snmCAT_V2

Bang-An Wang; Chongyuan Luo; Hanqing Liu; Anna Bartlett; Rosa Castanon; Joseph Ecker

Nov 24, 2021

Version 2

snmCAT_V2 V.2

DOI

dx.doi.org/10.17504/protocols.io.x54v9jby1g3e/v2

Bang-An Wang^1,2,
Chongyuan Luo³,
Hanqing Liu^1,2,
Anna Bartlett^1,2,
Rosa Castanon^1,2,
Joseph Ecker^1,2

¹Genomic Analysis Laboratory, The Salk Institute for Biological Studies;
²Howard Hughes Medical Institute,;
³Department of Human Genetics, UCLA

Joseph Ecker: PI;

Human Cell Atlas Method Development Community
IGVF

Bang-An Wang

Salk Institute

DOI: dx.doi.org/10.17504/protocols.io.x54v9jby1g3e/v2

Protocol Citation: Bang-An Wang, Chongyuan Luo, Hanqing Liu, Anna Bartlett, Rosa Castanon, Joseph Ecker 2021. snmCAT_V2. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9jby1g3e/v2Version created by Bang-An Wang

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it’s working

Created: July 23, 2021

Last Modified: November 24, 2021

Protocol Integer ID: 51808

Abstract

To comprehensively assess the molecular phenotypes of single cells in tissues, we devised single-nucleus methylCytosine, Chromatin accessibility and Transcriptome sequencing (snmCAT-seq) and applied it to various sample sources, like culture cells, fresh/frozen mice tissues (brain, liver, pancreases etc) and postmortem human frontal cortex tissue.

Guidelines

For details, please refer to the publications below:

Luo, C., Rivkin, A., Zhou, J., Sandoval, J.P., Kurihara, L., Lucero, J., Castanon, R., Nery, J.R., Pinto-Duarte, A., Bui, B., et al. (2018). Robust single-cell DNA methylome profiling with snmC-seq2. Nat. Commun. 9, 3824.

Luo, C., Liu, H., Xie, F., Armand, E.J., Siletti, K., Bakken, T., Fang, R., Doyle, W.I., Hodge, R.D., Hu, L., et al. (2019). Single nucleus multi-omics links human cortical cell regulatory genome diversity to disease risk variants. bioRxiv.

• For troubleshooting: feel free to leave comments or message directly.

Materials

Reagents
RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific 10777019)
SUPERase• In™ RNase Inhibitor (ThermoFisher Scientific AM2694)
Protease Inhibitor Cocktail (Sigma-Aldrich P8340)
Hoechst 33342 Solution (20 mM) (ThermoFisher 62249)
OptiPrep™ Density Gradient Medium (Sigma-Aldrich D1556)
Dounce tissue grinder set (2 mL) (Sigma-Aldrich D8938)
Dounce tissue grinder set (7 mL) (Sigma-Aldrich D9063)
UltraPure™ BSA (50 mg/mL) (ThermoFisher AM2618)
DPBS (1X) (ThermoFisher 14190144)
GpC Methyltransferase M.CviPI (NEB M0227L) (optional)
1% Triton X-100
DTT: 

Superscript II Reverse Transcriptase (ThermoFisher Scientific 18064071) 
5-methyl-dCTP (NEB N0356S)
Deoxynucleotide (dNTP) Solution Set (NEB N0446S)
KAPA2G Robust HotStart PCR Kit (Roche KK5517)
10X Uracil DNA Glycosylase (UDG) (Enzymatics G5010L)

anti-NeuN-488 clone A60 (Millipore MAB377)

DNA oligos (HPLC purified, synthesized by IDT). 

