Mar 28, 2025

Public workspaceStandard Uniplex PCR SOP for Escherichia coli and Salmonella

DOI
dx.doi.org/10.17504/protocols.io.dm6gp9km1vzp/v1
  • 1USDA-ARS;
  • 2USDA - ARS
Justine C. Condon
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.dm6gp9km1vzp/v1
Protocol Citation: Justine C. Condon, Lisa M. Durso 2025. Standard Uniplex PCR SOP for Escherichia coli and Salmonella. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gp9km1vzp/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 18, 2025
Last Modified: March 28, 2025
Protocol Integer ID: 121937
Keywords: Gel Electrophoresis , PCR, Primers, invA, uidA, E. coli, Salmonella, Escherichia coli, Polymerase Chain Reaction, Pathogen Indicators
Disclaimer
The use of trade, firm, or corporation names in this publication (or page) is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable.
Abstract
To describe the procedures on how to set-up polymerase chain reaction (PCR) and process gel electrophoresis for the detection of Escherichia coli (E. coli) and Salmonella.
Guidelines
Scope

E. coli is a gram-negative rods genus belonging to the Enterobacteriaceae family. They are commonly found in the lower intestinal regions of humans and animals. Most are part of the normal microbiota and can be harmless or beneficial. Some serotypes are pathogenic and can cause severe gastrointestinal illness as a food-borne disease. (WHO, 2018). The uidA gene, which encodes the beta-glucuronidase enzyme, was detected in 97.7% of 435 Escherichia coli isolates (Martins, 1993) and is used as an indicator of E. coli.
Salmonella is a gram-negative rods genus belonging to the Enterobacteriaceae family. Salmonella is a ubiquitous and hardy bacterium that can survive several weeks in a dry environment and several months in water. (WHO, 2018). Many Salmonella serovars have a broad host range and can infect a wide variety of animals, including mammals, birds, reptiles, amphibians, and insects. In addition, Salmonella can grow in plants and can survive in protozoa, soil, and water. (Silva, 2014). They are a group of bacteria that can cause gastrointestinal illness and fever called salmonellosis. It’s a common food-borne illness often spread through contaminated food items, or direct contact with infected animals and feces. invA is a common molecular target for Salmonella-specific detection methods and is recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual as a target for PCR confirmation of putative Salmonella isolates (Buehler, 2019).
Pathogens and antimicrobial resistance are a global public health concern, and tracking indicators assist in surveillance and mitigation efforts. This protocol describes the procedures used to detect the presence of the uidA gene from E. coli and invA gene from Salmonella using standard PCR, with detection via gel electrophoresis.

Responsibility

This SOP applies to all staff members and students. These individuals must be knowledgeable about the requirements set forth within this document. The lab manager or designee shall ensure that all staff and students know the proper techniques.
Materials
PCR

  • Forward and Reverse Primers (IDT, Coralville, IA) for:
  1. invA - Salmonella (Sequences in Table 2)
  2. uidA – E. coli (Sequences in Table 4)
  • ReagentJumpStart™ REDTaq® ReadyMix™ Reaction MixMerck MilliporeSigma (Sigma-Aldrich)Catalog #P0982-800RXN , St. Louis, MO)
  • ReagentMolecular Biology Grade WaterHyCloneCatalog #SH30538.01 , St. Louis, MO)
  • Positive Control – Salmonella typhimurium (for invA)
  • Positive Control – STEC O157 (for uidA)
  • PCR Prep Cabinet (3620804 Labconco, Kansas City, MO)
  • 0.2mL x 8 PCR reaction strips (T320-2N, Simport, Quebec, Canada)
  • 2mL sterile microcentrifuge tube (02.681.299 Fisher Scientific, Pittsburg, PA)
  • Aerosol-barrier, no-retention pipette tips for various volumes from 1-1000µL
  • Pipettors for various volumes from 1-1000µL
  • Thermal cycler (T100, BioRad, Hercules, CA)
  • Mini Centrifuge (C1301P, Labnet International, Big Flats, NY)

