Aug 03, 2020
Target Guide Sequence Cloning Protocol
- 1Baylor College of Medicine
- Dr. Shen's Lab GroupTech. support email: Skye.Waterland@bcm.edu
Protocol Citation: Skye Waterland, Yang Li 2020. Target Guide Sequence Cloning Protocol . protocols.io https://dx.doi.org/10.17504/protocols.io.bij2kcqe
Manuscript citation:
Improved vectors and genome-wide libraries for CRISPR screening . Sanjana NE, Shalem O, Zhang F. Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038/nmeth.3047. 10.1038/nmeth.3047PubMed 25075903
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol in our workspace and it is working.
Created: July 14, 2020
Last Modified: August 03, 2020
Protocol Integer ID: 39258
Keywords: Lentivirus vector, cloning, vector digestion, oligo annealing, CRISPR,
Disclaimer
This protocol is a modified version of the Zhang Lab's GeCKOv2 Target Guide Sequence Cloning Protocol attached below based off of Joung, J., Konermann, S., Gootenberg, J.et al. Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.Nat Protoc12,828–863 (2017).https://doi.org/10.1038/nprot.2017.016
Other protocols modified/used in this protocol:
Bacterial Transformation, Addgene: https://www.addgene.org/protocols/bacterial-transformation/
More information about the specific lentiGuide-puro plasmid can be found here: https://www.addgene.org/52963/.
Abstract
Create single gRNA vectors for targeted cloning utilizing CRISPR or CRISPR-based systems.
Image Attribution
https://www.addgene.org/52963/
Materials
MATERIALS
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
Agar
lentiGuide-PuroaddgeneCatalog #52963
double distilled water (ddH2O)
SOC Media
1X TAE Buffer
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
ethanol
10X PCR BufferLife TechnologiesCatalog #10966-034
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
BsmBI-v2New England BiolabsCatalog #R0739L
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
dNTP Set (100mM each A C G T)Ge HealthcareCatalog #95038-256
STEP MATERIALS
lentiGuide-PuroaddgeneCatalog #52963
double distilled water (ddH2O)
10X T4 PNK Reaction BufferNew England Biolabs
double distilled water (ddH2O)
BsmBI-v2New England BiolabsCatalog #R0739L
BsmBI-v2New England BiolabsCatalog #R0739L
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
10X NEB T4 DNA ligase bufferNew England Biolabs
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
ethanol
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
SOC Media
Agar
1X TAE Buffer
10X PCR BufferLife TechnologiesCatalog #10966-034
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
dNTP Set (100mM each A C G T)Ge HealthcareCatalog #95038-256
ddH20
lentiGuide-PuroaddgeneCatalog #52963
BsmBI-v2New England BiolabsCatalog #R0739L
Sigma-Aldrich: RRID:SCR_008988
Protocol materials
double distilled water (ddH2O)
10X PCR BufferLife TechnologiesCatalog #10966-034
BsmBI-v2New England BiolabsCatalog #R0739L
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
10X T4 PNK Reaction BufferNew England Biolabs
double distilled water (ddH2O)
double distilled water (ddH2O)
ddH20
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
SOC Media
lentiGuide-PuroaddgeneCatalog #52963
1X TAE Buffer
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
lentiGuide-PuroaddgeneCatalog #52963
SOC Media
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
lentiGuide-PuroaddgeneCatalog #52963
Agar
BsmBI-v2New England BiolabsCatalog #R0739L
10X NEB T4 DNA ligase bufferNew England Biolabs
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
Agar
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
1X TAE Buffer
10X T4 PNK Reaction BufferNew England Biolabs
BsmBI-v2New England BiolabsCatalog #R0739L
BsmBI-v2New England BiolabsCatalog #R0739L
ethanol
ethanol
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
10X NEB T4 DNA ligase bufferNew England Biolabs
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
10X PCR BufferLife TechnologiesCatalog #10966-034
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
lentiGuide-PuroaddgeneCatalog #52963
BsmBI-v2New England BiolabsCatalog #R0739L
ddH20
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
BsmBI-v2New England BiolabsCatalog #R0739L
lentiGuide-PuroaddgeneCatalog #52963
1X TAE Buffer
Agar
double distilled water (ddH2O)
10X NEB T4 DNA ligase bufferNew England Biolabs
10X T4 PNK Reaction BufferNew England Biolabs
double distilled water (ddH2O)
double distilled water (ddH2O)
BsmBI-v2New England BiolabsCatalog #R0739L
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
10X NEB T4 DNA ligase bufferNew England Biolabs
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
SOC Media
ethanol
dNTP Set (100mM each A C G T)GE HealthcareCatalog #95038-256
10X PCR BufferLife TechnologiesCatalog #10966-034
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
ddH20
Before start
Lentiviral vector digestion
Lentiviral vector digestion
Digest and dephosphorylate2 µL (equivalent to 1µg) of the
lentiGuide-PuroaddgeneCatalog #52963
Image attribution: https://www.addgene.org/52963/
with
BsmBI-v2New England BiolabsCatalog #R0739L
for 03:30:00 at 37 °C .
