Sep 10, 2021
Variant (E484K) ALERT - Ligation-Dependent Loop-Mediated Isothermal Amplification
- 1Oakland Genomics Center
Protocol Citation: Ali Bektas, Anitha Jayaprakash 2021. Variant (E484K) ALERT - Ligation-Dependent Loop-Mediated Isothermal Amplification. protocols.io https://dx.doi.org/10.17504/protocols.io.bxzjpp4n
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working but we are also developing and optimizing it.
Created: September 05, 2021
Last Modified: September 10, 2021
Protocol Integer ID: 53003
Funders Acknowledgements:
Just One Giant Lab
Grant ID: Covid19 Microgrant
Abstract
A 2-hour, 2-temperature protocol, using RNA templated DNA ligation, for the visual detection of the E484K mutation of concern pertaining to SARS-CoV-2.
N.B. This is the first version of this protocol, stay tuned for increased sensitivity and multiplexing (A.B.)
Protocol materials
SplintR Ligase - 1,250 unitsNew England BiolabsCatalog #M0375S
Bst 2.0 WarmStart DNA Polymerase - 8,000 unitsNew England BiolabsCatalog #M0538L
SYTO 9 fluorescent nucleic acid stainLife TechnologiesCatalog #S-34854
Magnesium Sulfate (MgSO4) Solution - 6.0 mlNew England BiolabsCatalog #B1003S
SplintR Ligase - 1,250 unitsNew England BiolabsCatalog #M0375S
Ligation Primers
Ligation Primers
Oligonucleotides used for RNA templated DNA ligation using SplintR Ligase - 1,250 unitsNew England BiolabsCatalog #M0375S
All sequences shown 5' to 3. Underlined segments are complementary to the target and bold nucleotide is specific to the G>A substitution at position 23012 resulting in the E484K amino acid change.
E484K-Donor
/5Phos/AACACCATTACAAGCTACGTACATGACATAATCCAAACTCATAAATTCTCGCATTTTAGATCCGTCTCCTTACAGGACACATCATCC
E484-Acceptor
CATCTCTAACTCTACTAAGACTTCCATTTATCAACAATAGCTGACATGTTCTAGCAGCGACAGGACACACGACAGGAGGAAAGTAACAATTAAAACCTTT
Ligation
Ligation
- Prepare ligation mix to use with previously isolated RNA. A standard Trizol/Chloroform method or column purification method for RNA isolation works well.
X1 Ligation mix (multiply for number of samples processed)
2 µL E484K-Donor (100nM)
2 µL E484K-Acceptor (100nM)
1 µL SplintR Buffer (NEB)
0.2 µL SplintR Ligase - 1,250 unitsNew England BiolabsCatalog #M0375S (NEB)
1.8 µL molecular biology grade water
- add 3 µL RNA per 7 µL of reaction mix for a 10 µL reaction volume
Incubate at 37 °C for 00:20:00 followed by a 00:20:00 at 65 °C
inactivation step.
40m
Place ligation reactions on ice.
LAMP Primers
LAMP Primers
Oligonucleotides used for Loop-Mediated Isothermal Amplification
all sequences shown 5' to 3'
FIP
CTTTCCTCCTGTCGTGTGTCCTCCATTTATCAACAATAGCTGAC
BIP
ACCTTTAACACCATTACAAGCTACGACGGATCTAAAATGCGAGAA
F3
CATCTCTAACTCTACTAAGACT
B3
GGATGATGTGTCCTGTAAGG
LAMP
LAMP
50m
50m
- Prepare LAMP mix.
X1 LAMP mix (multiply for number of samples processed)
2.5 µL Isothermal Buffer 1 (NEB)
0.5 µL Magnesium Sulfate (MgSO4) Solution - 6.0 mlNew England BiolabsCatalog #B1003S (100mM)
3.5 µL dNTPs (10µM)
0.8 µL FIP (50µM)
0.8 µL BIP (50µM)
0.5 µL F3 (10µM)
0.5 µL B3 (10µM)
0.1 µL SYTO 9 fluorescent nucleic acid stainLife TechnologiesCatalog #S-34854 (100µM)
1 µL Bst 2.0 WarmStart DNA Polymerase - 8,000 unitsNew England BiolabsCatalog #M0538L
11.8 µL Molecular Biology Grade water
- add 3 µL of the ligation product from the Ligation step to 22 µL of LAMP mix for a 25 µL reaction.
Incubate at 65 °C for 00:50:00
50m
Visualize reaction tubes over a UV transilluminator. Samples containing a G>A mutation at position 23012 will exhibit fluorescence.