Gel Electrophoresis

  1. ReagentAgaroseMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9539 500g, St. Louis, MO)
  2. 1X Sodium Borate (SB) Buffer (SB20-4 20X SB Buffer FasterBetter Media, Hunt Valley, MD) (Recipe Appendix A - Step 34)
  3. Microwave
  4. Silicone Hot-Pad gloves
  5. ReagentSYBR™ Safe DNA Gel StainThermo Fisher ScientificCatalog #S33102 , Carlsbad, CA)
  6. PCR amplicons
  7. ReagentDirectLoad™ PCR 100 bp Low LadderMerck MilliporeSigma (Sigma-Aldrich)Catalog #D3687-1VL , St. Louis, MO)
  8. 500mL or 1-Liter sterile Pyrex glass bottle
  9. Gel casting tray, gel combs, and gel boat
  10. Electrophoresis machine (PowerEase 300W, Life Technologies, Carlsbad, CA)
  11. Micro-Pipettors and appropriate tips (10-20µL)
  12. Gel imaging apparatus (Gel Doc XR+, BioRad, Hercules, CA)
  13. Lighter

Procedure - invA for Salmonella PCR
Procedure - invA for Salmonella PCR
15m 20s
15m 20s
If frozen, thaw all reagents and samples and keep on an ice block or ice for stability. If kept in the refrigerator, keep there until ready for use, and keep on an ice block or ice for stability when in use.

Label tubes for the samples and controls.

Prepare the PCR Prep area for setting up a PCR reaction to eliminate contamination – UV PCR tubes, PCR water, and centrifuge tube for at least Duration00:15:00 .

15m
Combine the Master Mix components for the number of reactions (allow for 10% extra Master Mix) using the recipe from Table 1 with the correct primer sets in Table 2 for Amount25 µL reactions.

  • Before adding to the Master Mix - mix the primers by aspirating and expelling with the pipette tip.
  • Vortex the completed Master Mix for at least Duration00:00:20 . Centrifuge briefly.
ABCD
ComponentDescriptionVolume/RXN (µL)Final Concentration
TAQJumpStart RedTaq ReadyMix Reaction Mix (P0982)12.51X
PCR WaterPCR Water (HyClone SH30538.01)7.3N/A
Primer 1Forward Primer (100µM)0.12µM
Primer 2Reverse Primer (100µM)0.12µM
SampleTemplate51µL
Table 1. PCR Master Mix recipe. 25µl total reaction volume.
ABCDEFG
GeneTypeSequence 5' to 3'TM (°C)TC ConditionsAmplicon Size (bp)Sequence Reference
invAForward (invA139) Reverse (invA 141)GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC641 cycle at 94°C for 10 min; 30 cycles at 94°C for 30 sec, 64°C for 30 sec, 72°C for 30 sec; 1 cycle at 72°C for 5 min.284Rahn et al., 1992
Table2. Primer sequences, melting temperature, and thermal cycling conditions.
20s
Centrifigation

Note
Check the pipette’s volume as you go along, making sure it is exactly at the correct volume.

Carefully pipette Amount5 µL of PCR Water to the non-template control (NTC) tube.

Pipetting
Add Amount20 µL of Master Mix to each labeled PCR tube.

Pipetting
Next, gently vortex to mix then pipette Amount5 µL of sample (Amount5 µL of working stock; or Amount1 µL straight DNA + Amount4 µL PCR water) into its same labeled tube.

Note
  • Use a new pipette tip for each sample
  • To make a working stock dilution, see SOP: IDT Primer and gBlock Hydration and Aliquots

Pipetting
Add Amount1 µL of positive control (mix first by aspirating and expelling with the pipette tip) to its same labeled tube.

