Dec 12, 2024
Version 1
spotPCR: A Rapid and Efficient Approach for Indexing Individual Template Molecules using Unique Molecular Identifiers V.1
- 1University of California, San Francisco
Protocol Citation: Jason D Limberis 2024. spotPCR: A Rapid and Efficient Approach for Indexing Individual Template Molecules using Unique Molecular Identifiers. protocols.io https://dx.doi.org/10.17504/protocols.io.261ged66wv47/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: June 17, 2023
Last Modified: December 12, 2024
Protocol Integer ID: 83554
Funders Acknowledgements:
John Metcalfe
Grant ID: R01AI177637
Abstract
Low-frequency mutations provide valuable insights in various fields, including drug resistance identification, cancer and infectious disease research. One promising strategy to enhance the sensitivity and specificity of mutation detection is the incorporation of unique molecular identifiers (UMIs) during polymerase chain reaction (PCR) amplification and before deep sequencing. However, conventional methods for UMI incorporation often necessitate multiple labor-intensive steps. spotPCR (Specific Primer Limited Unique Molecular Identifier Tagging PCR) overcomes these challenges, streamlining the UMI tagging process.
Materials
Required
Q5 Hot Start High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0493L
Agencourt AmPure XP beadsContributed by usersCatalog #A63880
dNTPsContributed by users
A thermocycler and a qPCR machine
A magnetic rack
Optional
NEBNext Library Quant Kit for Illumina - 500 rxnsNew England BiolabsCatalog #E7630L
| A | B | C | |
| Primer Set | Direction | Sequence | |
| pncA | F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGCGGCGTCATGGACCCTAT | |
| pncA | R | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNNNNNTTTCGAAGCCGCTGTACGCTCC | |
| gyrA | F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGTCACCCGCAACGCCAAGGAT | |
| gyrA | R | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNNNNNTTATTGCCTGGCGAGCCGAAGT | |
| Illumina adapter primer | F | CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG | |
| Illumina adapter primer | R | AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG |
You can use any compatable Illumina adapters such as the IDT for Illumina DNA/RNA UD Indexes.
Stage 1 PCR
Stage 1 PCR
| A | B | |
| COMPONENT | Volume (µl) | |
| 5X Q5 Reaction Buffer | 5 | |
| 5X Q5 High GC Buffer | 5 | |
| 10 mM dNTPs | 0.5 | |
| Q5 High-Fidelity DNA Polymerase | 0.25 | |
| 1µM Forward primer 1 | 1 | |
| 1µM Forward primer 2 | 1 | |
| 0.0625µM Reverse primer 1* | 1 | |
| 0.625µM Reverse primer 2* | 1 | |
| Template DNA | 2 | |
| Nuclease-Free Water | 6.25 |
*We recommend doing a dilution series starting at 500fM to asses new primersets.
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 98 | 120 | 1 | |
| Denaturation | 98 | 10 | 3 | |
| Annealing | 62 | 45 | ||
| Extension | 72 | 120 | ||
| Extension | 4 | Forever | 1 |
Cycle parameters. Three cycles are performed to ensure there are amplicon copies with Illumina tags on both ends.
Stage 2 PCR
Stage 2 PCR
Add the below into the reaction while at 4 °C and proceed to the second PCR cycling
| A | B | |
| COMPONENT | Volume (µl) | |
| Illumina adapter primer F (10uM) | 1 | |
| Illumina adapter primer R (10uM) | 1 |
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 98 | 120 | 1 | |
| Denaturation | 98 | 5 | 34 | |
| Annealing | 65 | 15 | ||
| Extension | 72 | 20 | ||
| Extension | 4 | Forever | 1 |
Cycle parameters
Bead cleanup
Bead cleanup
21m
21m
Add 25 µL (1X) of resuspended AMPure XP Beads to the sample
Mix by pipetting 10x
Incubate 00:02:00 at Room temperature
2m
Place on the magnet, allow the beads to aggregate, and remove and discard the supernatant
Add 200 µL 70 % (v/v) ethanol and incubate (still on the magnet) for 00:00:30
30s
Remove the supernatant
Repeat go to step #6 for a total of 2 washes
Air dry for00:00:30 , don't allow the beads to become cracked
30s
Immediately after the bead pellet becomes opaque, remove the tube from magnetic rack and resuspend in 20 µL of Low EDTA Tris Buffer. Ensure all beads are in solution.
Incubate at room temperature for 00:05:00
Place on magnetic rack, wait for the solution to become clear ~00:02:00 , and transfer the eluted DNA to a new well-labeled tube
Optional: NEB Illumina Quantification
Optional: NEB Illumina Quantification
Thaw the NEBNext Library Quant Master Mix and NEBNext Library Quant Primer Mix. Ensure mixing of NEBNext Library Quant Primer Mix by vortexing. Place reagents on ice.
Thaw the NEBNext Library Quant DNA Standards, tubes 1–6.
Mix by pulse vortexing on a low setting. Briefly spin to collect material from the sides of the tubes. Place on ice.
Thaw the NEBNext Library Quant Dilution Buffer (10X). Mix well by vortexing.
Centrifuge briefly to collect material from the sides of the tube.
Place on ice.
Add 100 µL NEBNext Library Quant Primer Mix to the tube of NEBNext Library Quant Master Mix (1.5 mL ). Mix by vortexing. Write the date on the master mix tube to indicate that primer mix has been added.
Dilute the NEBNext Library Quant Dilution Buffer (10X) 1:10 with nuclease-free water. Mix by vortexing.
Prepare sufficient buffer for quantitating the desired number of libraries, allowing 1.2 mL for each library.
Prepare a 1:1,000 dilution of each library sample in NEBNext Library Quant Dilution Buffer (1X)
Aliquot 16 µL NEBNext Library Quant Master Mix (with primers) to each well
Add-in 4 µL of sample or standard per well
| A | B | C | D | |
| Step | Temp (C) | Time (s) | Cycles | |
| Denaturation | 95 | 60 | 1 | |
| Denaturation | 95 | 15 | 35 | |
| Annealing | 63 | 45 |
Cycle parameters
A denaturation/melt curve can be included if desired, but is optional.
| A | B | |
| Sample | Conc. (pM) | |
| DNA Standard 1 | 100 | |
| DNA Standard 2 | 10 | |
| DNA Standard 3 | 1 | |
| DNA Standard 4 | 0.1 | |
| DNA Standard 5 | 0.01 | |
| DNA Standard 6 | 0.001 |
Adjusted Conc. = Calculated Conc. × 399 / library size (bp)
Analysis
Analysis
bash spotPCR_process.sh \
-R1 "Read1.fastq" \
-R2 "Read2.fastq" \
-Ref_name "Reference.fasta" \
-sample_name "SampleName" \
-threads "Threads" \
-umi "UMI_Barcode_Pattern"
The output will allow you to determine if there was sufficient UNI tagging of the amplicons or if a lower initial primer concentration is needed.