SNARE-seq2 with Nuclei Hashing

Nongluk Plongthongkum; Dinh H Diep; Song Chen; Blue Lake; Kun Zhang

Jul 28, 2023

SNARE-seq2 with Nuclei Hashing

Forked from SNARE-seq2

DOI

dx.doi.org/10.17504/protocols.io.eq2lyjn4qlx9/v1

¹University of California, San Diego;
²King Mongkut's University of Technology Thonburi

Dinh H Diep

University of California, San Diego

DOI: dx.doi.org/10.17504/protocols.io.eq2lyjn4qlx9/v1

Protocol Citation: Nongluk Plongthongkum, Dinh H Diep, Song Chen, Blue Lake, Kun Zhang 2023. SNARE-seq2 with Nuclei Hashing . protocols.io https://dx.doi.org/10.17504/protocols.io.eq2lyjn4qlx9/v1

Manuscript citation:

Plongthongkum N, Diep D, Chen S, Lake BB, Zhang K. Scalable dual-omics profiling with single-nucleus chromatin accessibility and mRNA expression sequencing 2 (SNARE-seq2). Nat Protoc. 2021 Oct 14. doi: 10.1038/s41596-021-00507-3. Epub ahead of print. PMID: 34650278.

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: July 28, 2023

Last Modified: November 22, 2023

Protocol Integer ID: 85647

Disclaimer

This is a modification of the original published protocol. 

Abstract

To study the heterogeneity of complex tissues by joint profiling of gene expression and its regulation, we require an accurate and high-throughput method. Here we described improved high-throughput combinatorial indexing-based single-nucleus chromatin accessibility and mRNA expression sequencing 2 (SNARE-Seq2) co-assay. This protocol involves fixing and permeabilizing the nucleus followed by tagmentation, chromatin barcode ligation, reverse transcription, pooling and splitting for the next rounds of cell barcode ligation into cDNA and accessible chromatin (AC) on the same nucleus. The captured cDNA and AC are co-amplified before splitting and enrichment into single-nucleus RNA and single-nucleus AC sequencing libraries. The protocol can also be applied to both nuclei and whole cells to capture mRNA in the cytoplasm. This improvement allows us to generate hundreds of thousands of data set of each assay and can be scaled up to half a million cells from a single experiment. The entire procedure can be complete in 3.5 d for generating joint single-nucleus RNA and single-nucleus ATAC sequencing libraries.

Attachments

SNARE-seq2 Oligos.xl...