In the original snmCAT-seq protocol (ChongyuanLuo, et al. BioRxiv 2019, https://www.biorxiv.org/content/10.1101/2019.12.11.873398v1), 
RT primers and TSO oligos were synthesized with a 5’-C3 Spacer. However, in recent experiments, we found a 5’-biotin spacer is necessary to prevent the concatenation of oligo molecules. We speculate the reduced efficiency for 5’-C3 Spacer in preventing oligo concatenation is due to certain composition changes in commercial enzymes used in the protocol. 

dT30VN_5: /5Biosg/AAGCAGUGGUAUCAACGCAGAGUACUTTTTTUTTTTTUTTTTTUTTTTTUTTTTTVN
N6_3: /5Biosg/AAGCAGUGGUAUCAACGCAGAGUACNNNNNN
TSO_4: /5Biosg/AAGCAGUGGUAUCAACGCAGAGUGAAUrGrGrG
ISPCR23_3: /5SpC3/AAGCAGUGGUAUCAACGCAGAGU

Background

This protocol is based on the original protocol named as snmC2T-seq from the BioRxiv paper (ChongyuanLuo, et al. BioRxiv 2019)  https://www.biorxiv.org/content/10.1101/2019.12.11.873398v1 and SMART-seq3 (Hagemann-Jensen, et al.Nat Biotechnol 2020, https://www.protocols.io/view/smart-seq3-protocol-bcq4ivyw. 

Reagents and oligo sequence can be found in Materials part.

Nuclei preparation

50m

Sample preparation:

We typically grind tissue samples with liquid nitrogen ahead of time and stored at -80°C.
For smaller mouse tissues, we usually snap freeze the fresh dissected samples and store at -80°C.
For culture cells, we typically pellet either suspension cells or dissociated adherent cells, aspirate supernatant then store at -80°C.
Note
In recent experiments, we found the RNA integrity from frozen human tissues may various. DO RIN analysis in bulk tissue before starting the experiments will be helpful to know the sample quality.

Prepare the stock solutions for nuclei isolation, stored at Temperature4 °C   :

10X Diluent buffer : Tris-Cl pH 8.0 (120 mM), KCl (150 mM), MgCl2(30 mM)
NIB: Tris-Cl pH 8.0 (10 mM), KCl (25 mM), MgCl2 (5 mM), Sucrose (250 mM)

Prepare the following solutions freshly before each experiment:

NIB_plusTemperatureOn ice   : NIB + DTT (1 mM) + Proteinase inhibitor (0.5X) + SUPERase• In ( 1:1000 dilution) + RNaseOUT ( 1:1000 dilution)
NIBTTemperatureOn ice   : NIB_plus + 0.1% Triton X-100
50% IodixanolTemperatureRoom temperature   : 5 vol. Optiprep (60% Iodixanol) + 1 vol. Dilutent
25% IodixanolTemperatureRoom temperature   : 1 vol. 50% Iodixanol + 1 vol. NIB
DPBS + RNase inhibitor TemperatureOn ice   : DPBS + SUPERase• In ( 1:1000 dilution) + RNaseOUT ( 1:1000 dilution)

Pre-chilling steps:
Plunge the Dounce and Pestles on ice (in a 50ml tube to avoid contamination from ice).  Transfer 3ml of NIBT buffer to the Dounce in ice and let them chill for 10 min.
Pre-chill 2 ml and 5 ml low retention microcentrifuge tubeTemperatureOn ice   
Cooling down the swing bucket rotor for centrifugingTemperature4 °C   .

Transfer tissue sample or pre-ground tissue powder into the Dounce containing 3 ml of NIBT.
Gently do douncing with a loose pestle (A) 40 times and then with a tight pestle (B) 40 times without introducing bubbles.
Mix the suspension with 2 ml of 50% Iodixanol by pipetting in 5ml ice-cold microcentrifuge tube.
Slowly pipette 1ml of cell mixture onto 500 µl 25% Iodixanol cushion, 5 tubes in total.
Centrifuge at 10,000 g for 20 min at 4°C using a swing rotor.
Note
Before adding cell mixture, we usually aliquot the 500 µl 25% Iodixanol cushion into 2 ml low retention microcentrifuge tubes and centrifuge at 10,000 g for 5 min to sharp the liquid interface. 

10m

Depending on specific experiment, proceed either Section A or B or C or A+B or C+A or C+A+B

Section_A_Nuclei staining_ONLY

10m

Remove supernatant. Re-suspend the pellet in 1 ml of ice-cold DPBS + RNase Inhibitors.
Add Hoechest 33342, then incubate on ice for 5 min.

