Nov 11, 2024
stilPCR (single-tube Illumina long read PCR) increases the effective sequencing length of Illumina, targeted next-generation sequencing
- Jason D Limberis1,
- Roland Nagel2,
- Soumitesh Chakravorty2,
- Dena Block2,
- Scott Dewell2,
- Alina Nalyvayko1,
- Zach Howard1,
- Grant Theron1,
- Rouxjeane Venter1,
- John Metcalfe1
- 1University of California, San Francisco;
- 2Cepheid Inc
- Main
Protocol Citation: Jason D Limberis, Roland Nagel, Soumitesh Chakravorty, Dena Block, Scott Dewell, Alina Nalyvayko, Zach Howard, Grant Theron, Rouxjeane Venter, John Metcalfe 2024. stilPCR (single-tube Illumina long read PCR) increases the effective sequencing length of Illumina, targeted next-generation sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.bp2l6xmn5lqe/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 06, 2023
Last Modified: November 11, 2024
Protocol Integer ID: 90500
Keywords: tuberculosis, illumina, NGS, sequecing
Funders Acknowledgement:
National Institute of Allergy and Infectious Diseases
Grant ID: R01AI177637
Abstract
Identifying pathogens, resistance-conferring mutations, and strain types through targeted amplicon sequencing is an important tool. However, due to the limitations of short read sequencing, many applications require the division of limited clinical samples. Here, we present stilPCR (single-tube Illumina long read PCR), which allows the generation of hemi-nested amplicons in a single tube, with Illumina indexes and adapters, effectively increasing the Illumina read length without increasing the input requirements of reagents or sample. We have successfully utilized stilPCR on clinical sputum from tuberculosis patients to detect drug resistance mutations.
Materials
Required
Q5 Hot Start High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0493L
Agencourt AmPure XP beadsContributed by usersCatalog #A63880
dNTPsContributed by users
A thermocycler and a qPCR machine
A magnetic rack
Optional
NEBNext Library Quant Kit for Illumina - 500 rxnsNew England BiolabsCatalog #E7630L
| A | B | C | |
| Primer Set | Direction | Sequence | |
| Rv0678_F1 | F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGTTCCAATCATCGCCCTCCGC | |
| Rv0678_F2 | F | ACACTCTTTCCCTACACGACGCTCTTCCGATCTTGACTCGGTTGGCGGGTCGA | |
| Rv0678_R | R | GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCCGTCTTGCTCGCCACCTC | |
| TruSeq_UT_i5_F | F | AATGATACGGCGACCACCGAGATCTACACTG[i5]ACTCTTTCCCTACACGACGCTCTTCCGATCT | |
| TruSeq_UT_i7_R | R | CAAGCAGAAGACGGCATACGAGAT[i7]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT |
Primer sequences used in this study.
Stage 1 PCR
Stage 1 PCR
| A | B | C | |
| COMPONENT | Conc. | 50ul | |
| Reaction Buffer | 5X | 10 | |
| GC Buffer | 5X | 10 | |
| 10 mM dNTPs | 10 mM | 1 | |
| Q5 High-Fidelity DNA Polymerase | 2000 units/ml | 0.5 | |
| Rv0678_F1 | 10 µM | 1 | |
| Rv0678_R | 10 µM | 0.5 | |
| TruSeq_UT_A702_R | 10 µM | 0.5 | |
| BSA | 20 mg/ml | 5 | |
| Template DNA | variable | 5 | |
| Nuclease-Free Water | NA | 17 |
The total volume is 50ul at this stage
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 98 | 120 | 1 | |
| Denaturation | 98 | 10 | 4 | |
| Annealing | 64 | 20 | ||
| Extension | 72 | 120 | ||
| Denaturation | 98 | 10 | 18 | |
| Annealing | 65 | 15 | ||
| Extension | 72 | 60 | ||
| Extension | 4 | Forever | 1 |
Cycle parameters
As soon as the sample hits 4 °C , proceed to step 2.