126KB

Materials

MATERIALS
In-house Tn5 transposase or alternatively,  ReagentTagmentase (Unloaded)DiagenodeCatalog #C01070010-20  
ReagentTagmentase Dilution BufferDiagenodeCatalog #C01070010  
ReagentT4 DNA Ligase Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0202S 
ReagentNEBuffer 3.1 - 5.0 mlNew England BiolabsCatalog #B7203S 
ReagentHemo KlenTaq - 1,000 rxnsNew England BiolabsCatalog #M0332L 
ReagentT7 DNA Ligase - 750,000 unitsNew England BiolabsCatalog #M0318L 
ReagentPMSFSigma AldrichCatalog #P7626 
ReagentT4 DNA LigaseNew England BiolabsCatalog #M0202 
ReagentTween 20Sigma AldrichCatalog #P9416-50ML 
ReagentMicroseal® ‘B’ Adhesive SealsBioRad SciencesCatalog #MSB-1001 
ReagentDNA LoBind Tube 1.5ml EppendorfCatalog #022431021 
ReagentRNAse InhibitorEnzymaticsCatalog #Y9240L 
ReagentTango BufferThermo Fisher ScientificCatalog #BY5 
Reagenttwin.tec PCR Plate 96 LoBind semi-shirted clear 25 pcs.EppendorfCatalog #30129504 
ReagentDynabeads MyOne Streptavidin C1Invitrogen - Thermo FisherCatalog #65001 
ReagentFicoll PM-400 20% in H2OSigma AldrichCatalog #F5415-50ML 
ReagentQubit assay tubesThermo Fisher ScientificCatalog #Q32856 
ReagentQubit dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854 
ReagentcOmplete™ Protease Inhibitor CocktailSigma AldrichCatalog #11697498001 
ReagentLow DNA Mass LadderThermo FisherCatalog #10068013 
ReagentUltraPure&trade; DNase/RNase-Free Distilled WaterThermo FisherCatalog #10977015 
ReagentPierce&trade; 16% Formaldehyde (w/v), Methanol-freeThermo FisherCatalog #28906 
ReagentSUPERase&bull; In&trade; RNase Inhibitor (20 U/&mu;L)Thermo FisherCatalog #AM2696 
ReagentGlycoBlue&trade; Coprecipitant (15 mg/mL)Thermo FisherCatalog #AM9515 
ReagentATP Solution (100 mM)Thermo FisherCatalog #R0441 
ReagentBovine Albumin Fraction V (7.5% solution)Gibco, ThermoFisherCatalog #15260037 
ReagentPBSGibco - Thermo FischerCatalog # 10010023 
ReagentPolyethylene Glycol 6000 (PEG 6000)Sigma AldrichCatalog #81255-1KG 
ReagentTris hydrochloride (1M) pH 8.0Thermo Fisher ScientificCatalog #15568025 
ReagentMagnesium chloride solution for molecular biology (1.00 M)Sigma – AldrichCatalog #M1028  
ReagentPotassium chloride (2M)Thermo Fisher ScientificCatalog #AM9640G  
Reagent5 M Sodium chloride (NaCl)Sigma AldrichCatalog #S5150-1L  
ReagentNN-Dimethylformamide (DMF)Sigma AldrichCatalog #227056 
ReagentAdvantage UltraPure dNTP combination kit (100 mM each dNTP) ClontechCatalog #639132 
ReagentDL-DithiothreitolSigma AldrichCatalog #10708984001 
ReagentSodium dodecyl sulfate solutionThermo Fisher ScientificCatalog #AM9822 
ReagentMaxima H Minus Reverse Transcriptase (200 U/uL)Thermo Fisher ScientificCatalog #EP0753 
ReagentBovine Serum Albumin (20 mg/mL) Molecular Biology GradeNew England BiolabsCatalog #B9000S 
ReagentEDTA (0.5 M) pH 8.0Sigma AldrichCatalog #20158 
ReagentTriton X-100 Sigma AldrichCatalog #X100-100ML 
ReagentProteinase K solution (20mg/mL) RNA gradeThermo Fisher ScientificCatalog #25530049 