Section_B_Ab staining

30m

Remove supernatant. Resuspend the pellet in 900 µl of DPBS + RNase inhibitors and 100 µl UltraPure BSA (50 mg/ml).
Add specific amount of nucleus antibodies and incubate on ice for 20 min. 
(For mouse/human neurons, 1 µl AlexaFluor 488 conjugated anti-NeuN clone A60 is used)

Section_C_NOMe treatment

20m

Before do NOMe treatment, it's better to count the nuclei number either using hemocytometer or automated cell counter.
Transfer less than 1 million nuclei per reaction to a new tube, centrifuge at 1000 x g for 10 min at 4°C to spin down the nuclei.
Remove supernatant and resuspend in 50 µL DPBS. 
Then make the 1st cycle NOMe reaction:

AB
GpC Methyltransferase mix (per Rxn)ul vol.
Nuclei mix50
GpC Methyltransferase Buffer (10X) 15
S-adenosylmethionine (SAM 32mM)0.15
GpC MTase15
H2O70

 Incubate at 37°C for 8 mins

4. 2nd cycle NOMe reaction:

AB
GpC Methyltransferase mix (per Rxn)ul vol.
1st GpC treated nuclei mixture150
GpC Methyltransferase Buffer (10X) 15
S-adenosylmethionine (SAM 32mM)0.15
GpC MTase15
H2O120
 Incubate at 37°C for 8 mins

5. Stop the reaction in 1ml ice-cold DPBS and centrifuge at 1000 x g for 10min at 4°C

Pre_sorting

15m

Centrifuge at 1000 x g for 10 min at  4°C.
Remove supernatant. Resuspend the pellet in 1ml DPBS + RNase inhibitors.
Filter with 40 um Cell strainer

Ready to run sorting.

Prepare collection plates

30m

Prepare mCT master mix:

ABCD
Reagent1 Rxn (μl)384 Rxns (with 100% extra, μl)8 x 384 Rxns (with 63% extra, μl)
Number of 384w plates18
Rxn8005000
5X First-Strand Buffer0.21601000
0.1M DTT0.0540250
1% Triton X-1000.180500
25mM MgCl20.180500
500mM NaCl20.0648300
5-methyl-dNTP (10mM)0.0540250
dT30VN_5 (100 μM)0.0129.660
N6_3 (100 μM)0.0216100
TSO_4 (48 μM)0.0540250
RNaseOUT40U/μl0.02520125
SUPERaseIn 20U/μl0.02520125
Superscript II RT*0.0540200
H2O0.258206.41340
Total18005000

Use Beckman i7 robot to distribute mct reaction buffer to 384-plates:

Add Amount1 µL   RT mix into each well of a 384 well plate.
Quick centrifugation the plates and keepTemperatureOn ice  .

Note
For high RNA aboundance tissue or cell types,  RNaseOUT, SUPERaseIn and Superscript II RT can be cut to 0.01 ul per reaction.

FACS

Sort single nuclei using BD Influx or other sorters into 384 well plates on one-drop single mode.

Reverse Transcription

Incubate with a thermocycler

ABC
TemperatureTimeCycles
25°C5 mins1x
42°C90 mins1x
50°C2 mins10x
42°C2 mins
85°C5 mins1x
4°C∞

PCR Amplification

Prepare cDNA amplification mix: 

ABCD
Reagent1 Rxn (μl)384 Rxns (with 60% extra, μl)8 x 384 Rxns (with 30% extra, μl)
Number of 384w plates18
Rxns16004000
KAPA2G Buffer A (5X)0.84803200
ISPCR23_3 (100 μM)0.02414.496
KAPA2G Robust HotStart DNA Polymerase (5 U/μL)0.0169.664
H2O2.1612968640
Total3180012000
Add Amount3 µL   RT mix into each well of a 384 well plate.

Incubate with a thermocycler

ABCD
StepTemperatureTimeCycles
Initial denaturation95 °C3 min1x
Denaturation95 °C15 sec11-15x
Annealing60°C30 sec
Elongation72 °C2 min
Final Elongation72 °C5 min1x
Hold4 °CHold

Note

*Different cell types have a various RNA quantity per cell or nucleus. The optimal cycle number for cDNA amplification needs to be optimized for specific cell types or experiments. 

