaction mix. Mix well by pipetting. Incubate for 5 min at room temperature.

Incubation
Pipetting
Mix
ReagentSPRIselect reagent kitBeckman CoulterCatalog #B23317 Pellet beads by placing the sample tubes on a magnetic rack. Allow the beads to collect for Duration00:05:00 or until the supernatant is completely clear.

5m
Incubation
Leaving the sample tubes on the magnetic rack, transfer the supernatant to fresh 0.2ml tubes. Take care to not disturb the pelleted beads. Pelleted beads may be discarded. Do NOT discard the supernatant.


Note
The SPRI beads discarded at this step retain the longer fragment sizes in the final library generated by ClickSeq (>~600nt). These are generally not compatible with clustering on Illumina flowcells, however, these beads/fragments can be washed with 80% EtOH per the usual protocol, eluted with EB2 and retained for sequencing on longer-read NGS platforms such as Oxford Nanopore Technologies flowcells.

Pipetting
Add Amount15 µL of thoroughly resuspended SPRI beads to the retained supernatant from step #32. Mix well by pipetting. Incubate for Duration00:05:00 at TemperatureRoom temperature .

5m
Incubation
Pipetting
Mix
Pellet beads by placing the sample tubes on a magnetic rack. Allow the beads to collect for Duration00:05:00 or until the supernatant is completely clear.

5m
Incubation
Leaving the sample tubes on the magnetic rack, discard clear supernatant. Take care to not disturb the pelleted beads.
Pipetting
Leaving the sample tubes on the magnetic rack, wash pelleted beads by adding Amount200 µL of freshly prepared 80% EtOH. Do not resuspend beads. After Duration00:00:30 incubation remove and discard the supernatant.

30s
Incubation
Pipetting
Repeat the EtOH wash step (#36) for a total of two washes. After the second wash make sure to remove all traces of EtOH as ethanol can impair the efficiency of subsequent steps. Visually inspect tubes for trace amounts of EtOH left over on the sides of the tubes. Tubes should be removed off the magnet and pulse spun to collect extra EtOH at the bottom of the tube. Place tubes back on a magnetic stand and pipette off any remaining EtOH.
Pipetting
Remove the sample tubes off the magnetic rack and resuspend the beads by adding Amount18 µL of Elution Buffer 2 (EB2). Incubate resuspended beads for Duration00:02:00 at TemperatureRoom temperature .

2m
Incubation
Pipetting
Mix
Place the sample tubes back on the magnetic plate and allow beads to pellet. Transfer Amount17 µL of the supernatant to a fresh tube.

Pipetting
Samples are now ready for quality control, quantification, pooling, and sequencing.

Safe stopping point: samples can be stored at Temperature-20 °C


Note
Following the protocol as directed will retain fragments ~300-600bp. This is the optimal size fragment size range for the ClickSeq protocol. The final fragments consist of: ~140nt of sequencing adapters and ~160-460nt of the cDNA fragment. If a tighter size selection is required, we suggest following the additional optional steps protocol.

Pause
[Optional] Agarose Gel DNA Extraction Protocol (if tighter fragment size distribution is required)
[Optional] Agarose Gel DNA Extraction Protocol (if tighter fragment size distribution is required)
Quantify samples using the Qubit dsDNA High Sensitivity Kit or with a BioAnalyzer High Sensitivity DNA kit.
Optional
Make an equimolar pool(s) of your samples (or however you would like to distribute the pool). You may pool all your samples into one pool, or you may make a few pools with fewer samples per pool. When pooling, consider the capacity of your gel electrophoresis system.
Optional
Following the protocol for the agarose system of your choosing; assemble your gel electrophoresis system, mix your sample with loading dye (if necessary), load your samples and ladder into the wells of your gel, and run the gel to separate your samples.
Optional
Using a clean gel knife and referencing the DNA ladder, excise the gel between 300 and 600bp (or as required per the user’s assay).
Optional
Following the user defined agarose DNA extraction protocol, dissolve and extract the DNA from the excised agarose. Elute/resuspend your sample in 10-20µl of Elution Buffer 2 (EB2).
Optional
Samples are now ready for quality control, quantification, pooling, and sequencing.

Safe stopping point: samples can be stored at Temperature-20 °C
Optional
Protocol references

CITATION
Muruato A, Vu MN, Johnson BA, Davis-Gardner ME, Vanderheiden A, Lokugamage K, Schindewolf C, Crocquet-Valdes PA, Langsjoen RM, Plante JA, Plante KS, Weaver SC, Debbink K, Routh AL, Walker D, Suthar MS, Shi PY, Xie X, Menachery VD (2021). Mouse-adapted SARS-CoV-2 protects animals from lethal SARS-CoV challenge..

CITATION
Johnson BA, Zhou Y, Lokugamage KG, Vu MN, Bopp N, Crocquet-Valdes PA, Kalveram B, Schindewolf C, Liu Y, Scharton D, Plante JA, Xie X, Aguilar P, Weaver SC, Shi PY, Walker DH, Routh AL, Plante KS, Menachery VD (2022). Nucleocapsid mutations in SARS-CoV-2 augment replication and pathogenesis..

CITATION
Vu MN, Lokugamage KG, Plante JA, Scharton D, Bailey AO, Sotcheff S, Swetnam DM, Johnson BA, Schindewolf C, Alvarado RE, Crocquet-Valdes PA, Debbink K, Weaver SC, Walker DH, Russell WK, Routh AL, Plante KS, Menachery VD (2022). QTQTN motif upstream of the furin-cleavage site plays a key role in SARS-CoV-2 infection and pathogenesis..