ReagentSSC Buffer (20X)Sigma AldrichCatalog #S6639 
ReagentKAPA HiFi HotStart ReadyMix (2X)Kapa BiosystemsCatalog #KK2602 
ReagentEvaGreen® Dye, 20x in WaterGold BiotechnologyCatalog #E-670  
ReagentSYBR Gold (10000x)Thermo Fisher ScientificCatalog #S11494 
ReagentSodium acetate (3M) pH 5.5Thermo Fisher ScientificCatalog #AM9740 
Reagent2-Propanol or Isopropanol for molecular biologySigma AldrichCatalog #I9516-500mL 
ReagentEthanol Pure 200 proof for molecular biologySigma AldrichCatalog #E7023-500mL 
ReagentDNA Clean & Concentrator-5 (capped)Zymo ResearchCatalog #D4014 
ReagentTris-borate-EDTA buffer (10X)Thermo Fisher ScientificCatalog #15581044 
ReagentDNA LoBind Tubes 2.0 mLEppendorfCatalog #30108078  
ReagentDNA LoBind Tubes 5mLEppendorfCatalog #30108310 
Reagent8-strip PCR tube without cap (0.2mL)VWR ScientificCatalog #20170-002 
Reagent8-strip PCR tube with individually attached bubble VWR ScientificCatalog #53509-304 
ReagentCorning polypropylene tube (15mL)Fisher ScientificCatalog #0553859B 
ReagentCorning polypropylene tube (50mL)Fisher ScientificCatalog #0553868 
ReagentReservoir for 8 channel pipetters (25mL) individually wrappedCatalog #28-132 
ReagentMillex-GP syringe filter unit (0.22 µm)Merck MilliporeCatalog #SLGP033RS 
ReagentNanosep 0.2 µm column PallCatalog #ODM02C35 
ReagentCELLTRICS 30 µm strainer Fisher ScientificCatalog #NC9682496 
ReagentScalpel bladeIntegraCatalog #4-410 
ReagentDual-chambered counting slideBio-rad LaboratoriesCatalog #145-0011 
Equipments List:
Eppendorf ThermoMixer C with Thermo Top (Eppendorf, cat. no.2231000574)
IKA MS3 digital orbital shaker, with MS 1.32 tube insert (Coleparmer, cat. no. UX-04304-04)
Tube revolver/rotator (Thermo Fisher Scientific, cat. no. 88881001)
0.2 mL PCR Strip / 1.5 mL Microfuge magnetic separator (Permagen Labware, cat. no. SKU: MSR1224B)
MiSeq (Illumina)
MiSeq reagent kit v2 (300 cycles) (Illumina, cat. no. MS-102-2002)
MiSeq reagent kit v3 (150 cycles) (Illumina, cat. no. MS-102-3001)
Qubit 3.0 fluorometer (Thermo Fisher Scientific, cat. no. Q33216)
E1-ClipTip multichannel pipette, 12 channel, 0.5-12.5 µL, 1-30 µL and 2-125 µL (Fisher Scientific, cat. no. 14-387-972TI, 14-387-973TI and 14-387-974TI)
ClipTip 384 12.5 µL, 30 µL and 125 µL multichannel pipette tip, racked, filter, sterile (Thermo Fisher Scientific, cat. no. 94420053, 94420103 and 94420153)
Refrigerated centrifuge (Eppendorf)
Bench top centrifuge (Eppendorf)
mySPIN mini centrifuge (Thermo Fisher Scientific, cat. no. 75004061)
CFX96 Touch deep well real-time PCR detection system (BIO-RAD)
T100 Thermocycler (BIO-RAD, cat. no. 1861096)
TC20 Automated cell counter (BIO-RAD, cat. no.1450102)
Dual-chambered counting slide (BIO-RAD, cat. no. 145-0011)
Eppendorf PCR cooler (Eppendorf, cat. no. 022510525)
XCell SureLock mini-cell electrophoresis system (Thermo Fisher Scientific, cat. no. EI0001)
UV transilluminator