From our experiences:

Mouse and human neuronal nuclei 11- 13 cycles
Mouse and human non-neuronal nuclei 13 - 15 cycles
P120 Mouse non-neuronal nuclei 15 cycles
P120 Mouse neuronal nuclei 11 cycles
Human culture fibroblast and induced neurons 11-13 cycles
Human H1 and HEK293 whole cell  11 cycles
Human H1 and HEK293 nuclei  11-13 cycles

UDG Diegestion

30m

Prepare uracil digestion mix:

ABCD
Reagent1 Rxn (μl)384 Rxns (with 50% extra, μl)8 x 384 Rxns (with 50% extra, μl)
UDG (G5010)0.5287.52300
EB buffer0.5287.52300
Total15754600
Add Amount1 µL   RT mix into each well of a 384 well plate and incubate at 37°C for 30 mins.

Bisulfite conversion

Add Amount25 µL   Zymo direct bisulfite conversion reagent into each well of a 384 well plate.
Incubate with a thermocycler


AB
TemperatureTime
98 °C8 min
64 °C3.5 hrs
4 °Chold

snmC-Seq2 library preparation

Proceed to the snmC-seq2 library preparation protocol.
https://www.protocols.io/view/methyl-c-sequencing-of-single-cell-nuclei-snmc-seq-pjvdkn6

The NGS mapping pipeline and analysis tools can be found in the packages coded by Hanqing:
Yap: https://hq-1.gitbook.io/mc/
Allcools: https://lhqing.github.io/ALLCools/intro.html

	A	B
	GpC Methyltransferase mix (per Rxn)	ul vol.
	Nuclei mix	50
	GpC Methyltransferase Buffer (10X)	15
	S-adenosylmethionine (SAM 32mM)	0.15
	GpC MTase	15
	H2O	70

	A	B
	GpC Methyltransferase mix (per Rxn)	ul vol.
	1st GpC treated nuclei mixture	150
	GpC Methyltransferase Buffer (10X)	15
	S-adenosylmethionine (SAM 32mM)	0.15
	GpC MTase	15
	H2O	120

A	B	C	D
Reagent	1 Rxn (μl)	384 Rxns (with 100% extra, μl)	8 x 384 Rxns (with 63% extra, μl)
Number of 384w plates		1	8
Rxn		800	5000
5X First-Strand Buffer	0.2	160	1000
0.1M DTT	0.05	40	250
1% Triton X-100	0.1	80	500
25mM MgCl2	0.1	80	500
500mM NaCl2	0.06	48	300
5-methyl-dNTP (10mM)	0.05	40	250
dT30VN_5 (100 μM)	0.012	9.6	60
N6_3 (100 μM)	0.02	16	100
TSO_4 (48 μM)	0.05	40	250
RNaseOUT40U/μl	0.025	20	125
SUPERaseIn 20U/μl	0.025	20	125
Superscript II RT*	0.05	40	200
H2O	0.258	206.4	1340
Total	1	800	5000

A	B	C
Temperature	Time	Cycles
25°C	5 mins	1x
42°C	90 mins	1x
50°C	2 mins	10x
42°C	2 mins	10x
85°C	5 mins	1x
4°C	∞

A	B	C	D
Reagent	1 Rxn (μl)	384 Rxns (with 60% extra, μl)	8 x 384 Rxns (with 30% extra, μl)
Number of 384w plates		1	8
Rxns	1	600	4000

KAPA2G Buffer A (5X)	0.8	480	3200
ISPCR23_3 (100 μM)	0.024	14.4	96
KAPA2G Robust HotStart DNA Polymerase (5 U/μL)	0.016	9.6	64
H2O	2.16	1296	8640
Total	3	1800	12000

A	B	C	D
Step	Temperature	Time	Cycles
Initial denaturation	95 °C	3 min	1x
Denaturation	95 °C	15 sec	11-15x
Annealing	60°C	30 sec
Elongation	72 °C	2 min
Final Elongation	72 °C	5 min	1x
Hold	4 °C	Hold

A	B	C	D
Reagent	1 Rxn (μl)	384 Rxns (with 50% extra, μl)	8 x 384 Rxns (with 50% extra, μl)
UDG (G5010)	0.5	287.5	2300
EB buffer	0.5	287.5	2300
Total	1	575	4600

Public workspacesnmCAT_V2 V.2

snmCAT_V2 V.2