Aug 13, 2020
Target Guide Sequence Cloning Protocol Version 2
Forked from Target Guide Sequence Cloning Protocol
- 1Baylor College of Medicine
Protocol Citation: Skye Waterland, Yang Li 2020. Target Guide Sequence Cloning Protocol Version 2. protocols.io https://dx.doi.org/10.17504/protocols.io.bjp3kmqn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol in our workspace and it is working. This protocol is a revised version of the first Target Guide Sequence Cloning Protocol and is much easier to follow.
Created: August 13, 2020
Last Modified: August 13, 2020
Protocol Integer ID: 40411
Keywords: Lentivirus vector, cloning, vector digestion, oligo annealing, CRISPR,
Disclaimer
This protocol is a modified version of the Zhang Lab's GeCKOv2 Target Guide Sequence Cloning Protocol attached below based off of Joung, J., Konermann, S., Gootenberg, J.et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.Nat Protoc12,828–863 (2017).https://doi.org/10.1038/nprot.2017.016
Other protocols modified/used in this protocol:
Bacterial Transformation, Addgene: https://www.addgene.org/protocols/bacterial-transformation/
More information about the specific lentiGuide-puro plasmid can be found here: https://www.addgene.org/52963/.
Abstract
Create single gRNA vectors for targeted cloning utilizing CRISPR or CRISPR-based systems.
Image Attribution
https://www.addgene.org/52963/
Materials
MATERIALS
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
Agar
lentiGuide-PuroaddgeneCatalog #52963
double distilled water (ddH2O)
SOC Media
1X TAE Buffer
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
ethanol
10X PCR BufferLife TechnologiesCatalog #10966-034
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
BsmBI-v2New England BiolabsCatalog #R0739L
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
dNTP Set (100mM each A C G T)Ge HealthcareCatalog #95038-256
STEP MATERIALS
lentiGuide-PuroaddgeneCatalog #52963
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
BsmBI-v2New England BiolabsCatalog #R0739L
lentiGuide-PuroaddgeneCatalog #52963
BsmBI-v2New England BiolabsCatalog #R0739L
Agar
1X TAE Buffer
double distilled water (ddH2O)
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
ethanol
10X PCR BufferLife TechnologiesCatalog #10966-034
dNTP Set (100mM each A C G T)Ge HealthcareCatalog #95038-256
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
ddH20
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
SOC Media
Sigma-Aldrich: RRID:SCR_008988
Protocol materials
double distilled water (ddH2O)
lentiGuide-PuroaddgeneCatalog #52963
ddH20
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
10X NEB T4 DNA ligase bufferNew England Biolabs
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
ethanol
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
10X T4 PNK Reaction BufferNew England Biolabs
Agar
1X TAE Buffer
SOC Media
BsmBI-v2New England BiolabsCatalog #R0739L
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
Agar
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
ethanol
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
10X PCR BufferLife TechnologiesCatalog #10966-034
double distilled water (ddH2O)
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
lentiGuide-PuroaddgeneCatalog #52963
BsmBI-v2New England BiolabsCatalog #R0739L
BsmBI-v2New England BiolabsCatalog #R0739L
double distilled water (ddH2O)
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
1X TAE Buffer
SOC Media
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
lentiGuide-PuroaddgeneCatalog #52963
10X PCR BufferLife TechnologiesCatalog #10966-034
double distilled water (ddH2O)
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
10X NEB T4 DNA ligase bufferNew England Biolabs
lentiGuide-PuroaddgeneCatalog #52963
ddH20
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
BsmBI-v2New England BiolabsCatalog #R0739L
lentiGuide-PuroaddgeneCatalog #52963
Agar
1X TAE Buffer
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
BsmBI-v2New England BiolabsCatalog #R0739L
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
10X NEB T4 DNA ligase bufferNew England Biolabs
ddH20
double distilled water (ddH2O)
double distilled water (ddH2O)
ethanol
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
10X PCR BufferLife TechnologiesCatalog #10966-034
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
SOC Media
Before start
Lentiviral vector digestion
Lentiviral vector digestion
Digest and dephosphorylate
lentiGuide-PuroaddgeneCatalog #52963
Image attribution: https://www.addgene.org/52963/
Add 40 µL
ddH20
to a 1.5 mL
Equipment
Snap Cap Microcentrifuge Tube or equivalent
NAME
Polypropylene Microcentrifuge Tube
TYPE
Corning Costar Snap Cap Microcentrifuge Tube
BRAND
07200210
SKU
LINK
2 mL snap cap polypropylene micro tube
SPECIFICATIONS
.
Add 5 µL of
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
to solution.
Add 3 µL of
BsmBI-v2New England BiolabsCatalog #R0739L
to solution.
Note
*Note: we used BsmBI Cat #R0580, NEB, but this one has been discontinued. #R0739L is considered as an effective replacement.*
Add 2 µL of
lentiGuide-PuroaddgeneCatalog #52963
to solution.
Close cap on microcentrifuge tube and place in
Equipment
Mini-centrifuge
NAME
Centrifuge
TYPE
Fisher
BRAND
S67601B
SKU
LINK
Any standard mini centrifuge with adapters for different tube sizes will suffice
SPECIFICATIONS
for 00:00:10 on until all of the solution is at the bottom of the tube.
Place microcentrifuge tube with vector digestion mixture in a
Equipment
Oven
NAME
Oven forced-air convection
TYPE
Fisher Isotemp
BRAND
15-103-0510
SKU
LINK
on 55 °C
Close lid and set a timer for 01:00:00
Gel purify the digested plasmid from Step 1
Gel purify the digested plasmid from Step 1
Prepare gel
Create gel concentration of 1.2-1.5%
Agar
for 100 mL of
1X TAE Buffer
solution.