Reagent setup

40% (wt/vol) PEG 6000. Weigh 16.0 g of PEG 6000 in 50 mL tube. Add nuclease-free water and bring the total volume to 40 mL. Rotate the tube at room temperature until PEG 6000 completely dissolved. Spin down the tube at 200 g for 2 min, at room temperature to remove the tiny bubble. CRITICAL: 40% (wt/vol) of PEG 6000 is very viscous and difficult to filter through a 0.22 µm filter. We suggest preparing 40% PEG freshly before making GLR buffer. When PEG is diluted in 4x GLR buffer, it is easier to filter.

4x GLR buffer. To prepare 40 mL of 4x GLR buffer, Add 2.64 mL of nuclease-free water, 10.56 mL of 1 M Tris-HCl, pH 8.0, 0.8 mL of 1 M MgCl2 and 4 mL of 2 M KCl into 50 mL tube. Gently mix well by vortexing. Add 22 mL of 40% (wt/vol) PEG 6000 and gently mix well by vortexing. Filter through 0.22 µm into a new 50 mL tube and briefly spin the tube at room temperature for 30 s. Aliquot 1.8 mL into 2 mL tubes to minimize contamination from each use and store at 4 ºC.

10% (vol/vol) Triton X-100. Slowly aspirate 2.0 mL of Triton X-100 liquid with low retention pipette tip and slowly dispend into 18.0 mL nuclease-free water in 50 mL tube. Dissolve Triton X-100 by slowly rotate the tube until the solution is clear. Filter 10% Triton X-100 solution through 0.22 µm syringe filter into a new 50 mL tube and store at room temperature. CRITICAL: If it’s difficult to pipette Triton X-100 accurately as it’s a viscous liquid, we may warm it at 37 ºC before pipetting

10% (vol/vol) Tween 20. Tween 20 is very viscous liquid and difficult to pipette accurately. We convert the volume in cm3 into grams using the density of tween 20 at 25 ºC is 1.1 cm3. To prepare 20 mL of 10% (vol/vol) Tween 20, weigh 2.2 g of Tween 20 in 50 mL tube. Add 18.0 mL of nuclease-free water and invert or rotate the tube slowly at room temperature until Tween 20 is completely dissolved in water. Filter 10% Tween 20 solution through 0.22 µm syringe filter into a new 50 mL tube and store at room temperature.

25 mM dNTP mix. Mix 250 µL each of 100 mM dATP, dCTP, dGTP and dTTP in 1.5 mL tube. Mix well by vortexing and briefly spin the tube at room temperature for 5 s. Aliquot 250 µL into each of 1.5 mL tube and store at -20 ºC for a couple of years

2x Lysis buffer. To prepare 25 mL of 2x Lysis buffer, add 6.5 mL of nuclease-free water into 50 mL tube. Add 0.5 mL of 1 M Tris-HCl, pH 8.0, 2 mL of 5 M NaCl, 5 mL of 0.5 M EDTA and 11 mL of 10% (wt/vol) SDS. Gently mix and aliquot 1.8 mL into 2 mL tubes and store at room temperature.

1x B&W-T buffer. To prepare 40 mL of 1x B&W-T, add 31.56 mL of nuclease-free water into 50 mL tube. Add 200 µL of 1 M Tris-HCl, pH 8.0, 8 mL of 5 M NaCl, 40 µL of 0.5 M EDTA and 200 µL of 10% (vol/vol) Tween 20. Gently mix by vortexing and store at room temperature.

2x B&W buffer. To prepare 25 mL of 1x B&W, add 14.7 mL of nuclease-free water into 50 mL tube. Add 250 µL of 1 M Tris-HCl, pH 8.0, 10 mL of 5 M NaCl, and 50 µL of 0.5 M EDTA. Mix well by vortexing and store at room temperature.

0.1 M PMSF. Weigh 34.8 mg of PMSF and transfer into 2 mL microtube. Add 100% isopropanol to 2 mL and vortex vigorously to dissolve PMSF. Quick spin the tube down and transfer all solution into 3 mL syringe. Filter through a 0.22 µm syringe filter to a new 2 mL tube. Aliquot 50 µL per 0.2 mL PCR tube and store at -20 ºC for up to 4 months. CRITICAL: To maintain the activity of PMSF in solution, store PMSF in single-use aliquots.

Transposon preparation. Resuspend Nextera adapter 1, 5P-Nextera adapter 2 and mosaic end (ME) oligos with nuclease-free water to 100 µM. Mix 500 µL of 100 µM Nextera adapter 1 and 500 µL of 100 µM ME in 1.5 mL DNA LoBind microtube, aliquot 30 µL of non-annealed transposons into each of 0.2 mL PCR tube and store at -20 ºC for up to 1-2 years. Prepare 5P-Nextera adapter 2 and ME the same way as Nextera adapter 1. All sequences of oligos can be found in the attached tables.

Samples hashing barcodes preparation. Resuspend oligonucleotides barcodes with nuclease-free water to 10 pM final concentration and make 20 uL aliquots of each oligo in 0.2 mL PCR tubes.  