Note
*Note: we used BsmBI Cat #R0580, NEB, but this one has been discontinued. #R0739L is considered as an effective replacement.*
Add 40 µL
ddH20
to a 1.5 mL
Equipment
Snap Cap Microcentrifuge Tube or equivalent
NAME
Polypropylene Microcentrifuge Tube
TYPE
Corning Costar Snap Cap Microcentrifuge Tube
BRAND
07200210
SKU
LINK
2 mL snap cap polypropylene micro tube
SPECIFICATIONS
.
Add 5 µL of
NEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S
to solution.
Add 3 µL of
BsmBI-v2New England BiolabsCatalog #R0739L
to solution.
Add 2 µL of
lentiGuide-PuroaddgeneCatalog #52963
to solution.
Close cap on microcentrifuge tube and place in
Equipment
Mini-centrifuge
NAME
Centrifuge
TYPE
Fisher
BRAND
S67601B
SKU
LINK
Any standard mini centrifuge with adapters for different tube sizes will suffice
SPECIFICATIONS
for 00:00:10 on until all of the solution is at the bottom of the tube.
Place microcentrifuge tube with vector digestion mixture in a
Equipment
Oven
NAME
Oven forced-air convection
TYPE
Fisher Isotemp
BRAND
15-103-0510
SKU
LINK
on 55 °C
Close lid and set a timer for 01:00:00
Gel purify the digested plasmid from Step 1
Gel purify the digested plasmid from Step 1
Prepare 1.2-1.5% gel of
Agar
for 100 mL of
1X TAE Buffer
solution.
Run gel and isolate 2kb and 8kb band. Collect 8kb (8318 bp) band for gel purification.
Preparing the gRNAs
Preparing the gRNAs
Create a dilution from stock oligos at a 1:10 ratio in
double distilled water (ddH2O)
.
Note
Diluted oligo concentration should be 10 micromolar (µM) .
Phosphorylate and anneal each pair of oligos
Phosphorylate and anneal each pair of oligos
Add6.5 µL
double distilled water (ddH2O)
to a microcentrifuge tube.
Add 1 µL each of 10 micromolar (µM) Oligo 1 (F), 10 micromolar (µM) Oligo 2 (R), and
10X NEB T4 DNA ligase bufferNew England Biolabs
Add 0.5 µL
10X T4 PNK Reaction BufferNew England Biolabs
Vortex, microcentrifuge, and then place phosphorylation/annealing reaction in a
Equipment
SimpliAmp Thermal Cycler
NAME
PCR
TYPE
Applied Biosystems
BRAND
A24811
SKU
LINK
Any standard PCR thermocycler will suffice
SPECIFICATIONS
with the following settings: 37 °C for 00:30:00 ,95 °C for 00:05:00 , and then ramp down to 25 °C at 5 °C /00:01:00 .
Setting up and incubating the ligation reaction
Setting up and incubating the ligation reaction
Place 4.8 µL of
double distilled water (ddH2O)
in a microcentrifuge tube.
Add 2.2 µL
BsmBI-v2New England BiolabsCatalog #R0739L
Add 1 µL each of
10X NEB T4 DNA ligase bufferNew England Biolabs
, diluted oligo duplex from go to step #6 , and
T4 DNA Ligase - 20,000 unitsNew England BiolabsCatalog #M0202S
.
