Feb 28, 2023
uDumBell – Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosis
- 1University of California, San Francisco
Protocol Citation: Jason D Limberis 2023. uDumBell – Circularization of rv0678 for genotypic bedaquiline resistance testing of Mycobacterium tuberculosis. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqj9zyvk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 16, 2022
Last Modified: February 28, 2023
Protocol Integer ID: 70166
Abstract
The ligation of dumbbell (hairpin) oligos to linear dsDNA produces pseudo-circular DNA. Including deoxyUridine in the PCR primer sequences causes Q5 and other high-fidelity polymerases to arrest elongation. This results in overhangs that were successfully ligated to a complementary hairpin structure. The deoxyUridine reduced the PCR product by approximately two-thirds, but this was ameliorated by increasing the Q5 DNA polymerase concentration three-fold.
Attachments
222.png
441KB
Materials
Rv0678 amplification primers (you can use any primer set here, and multiplex them, these are not yet optimized, the random sequence is for blunt-end cloning to detect chimeras)
| A | B | |
| Forward primer | /5Phos/GUCTATTTTCTGTTGGTGCTGATATTGC | |
| Reverse primer | /5Phos/GUCTATACTTGCCTGTCGCTCTATCTTC |
| A | B | |
| uDumBell | /5Phos/ATAGACCGAGACAGTAGAAGACCATGAACAAGCAGCACACGATAAACTAGACACCCTACTGTCTCG |
Preferably PAGE purified
---
Q5 Hot Start High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0493L
Agencourt AMPure XPBeckman CoulterCatalog #A63880
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
Optinal
Exonuclease I (E.coli) - 15,000 unitsNew England BiolabsCatalog #M0293L
Exonuclease VIII truncatedNew England BiolabsCatalog #M0545S
Amplicon PCR
Amplicon PCR
| A | B | |
| Component | Volume (ul) | |
| 5X Reaction Buffer | 10 | |
| 5X Q5 High GC Enhancer | 10 | |
| 10 mM dNTPs | 1 | |
| Forward primer | 2.5 | |
| Reverse primer | 2.5 | |
| DNA (5ng) | 2 | |
| Q5 High-Fidelity DNA Polymerase | 1.5 | |
| Nuclease-Free Water | 20.5 |
PCR using primer set
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 98 | 30 | 1 | |
| Denaturation | 98 | 10 | 34 | |
| Annealing | 62 | 10 | ||
| Extension | 72 | 20 | ||
| Extension | 72 | 2 | 1 |
Cycle parameters
Adapter ligation
Adapter ligation
Prepare the dumbell (hairpin) by incubating at 80 °C followed by cooling to room temperature over 00:30:00 (this only needs to be done once)
30m
| A | B | |
| Component | Volume (ul) | |
| T4 DNA Ligase Buffer (10X) | 2 | |
| PCR product (upto 1ug), as low as 50ng, probably much lower possible) | 10 | |
| dumbell adapter | 3 | |
| Ligase (add last, don’t vortex) | 1 | |
| H20 | 4 |
Incubate as below, with the lid temperature set to 40 °C
| A | B | |
| Temp | Minutes | |
| 22 | 30 | |
| 15 | 120 | |
| 4 | 120 | |
| 65 | 5 |
Incubate at Room temperature for 00:05:00
Place on amagnetic rack
Aspirate supernatant
Add 200 µL 70 % (v/v) ethanol
Wait for 00:00:30
Aspirate and discard the supernatant
Add 200 µL 70 % (v/v) ethanol
Wait for 00:00:30
Aspirate and discard the supernatant
Resuspend beads in 20 µL of H20
Incubate for 00:02:00
Transfer to a clean PCR tube
8m
Exonuclease treatment – optional
Exonuclease treatment – optional
1h
1h
| A | B | |
| Component | Volume (ul) | |
| NEBuffer 4 (10x) | 1 | |
| Exonuclease VIII (truncated) | 1 | |
| DNA | 18 |
Incubate at 37 °C for 00:30:00
Stop reaction by adding EDTA to at least 11 mM.
Heat Inactivation 70 °C C for 00:30:00
1h