Oligo nameSequence
SNARE2-Truhash001ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAAGTGAGTTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash002ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTTCCGGTABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash003ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCCGACGCATBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash004ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTAGCACABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash005ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAATGCCGGTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash006ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTCAGGTCTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash007ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTACAGAGCBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
SNARE2-Truhash008ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTATATCGTCBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Hashing Oligos

Round 1 DNA barcoding plates generation

Accessible chromatin (AC) Round 1 barcoded oligos preparation (Plate A). Prepare 50 µL of 25 µM accessible chromatin (AC) Round 1 barcoded oligos annealed with 23 µM accessible chromatin (AC) Round 1 linker oligos (BC_0100)

Resuspend AC Round 1 linker (BC_0100) with nuclease-free water to final concentration of 1 mM

Prepare 2.5 mL of 30.67 µM AC Round 1 linker by adding 76.68 µL of 1 mM of AC Round 1 linker to 2,423.32 µL of nuclease-free water in 5 mL tube and mix well by vortexing

Add 12.5 µL of 100 µM AC Round 1 barcoded oligos into 96-well plate (total 48 wells, rows A - D) with multichannel pipette

Transfer AC Round 1 linker oligos into 25 mL reservoir

Add 37.5 µL of 30.67 µM AC Round 1 linker into each well of AC Round 1 barcodes with multichannel pipette and mix well by pipetting 12 times (mixing volume 45 µL)

CRITICAL STEP: Seal and spin down the plate on 96-well plate swinging bucket rotor at 160 g for 1min, 4 ºC. 

Anneal AC Round 1 barcoded oligos and AC linker oligos on thermocycler using the following annealing program: 95 ºC for 2 min, slowly cool down to 20 ºC (0.1 ºC/s) and hold at 4 ºC. CRITICAL STEP: After annealing oligonucleotides in the plate, we recommend spinning down the plate and use a sterile needle to punch the holes on the sealing film to release the pressure in every single well. Otherwise, the liquid inside the well will be pulled up to the top of the well when the film is unsealed, and this can lead to barcode cross-contamination. PAUSE POINT: If do not want to continue to mix these annealed oligos in the next step, store that plate at -20 ºC 

RNA reverse transcription (RT) Round 1 barcoded oligos preparation (Plate B). Prepare 50 µL of 25 µM of oligo (dT)15 and 25 µM of random hexamer (N6) RT barcoded oligos (see attached tables) mix in each of 48 wells. CRITICAL STEP: 100 µM of dT and N6 reverse transcription barcoded oligos are ordered in row A-D and row E-H of oligo plate, respectively.

Transfer 12.5 µL of 100 µM of rows A-D (dT) in the RT barcoded oligos plate to rows A-D of a new 96-well DNA LoBind plate. CRITICAL STEP If use electronic multichannel pipette, add 1 µL of air after aspirating to avoid cross-contamination of barcoded oligos. This can be applied to other steps when we have to transfer barcoded oligos from stock plate to a new plate. Make sure that oligos are delivered to the bottom of the well.

Transfer 12.5 µL of 100 µM of rows E-H oligos (N6) in RT barcoded oligos plate to rows A-D (row E to row A, row F to row B, row G to row C, row H to row D) of 96-well plate that contains dT barcoded oligos above

Pipette 2 mL of nuclease-free water into 25 mL reservoir

Add 25 µL of nuclease-free water to row A-D of RNA Round 1 stock plate and mix well by pipetting 12 times (mixing volume 45 µL) 

Seal and spin down the plate at 160 g for 1 min, 4 ºC and leave the plate on ice or PCR cool rack

AC Round 1 barcoded oligos and RT Round 1 barcoded oligos mix. The final concentration of each oligo (dT, N6, AC) in the oligo mix is 12.5 µM.