Lightly vortex, microcentrifuge, and incubate at room temperature for02:00:00 -03:00:00
Transformation into E. coli bacteria
Transformation into E. coli bacteria
Take competent cells
One Shot™ TOP10 Chemically Competent E. coliThermo FisherCatalog #C404010
out of -80 °C and thaw on ice (00:20:00 - 00:30:00 ).
Remove Agar Ampicillin Plates250 µL from 4 °C and let warm up to room temperature.
Set up a sterile environment for your bench area by wiping down your bench with at least 70%
ethanol
and lighting a bunsen burner.
Add 100 µL of E.coli cells to 10 µL of DNA in a microcentrifuge tube next to the bunsen burner.
Note
When working with the E. coli, be very diligent and make sure you are working in the sterile area of your bench near the bunsen burner flame.
Gently flick tube a few times with your finger to mix.
Incubate the competent cell/DNA mixture on ice for 00:30:00 .
Heat shock transformation tube(s) by placing into water bath at 42 °C for 00:00:30 -00:01:00
Place the transformation tube(s) back on ice for 00:02:00 .
Add 250 µL
LB-Broth Miller (= LB mix)FormediumCatalog #LMM0104
(without antibiotic) or
SOC Media
to the tube(s).
Place tube(s) in 37 °C shaking incubator for 00:45:00 -01:00:00 .
Plate all of transformation onto LB agar plate(s) with ampicillin.
Incubate plates at 37 °C overnight.
Colony Selection and Suspension Growth
Colony Selection and Suspension Growth
Select 10-15 colonies from each agar plate to suspend in an LB solution.
Note
We originally selected only 4 colonies from each plate, but did not have a successful PCR. To increase chances of successfully amplifying the plasmid vector, we suggest picking 10-15 colonies.
Place each colony in a tube with 3 mL of LB.
Note
Reminder to work in an aseptic area when handling the bacterial colonies.
Place tubes into shaking incubator at 37 °C overnight.
Note
Strong suggestion to do this whole section sometime in the late afternoon (~4-5pm), so that you can run PCR for the bacterial plasmids you collect the next morning (~16 hours later). More than 24 hours of incubation can cause other non-ampicillin resistant bacteria to grow in the suspension tubes.
Run PCR for Bacterial Plasmids
Run PCR for Bacterial Plasmids
Proportions for the Master PCR Mix are below. Simply multiply each value by the same amount (x 10, 15, etc.) according to how much master mix you think you'll need to run your sets.
Add 15.875 µL
ddH20
, 2.5 µL
10X PCR BufferLife TechnologiesCatalog #10966-034
, 0.5 µL 10 millimolar (mM)
dNTP Set (100mM each A C G T)Ge HealthcareCatalog #95038-256
, 2 µL 10 micromolar (µM) Forward Primer hU6-02, 2 µL 10 micromolar (µM) Reverse Primer (gRNA reverse primer oligo), and 0.125 µL
HotStarTaq Plus DNA Polymerase (1000)QiagenCatalog #203605
to microcentrifuge tube.
Note
Forward Primer hU6-02 sequence: TAATTAGAATTAATTTGACT
Aliquot equal proportions of master mix to each PCR well (we used 23 µL ).
Add 2 µL of each bacterial suspension sample from go to step #21 to each PCR well.
Note
Total volume of Master Mix and Sample should be 25 µL in each well.
Seal off PCR wells tightly with a clear plastic cover or tube tops.
Centrifuge 1200 rpm, 00:01:00 .
Place in thermocycler and run PCR. Settings should be as follows:
1) 95C for 5mins (ramp up).
2) 95C for 30sec.
3) 55C for 45 sec.
4) 72C for 45 sec.
- x35 cycles steps 2-4.
5) 72 for 10mins.
Note
PCR product is about 200bp.
Running Gel for PCR
Running Gel for PCR
Prepare a gel of 2% concentration. Run gel and examine bands. Desired band length is about 200bp with the gRNA insertion.
Congrats!
Congrats!
You have successfully transformed a lentiviral vector with your gRNA sequence of interest! For confirmation, feel free to sequence your vector.