CITATION
Johnson BA, Xie X, Bailey AL, Kalveram B, Lokugamage KG, Muruato A, Zou J, Zhang X, Juelich T, Smith JK, Zhang L, Bopp N, Schindewolf C, Vu M, Vanderheiden A, Winkler ES, Swetnam D, Plante JA, Aguilar P, Plante KS, Popov V, Lee B, Weaver SC, Suthar MS, Routh AL, Ren P, Ku Z, An Z, Debbink K, Diamond MS, Shi PY, Freiberg AN, Menachery VD (2021). Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis..

CITATION
Jaworski E, Langsjoen RM, Mitchell B, Judy B, Newman P, Plante JA, Plante KS, Miller AL, Zhou Y, Swetnam D, Sotcheff S, Morris V, Saada N, Machado RR, McConnell A, Widen SG, Thompson J, Dong J, Ren P, Pyles RB, Ksiazek TG, Menachery VD, Weaver SC, Routh AL (2021). Tiled-ClickSeq for targeted sequencing of complete coronavirus genomes with simultaneous capture of RNA recombination and minority variants..

CITATION
Jaworski E, Routh A (2018). ClickSeq: Replacing Fragmentation and Enzymatic Ligation with Click-Chemistry to Prevent Sequence Chimeras..

CITATION
Routh A, Head SR, Ordoukhanian P, Johnson JE (2015). ClickSeq: Fragmentation-Free Next-Generation Sequencing via Click Ligation of Adaptors to Stochastically Terminated 3'-Azido cDNAs..

Citations
Jaworski E, Langsjoen RM, Mitchell B, Judy B, Newman P, Plante JA, Plante KS, Miller AL, Zhou Y, Swetnam D, Sotcheff S, Morris V, Saada N, Machado RR, McConnell A, Widen SG, Thompson J, Dong J, Ren P, Pyles RB, Ksiazek TG, Menachery VD, Weaver SC, Routh AL. Tiled-ClickSeq for targeted sequencing of complete coronavirus genomes with simultaneous capture of RNA recombination and minority variants.
https://doi.org/10.7554/eLife.68479
Muruato A, Vu MN, Johnson BA, Davis-Gardner ME, Vanderheiden A, Lokugamage K, Schindewolf C, Crocquet-Valdes PA, Langsjoen RM, Plante JA, Plante KS, Weaver SC, Debbink K, Routh AL, Walker D, Suthar MS, Shi PY, Xie X, Menachery VD. Mouse-adapted SARS-CoV-2 protects animals from lethal SARS-CoV challenge.
https://doi.org/10.1371/journal.pbio.3001284
Johnson BA, Zhou Y, Lokugamage KG, Vu MN, Bopp N, Crocquet-Valdes PA, Kalveram B, Schindewolf C, Liu Y, Scharton D, Plante JA, Xie X, Aguilar P, Weaver SC, Shi PY, Walker DH, Routh AL, Plante KS, Menachery VD. Nucleocapsid mutations in SARS-CoV-2 augment replication and pathogenesis.
https://doi.org/10.1371/journal.ppat.1010627
Vu MN, Lokugamage KG, Plante JA, Scharton D, Bailey AO, Sotcheff S, Swetnam DM, Johnson BA, Schindewolf C, Alvarado RE, Crocquet-Valdes PA, Debbink K, Weaver SC, Walker DH, Russell WK, Routh AL, Plante KS, Menachery VD. QTQTN motif upstream of the furin-cleavage site plays a key role in SARS-CoV-2 infection and pathogenesis.
https://doi.org/10.1073/pnas.2205690119
Johnson BA, Xie X, Bailey AL, Kalveram B, Lokugamage KG, Muruato A, Zou J, Zhang X, Juelich T, Smith JK, Zhang L, Bopp N, Schindewolf C, Vu M, Vanderheiden A, Winkler ES, Swetnam D, Plante JA, Aguilar P, Plante KS, Popov V, Lee B, Weaver SC, Suthar MS, Routh AL, Ren P, Ku Z, An Z, Debbink K, Diamond MS, Shi PY, Freiberg AN, Menachery VD. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis.
https://doi.org/10.1038/s41586-021-03237-4
Jaworski E, Langsjoen RM, Mitchell B, Judy B, Newman P, Plante JA, Plante KS, Miller AL, Zhou Y, Swetnam D, Sotcheff S, Morris V, Saada N, Machado RR, McConnell A, Widen SG, Thompson J, Dong J, Ren P, Pyles RB, Ksiazek TG, Menachery VD, Weaver SC, Routh AL. Tiled-ClickSeq for targeted sequencing of complete coronavirus genomes with simultaneous capture of RNA recombination and minority variants.
https://doi.org/10.7554/eLife.68479
Jaworski E, Routh A. ClickSeq: Replacing Fragmentation and Enzymatic Ligation with Click-Chemistry to Prevent Sequence Chimeras.
https://doi.org/10.1007/978-1-4939-7514-3_6
Routh A, Head SR, Ordoukhanian P, Johnson JE. ClickSeq: Fragmentation-Free Next-Generation Sequencing via Click Ligation of Adaptors to Stochastically Terminated 3'-Azido cDNAs.
https://doi.org/10.1016/j.jmb.2015.06.011