Transfer 50 µL of oligos in plate B (RT Round 1 barcoded oligos) into plate A that contain 50 µL of annealed AC Round 1 barcoded oligos and linker at identical well IDs (rows A-D) and mix well by pipetting 12 times (mixing volume 90 µL)

Spin down the plate at 160 g for 1 min, 4 ºC and put the plate on PCR cool rack

Aliquot 4 µL of mixed Round 1 barcoded oligos (rows A-D) into 10-25 of 96-well plates as “working plates”

Spin down working plates at 160 g for 1 min, 4 ºC and store at -20 ºC for up to a couple of years. Store the left over Round 1 stock plate at -20 ºC.

Round 2 DNA barcoding plates generation

Ligation Round 2 barcoded oligos. Prepare stock plate of 100 µL of 18 µM ligation Round 2 barcoded oligos annealed with 16.5 µM ligation Round 2 linker (BC_0215).

Resuspend ligation Round 2 linker (BC_0215) with nuclease-free water to final concentration of 1 mM

Prepare 9 mL of 20.12 µM ligation Round 2 linker by adding 181.08 µL of 1 mM round 2 linker to 8,818.9 µL of nuclease-free water in 15 mL tube and mix well by vortexing

Add 18 µL of 100 µM of ligation round 2 barcoded oligos into 96-well plate (rows A-H)

Transfer ligation Round 2 linker into 25 mL reservoir

Add 82 µL of 20.12 µM ligation Round 2 linker to each well of ligation Round 2 barcoded oligos with and mix well by pipetting 10 times (mixing volume 90 µL)

Seal and spin down the plate at 160 g for 1min, 4 ºC

Anneal ligation Round 2 barcoded oligos and Round 2 linker on thermocycler using the annealing program for Round 1 barcoded oligos and keep on ice

Spin down the plate at 160 g for 1min, 4 ºC and keep on ice

Aliquot 10 µL of annealed ligation Round 2 barcoded/linker oligos into 10 of 96-well plate as “working plate”

Spin down the working plate at 160 g for 1min, 4 ºC before store at -20ºC for up to a couple of year

Round 3 DNA barcoding plates generation

Ligation Round 3 barcoded oligos. Prepare stock plate of 100 µL of 21 µM Round 3 barcoded oligos annealed with 19.5 µM ligation Round 3 linker (BC_0060).

Resuspend ligation Round 3 linker (BC_0060) with nuclease-free water to final concentration of 1 mM

Prepare 8.5 mL of 24.68 µM ligation Round 3 linker by adding 209.8 µL of 1 mM Round 3 linker to 8,290.2 µL of nuclease-free water in 15 mL tube and mix well by vortexing

Add 21 µL of 100 µM of ligation Round 3 barcoded oligos into 96-well plate (rows A-H)

Transfer ligation Round 3 linker into 25 mL reservoir

Add 79 µL of 24.68 µM ligation Round 3 linker to each well of ligation Round 3 barcoded oligos and mix well by pipetting 12 times (mixing volume 90 µL)

Seal and spin down the plate at 160 g for 1min, 4 ºC

Anneal ligation Round 3 barcoded oligos and Round 3 linker on thermocycler using the annealing program for Round 1 barcoded oligos and keep on ice

Spin down the plate at 160 g for 1min, 4 ºC and keep on ice

Aliquot 10 µL of annealed ligation Round 3 barcoded/linker oligos into 10 of 96-well plate as “working plate”

Spin down the working plate at 160 g for 1min, 4 ºC before store at -20ºC for up to a couple of year

Transposase preparation

Note
Convert Tn5 transposase (Diagenode Tagmentase, Diagenode #C01070010-20, EZ-Tn5 Transposase, Lucigen #TNP92110, or expressed/purified with an in house protocol). For example, if the concentration of unloaded Tn5 is 0.40 mg/mL, the monomer concentration in uM is 7.55 µM based on molar mass of monomer Tn5 ~53,000 g/mol [0.4 mg/mL * (1 mol/53,000 g)].  CRITICAL STEP: Anneal transposons and load Tn5 on the day of experiment 1-2 h prior experiment starts. Combine transposons and mix well before adding Tn5 to make sure that both transposons are sufficiently homogeneous prior to mixing with Tn5. Avoid generating bubbles when mixing Tn5 with transposons by pipetting slowly and do not fill pipette tip with air. If the experiment is not ready, store loaded Tn5 at -20 ºC.