Pipetting
Centrifuge the strip tubes so that the entire volume is at the bottom.

Note
Make sure the centrifuge is balanced with both sides containing tubes.

Centrifigation
Load the tubes into the Thermocycler, keeping them in order.

Find the programmed gene conditions and double check that they match the conditions listed in Table 2.
ABCDEFG
GeneTypeSequence 5' to 3'TM (°C)TC ConditionsAmplicon Size (bp)Sequence Reference
invAForward (invA139) Reverse (invA 141)GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC641 cycle at 94°C for 10 min; 30 cycles at 94°C for 30 sec, 64°C for 30 sec, 72°C for 30 sec; 1 cycle at 72°C for 5 min.284Rahn et al., 1992
Table2. Primer sequences, melting temperature, and thermal cycling conditions.
Run PCR

When cycle is complete:

  • Gel electrophoresis (See Section Procedure Gel Electrophoresis Go togo to step #17 ) OR
  • Store the tubes in a labeled rack at Temperature-20 °C until ready to run a gel.
  • Turn off the Thermocycler.


Procedure - uidA for E. coli PCR
Procedure - uidA for E. coli PCR
20s
20s
Follow Steps 1 – 3 Go togo to step #1 to prep for PCR.

Combine the Master Mix components for the number of reactions (allow for 10% extra Master Mix) using the recipe from Table 3 with the correct primer sets in Table 4 for Amount25 µL reactions.

  • Before adding to the Master Mix - mix the primers by aspirating and expelling with the pipette tip.
  • Vortex the completed Master Mix for at least Duration00:00:20 .
ABCD
ComponentDescriptionVolume/RXN (µL)Final Concentration
TAQJumpStart RedTaq ReadyMix Reaction Mix (P0982)12.51X
PCR WaterPCR Water (HyClone SH30538.01)7.3N/A
Primer 1Forward Primer (100µM)0.12µM
Primer 2Reverse Primer (100µM)0.12µM
SampleTemplate51µL
Table 3. PCR Master Mix recipe. 25µl total reaction volume
ABCDEFG
GeneTypeSequence 5’ to 3’TM (°C)TC ConditionsAmplicon Size (bp)Sequence Reference
uidAForward (uidA241) Reverse (uidA383)CAGTCTGGATCGCGAAAACTG ACCAGACGTTGCCCACATAATT631 cycle at 95°C for 1 min; 40 cycles at 94°C for 10 sec, 63°C for 40 sec, 72°C for 30 sec; 1 cycle at 72°C for 5 min.142USDA SOP: MDP-MTH-11
Table 4. Primer sequences, melting temperature, and thermal cycling conditions.
20s
Follow Steps 5 – 13 Go togo to step #5 using Table 4 to run the PCR.

  • Since the total reaction volume is Amount25 µL , pipette Amount20 µL of Master mix into each tube then Amount5 µL of sample or Amount1 µL control.

Pipetting
Procedure - Gel Electrophoresis
Procedure - Gel Electrophoresis
2h 11m 30s
2h 11m 30s
Using a spoon, measure out Amount2.6 g of powdered agarose into a weigh boat.

Measure Amount260 mL of 1X SB buffer into a graduated cylinder.

Add powdered agarose and 1X SB into 1L bottle and swirl to mix.

Pipetting
Mix
Microwave SB and agarose mixture for Duration00:01:00 with bottle lid LOOSE.

1m
Remove bottle from microwave (using hot pad gloves), tighten the lid and gently swirl.

LOOSEN the lid and put in microwave for another minute.

Check mixture visually, if flecks are present repeat Go togo to step #21 , loosen lid and microwave again for Duration00:00:30 .

30s
Add Amount26 µL of SYBR safe to the molten gel.

Pipetting
Swirl gently with a loose lid to distribute the SYBR.

Place bottle in 55°C water bath for Duration00:10:00 to temper.