Run gel
Isolate 2kb and 8kb band. Collect 8kb (8318 bp) band for gel purification.
Preparing the gRNAs
Preparing the gRNAs
Create a dilution from stock oligos at a 1:10 ratio in
double distilled water (ddH2O)
.
Note
Diluted oligo concentration should be 10 micromolar (µM) .
Phosphorylate and anneal each pair of oligos
Phosphorylate and anneal each pair of oligos
Prepare phosphorylation/annealing reaction
Add6.5 µL
double distilled water (ddH2O)
to a microcentrifuge tube.
Add 1 µL each of 10 micromolar (µM) Oligo 1 (F), 10 micromolar (µM) Oligo 2 (R), and
10X NEB T4 DNA ligase bufferNew England Biolabs
Add 0.5 µL
10X T4 PNK Reaction BufferNew England Biolabs
Vortex and microcentrifuge
Place the phosphorylation/annealing reaction in a
Equipment
SimpliAmp Thermal Cycler
NAME
PCR
TYPE
Applied Biosystems
BRAND
A24811
SKU
LINK
Any standard PCR thermocycler will suffice
SPECIFICATIONS
Note
Settings should be as follows: 37 °C for 00:30:00 ,95 °C for 00:05:00 , and then ramp down to 25 °C at 5 °C /00:01:00 .
Setting up and incubating the ligation reaction
Setting up and incubating the ligation reaction
Making the ligation reaction
Place 4.8 µL of
double distilled water (ddH2O)
in a microcentrifuge tube.
Add 2.2 µL
BsmBI-v2New England BiolabsCatalog #R0739L
Add 1 µL each of
10X NEB T4 DNA ligase bufferNew England Biolabs
, diluted oligo duplex from go to step #7 , and
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
.
Lightly vortex and microcentrifuge
Incubate the ligation reaction at room temperature for02:00:00 -03:00:00
Transformation into E. coli bacteria
Transformation into E. coli bacteria
Prepare LB Agar plates
Wipe down your bench with at least 70%
ethanol
and light a bunsen burner.
Remove Agar Ampicillin Plates250 µL from 4 °C and let warm up to room temperature.
E. coli competent cell transfection
Take competent cells
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
out of -80 °C and thaw on ice (00:20:00 - 00:30:00 ).
Add 100 µL of E.coli cells to 10 µL of DNA in a microcentrifuge tube next to the bunsen burner.
Note
When working with the E. coli, be very diligent and make sure you are working in the sterile area of your bench near the bunsen burner flame.
Gently flick tube a few times with your finger to mix.
Incubate the competent cell/DNA mixture on ice for 00:30:00 .
Place transformation tube(s) into water bath at 42 °C for 00:00:30 -00:01:00 to heat shock E. coli cells.
Place the transformation tube(s) back on ice for 00:02:00 .
Add 250 µL
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
(without antibiotic) or
SOC Media
to the tube(s).
Place tube(s) in 37 °C shaking incubator for 00:45:00 -01:00:00 .
Plate all of transformation onto LB agar plate(s) with ampicillin. Incubate plates at 37 °C overnight.
Picking Colony for Suspension Growth
Picking Colony for Suspension Growth
Before you get started
Note
Start this whole section (picking colony and suspension growth) sometime in the late afternoon (~4-5pm), so that you can run PCR for the bacterial plasmids you collect the next morning (~16 hours later). More than 24 hours of incubation can cause other non-ampicillin resistant bacteria to grow in the suspension tubes.
Note
Set up an aseptic area for handling the bacterial colonies.
Picking colony
Pick 10-15 colonies from each agar plate to suspend in an LB solution.
Note
We originally selected only 4 colonies from each plate, but did not have a successful PCR. To increase chances of successfully amplifying the plasmid vector, we suggest picking 10-15 colonies.
Place each colony in a tube with 3 mL of LB.
Culture the bacteria
Place tubes into shaking incubator at 37 °C overnight.
Run PCR to Identify Positive Clones
Run PCR to Identify Positive Clones
Prepare Master PCR Mix by adding each of the below reagents to a microcentrifuge tube.
Note
Before you start: multiply each volume below by the same amount (x 10, 15, etc.) according to how much master mix you need to run your sets.
15.875 µL
ddH20
2.5 µL
10X PCR BufferLife TechnologiesCatalog #10966-034
0.5 µL 10 millimolar (mM)
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
2 µL 10 micromolar (µM) Forward Primer hU6-02
Note
Forward Primer hU6-02 sequence: TAATTAGAATTAATTTGACT
2 µL 10 micromolar (µM) Reverse Primer (gRNA reverse primer oligo)
0.125 µL
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
Loading and Prepping PCR wells
Aliquot equal proportions of master mix to each PCR well (we used 23 µL ).
Add 2 µL of each bacterial suspension sample from go to step #15 to each PCR well.
Note
Total volume of Master Mix and Sample should be 25 µL in each well.
Seal off PCR wells tightly with a clear plastic cover or tube tops.
Centrifuge 1200 rpm, 00:01:00 .
Place PCR reaction in thermocycler and run PCR.
Note
Settings should be as follows:
1) 95C for 5mins (ramp up).
2) 95C for 30sec.
3) 55C for 45 sec.
4) 72C for 45 sec.
- x35 cycles steps 2-4.
5) 72 for 10mins.
Running Gel for PCR Product Verification
Running Gel for PCR Product Verification
Prepare a gel of 2% concentration. Run gel and examine bands. Desired band length is about 200bp with the gRNA insertion.
Congrats!
Congrats!
You have successfully transformed a lentiviral vector with your gRNA sequence of interest! For confirmation, feel free to sequence your vector.