Thaw non-annealed transposons (Nextera adapter 1/ME and 5P-Nextera adapter 2/ME) on ice. Briefly vortex and quick spin the tube. Anneal transposons on thermocycler using following program: 95 ºC 5 min, slowly cool down to 65 ºC (0.1 ºC/s), 65 ºC 5 min, slowly cool down to 4 ºC (0.1 ºC/s) and hold at 4 ºC.

Load transposons 1.5x molar ratio to Tn5. The amount below is sufficient for tagmenting ~ 1.8 million nuclei/cells.
Amount13 µL 37.72 uM monomer Tagmentase (2mg/mL)  
Amount7.35 µL 50 uM Annealed Nextera adapter 1/ME  
Amount7.35 µL 50 uM Annealed 5P-Nextera adapter 2/ME  
Amount39 µL Tagmentase Dilution Buffer  
Add annealed Nextera adapter 1/ME and annealed 5P-Nextera adapter 2/ME into the bottom of 1.5 mL DNA LoBind microtube, mix well by pipetting 10 times or gently vortexing and briefly spin the tube on mini centrifuge for 3 s. Addunloaded Tn5 and mix by gently pipetting 20 times (set the volume of p200 pipette to 80 µL). Quick spin the tube and incubate at 25 ºC for 0.5 h, 350 rpm. The final concentration of loaded Tn5 is 7.35 µM (monomer Tn5 concentration).
Duration00:30:00   

30m

Nuclei isolation and fixation

Isolate nuclei from tissue following tissue-specific nuclei extraction protocol (dx.doi.org/10.17504/protocols.io.ufketkw) with 0.1 U/µL of SUPERase In RNase Inhibitor and 0.2 U/µL of Enzymatics RNase Inhibitor. For cell lines, nuclei can be extracted with ATAC Lysis buffer with 0.1% NP-40 as previously described with the addition of RNase inhibitors, and increase lysis volume proportional to the number of input cells.

To each tube of 0.5 mL volumes of nuclei suspensions, add 15 µL of hashing oligos. Make a note of which oligo was added to which sample. Mix briefly, centrifuge at 500 g for 8 minutes at 4C, remove 400 µL of supernatant. Then pool up to 8 barcoded samples 

Prepare 1x PBS + RI (1 mL per sample) and keep on ice.
Amount1000 µL PBS, pH 7.4  
Amount2.5 µL SUPERase In (20 U/uL)  
Amount1.25 µL Enzymatics Rnase In (40 U/uL)  

Prepare 1% (wt/vol) formaldehyde in 1x PBS (1 mL per sample) and keep on ice. CRITICAL: formaldehyde solution should be in 1x PBS and methanol free.
Amount937.5 µL PBS, pH 7.4  
Amount62.5 µL Formaldehyde, 16% wt/vol  

Resuspend 1-2 million nuclei with 1 mL 1x PBS + RI and keep on ice. To each tube of 1 mL volumes of nuclei suspensions, add 15 µL of hashing oligos. Make a note of which oligo was added to which sample. Mix briefly.

Add 1 mL of 1% formaldehyde to nuclei suspension and pipette gently 8 times. Leave the tube on ice for 10 minutes.
Duration00:10:00 Fixation  

Pellet nuclei at 900 g for 8 min at 4C using bucket rotor centrifuge.