10m
While the mixture is tempering, set up gel cast by putting two plastic stoppers into the ends of the cast, with the orange rubber side of the stopper facing out.

Put two (or three) 36-well combs into the first and fourth notches of the gel cast (gel cast is right side up if first notch is close to the top of the cast).

After the gel has tempered, slowly pour it (using hot pad gloves) into the gel cast.

If there are any noticeable bubbles, take a lighter and hold it over the bubble, which should make it pop.

Cover gel loosely with foil and allow it to set (up to an hour) before use.

Make sure SB gel goes into a gel boat with SB buffer.

Electrophoresis Conditions

Amount10 µL of PCR amplicon will go into a well, flanked by Amount5 µL of ladder.

Run at 120 V for Duration02:00:00 in 1X SB buffer.

2h
Remove processed gel and analyze using a gel doc (BioRad Gel Doc).

Samples with a positive band will be confirmed on qPCR (See SOP: 5-Gene Uniplex Probe-Based qPCR SOP).

Appendix A – Recipes
Appendix A – Recipes
1x SB Buffer Stock – 10 liters

Directions to make 10L:

Prepare a clean, Amount10 L carboy.

In a graduated cylinder, measure out Amount500 mL of 20x SB, and pour into the carboy.

In a graduated cylinder, measure out Amount9500 mL of dH2O, and pour into the carboy.

Put the cap on tight, and swirl gently to mix.

Autoclave the carboy.

  • Place autoclave tape on the cap, and write SB on the tape
  • Put carboy in a large autoclave bin
  • Loosen the cap
  • Autoclave at Temperature121 °C
  • Label and store at TemperatureRoom temperature .

Protocol references
1. Buehler , Ariel J., Martin Wiedmann, Zeina Kassaify, Rachel A. Cheng. Evaluation of invA Diversity among Salmonella Species Suggests Why Some Commercially Available Rapid Detection Kits May Fail To Detect Multiple Salmonella Subspecies and Species. Journal of Food Protection, Volume 82, Issue 4, 2019, Pages 710-717. ISSN 0362-028X. https://doi.org/10.4315/0362-028X.JFP-18-525.

2. Martins MT, Rivera IG, Clark DL, Stewart MH, Wolfe RL, Olson BH. Distribution of uidA gene sequences in Escherichia coli isolates in water sources and comparison with the expression of beta-glucuronidase activity in 4-methylumbelliferyl-beta-D-glucuronide media. Appl Environ Microbiol. 1993 Jul;59(7):2271-6. doi: 10.1128/aem.59.7.2271-2276.1993. PMID: 8357258; PMCID: PMC182268.

3. Rahn, K., S. A. De Grandis, R. C. Clarke, S. A. McEwen, J. E. Gala´n, C. Ginocchio, R. Curtiss III, and C. L. Gyles. 1992. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol. Cell. Probes 6:271–279.

4. Schwesig, D., Borchers, U., Chancerelle, L., Duffek, A., Eriksson, U., Goksoyr, A., Lamoree, M., Lepom, P., Leonards, P., Leverett, D., McLachlan, M., Poulsen, V., Robinson, R., Silharova, K., Tolgyessy, P., Wegener, JW., Westwood, D. 2009. NORMAN Network of reference laboratories and related organisations for monitoring and bio-monitoring of emerging environmental pollutants. European Commission, Contract no018486, V4.1.

5. Silva, C., Calva, E., & Maloy, S. (2014). One Health and Food-Borne Disease: Salmonella Transmission between Humans, Animals, and Plants. Microbiology Spectrum, 2(1). https://doi.org/10.1128/microbiolspec.oh-0020-2013

6. USDA, MDP-MTH-11. 2011. Real-time PCR Detection of Shiga-toxin Producing Escherichia coli (STEC), Serotype O157 and non-O157 in Fresh Produce and Food with non-O157 Isolation and Identification. Real-time PCR Detection of STEC (usda.gov)