Stage 2 PCR
Stage 2 PCR
Add in the below to the same reaction tube.
| A | B | C | |
| COMPONENT | Conc. | 50ul | |
| Reaction Buffer | 5X | 1 | |
| Rv0678_F2 | 10 µM | 0.5 | |
| TruSeq_UT_A503_F | 10 µM | 1.5 | |
| TruSeq_UT_A702_R | 10 µM | 1.5 |
The total volume is 55ul at this stage
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 98 | 10 | 1 | |
| Denaturation | 98 | 10 | 12 | |
| Annealing | 65 | 15 | ||
| Extension | 72 | 60 | ||
| Extension | 72 | 120 | 1 |
Cycle parameters
Bead cleanup
Bead cleanup
Add 25 µL (1X) of resuspended AMPure XP Beads to the sample
Mix by pipetting 10x
Incubate 00:02:00 at Room temperature
Place on the magnet, allow the beads to aggregate, and remove and discard the supernatant
Add 200 µL 70 % (v/v) ethanol and incubate (still on the magnet) for 00:00:30
Remove the supernatant
Repeat for a total of 2 washes
Air dry for00:00:30 , don't allow the beads to become cracked
Immediately after the bead pellet becomes opaque, remove the tube from magnetic rack and resuspend in 20 µL of Low EDTA Tris Buffer. Ensure all beads are in solution.
Incubate at room temperature for 00:05:00
Place on magnetic rack, wait for the solution to become clear ~00:02:00 , and transfer the eluted DNA to a new well-labeled tube
Optional: NEB Illumina Quantification
Optional: NEB Illumina Quantification
Thaw the NEBNext Library Quant Master Mix and NEBNext Library Quant Primer Mix. Ensure mixing of NEBNext Library Quant Primer Mix by vortexing. Place reagents on ice.
Thaw the NEBNext Library Quant DNA Standards, tubes 1–6.
Mix by pulse vortexing on a low setting. Briefly spin to collect material from the sides of the tubes. Place on ice.
Thaw the NEBNext Library Quant Dilution Buffer (10X). Mix well by vortexing.
Centrifuge briefly to collect material from the sides of the tube.
Place on ice.
Add 100 µL NEBNext Library Quant Primer Mix to the tube of NEBNext Library Quant Master Mix (1.5 mL ). Mix by vortexing. Write the date on the master mix tube to indicate that primer mix has been added.
Dilute the NEBNext Library Quant Dilution Buffer (10X) 1:10 with nuclease-free water. Mix by vortexing.
Prepare sufficient buffer for quantitating the desired number of libraries, allowing 1.2 mL for each library.
Prepare a 1:1,000 dilution of each library sample in NEBNext Library Quant Dilution Buffer (1X)
Aliquot 16 µL NEBNext Library Quant Master Mix (with primers) to each well
Add-in 4 µL of sample or standard per well
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 95 | 60 | 1 | |
| Denaturation | 95 | 15 | 35 | |
| Annealing | 63 | 45 |
Cycle parameters
A denaturation/melt curve can be included if desired, but is optional.
| A | B | |
| Sample | Conc. (pM) | |
| DNA Standard 1 | 100 | |
| DNA Standard 2 | 10 | |
| DNA Standard 3 | 1 | |
| DNA Standard 4 | 0.1 | |
| DNA Standard 5 | 0.01 | |
| DNA Standard 6 | 0.001 |
Adjusted Conc. = Calculated Conc. × 399 / library size (bp)
For library size, use the average of the two amplicon sizes.
Data processing
Data processing
bash stilPCR.sh \
--R1 "test_data/read_R1_001.fastq.gz" \
--R2 "test_data/read_R2_001.fastq.gz" \
--ref "refs/BDQ_duplex.fasta" \
--primers "refs/primers.bed"
Expected Outcome
Expected Outcome
Successful sequencing of rv0678 and its promoter region using stilPCR. The plot shows the coverage (y-axis) at each position (x-axis) along the sequence amplicons. The coding region is denoted by the grey line at the top of the figure. The positions of forward primer sequencing amplicons are shown in orange at the bottom of each plot, with reverse primer amplicons in pink.