Prepare 1x PBS + 0.1% (wt/vol) BSA + RI ( 1 mL per sample) and leave on ice.
Amount1000 µL PBS, pH 7.4  
Amount13.4 µL BSA, 7.5% wt/vol  
Amount1.5 µL SUPERase In (20 U/uL)  
Amount0.75 µL Enzymatics RNase In (40 U/uL)  

Prepare 1x Tango Buffer + RI (1 mL per ~ 3 million nuclei/cells) and leave on ice.
Amount100 µL Tango Buffer, 10x  
Amount160 µL DMF, 100%  
Amount5 µL SUPERase In (20U/uL)  
Amount2.5 µL Enzymatics RNase In (40 U/uL)  
Amount732.5 µL Nuclease-free water  

Aspirate the supernatant, resuspend pelleted nuclei with 0.1 mL of 1x PBS + 0.1% BSA + RI to wash. Pool up to 8 samples, ~800 uL total max. Add wash buffer to 1 mL total volume.

Pellet nuclei at 900 g for 8 min at 4C using bucket rotor centrifuge.

Aspirate the supernatant and resuspend with 1x Tango Buffer + RI to have a minimum concentration of 3,400 nuclei per microliter.

Count the nuclei using cell counter and resuspend the nuclei solution with additional 1x Tango Buffer + RI to obtain 3,400 nuclei per microliter.

Tagmentation

Set up tagmentation mix per reaction as follows (1 reaction per 150,000 nuclei/cells). Minimum 4 reactions for 1 sample per plate (48 wells of round 1).
Amount3 µL Tango Buffer, 10x  
Amount4.8 µL DMF, 100%  
Amount4.95 µL Loaded Tn5, 7.35uM  
Amount1.5 µL SUPERase In (20 U/uL)  
Amount0.75 µL Enzymatics RNase In (40 U/uL)  
Amount15 µL Nuclease-free water  

Prepare 150,000 nuclei in 45 µL of 1x Tango Buffer and mix with 30 µL of tagmentation mix. The final concentration of Tn5 and DMF in final reaction is 0.8 µM and 16% (vol/vol), respectively. The ratio of nuclei suspension and tagmentation mix is 3 : 2 or 45 µL : 30 µL. Add nuclei into 1.5 mL DNA LoBind tube then add tagmentation mix and mix gently by pipetting 10 times. Briefly spin the tube on mini centrifuge at room temperature for 3 s and aliquot 75 µL of tagmentation reaction into 1.5 mL DNA LoBind tube. 

CRITICAL STEP: Set up 4 tubes of tagmentation reactions to have enough nuclei for Round 1 barcoding (8,000 nuclei/well x total 48 wells = 384,000 nuclei). Set up the reactions on ice. Do not incubate tagmentation reaction in large volume to make sure that nuclei are distributed evenly in the reaction not sitting on the bottom of the tube when incubating during tagmentation.

Place the tubes on thermomixer and incubate at 37 ºC for 30 min, 300 rpm.
Duration00:30:00 Tagmentation  

Before incubation is complete, prepare 1x PBS + 0.1% (wt/vol) BSA + RI (1 mL per 400 µL tagmented nuclei)  and keep on ice

Amount1000 µL PBS, pH 7.4  
Amount13.33 µL BSA, 7.5% wt/vol  
Amount1.5 µL SUPERase In (20 U/uL)  
Amount0.75 µL Enzymatics RNase In (40 U/uL)  

Remove the tubes from thermomixer and place on ice. Then pool tagmented nuclei of the same sample into the same tube.

Add 2.5x volume of 1x PBS + 0.1% (wt/vol) BSA + RI (1000 µL to 400 µL tagmented nuclei) to pooled tagmented nuclei and mix by pipetting gently 5 times and centrifuge at 900 g for 8 min, 4 ºC with swinging bucket rotor

During centrifugation, prepare 0.5x PBS + RI (1 mL per 1 million nuclei/cells) and keep on ice
Amount500 µL PBS, pH 7.4   
Amount500 µL Nuclease free water  
Amount2.5 µL SUPERase In (20 U/uL)  
Amount1.25 µL Enzymatics Rnase In (40 U/uL)  

CRITICAL STEP Aspirate supernatant and resuspend nuclei with 300 µL of 0.5x PBS + RI to have a minimum concentration of nuclei not lower than 1,000 nuclei/µL. If different numbers of nuclei in tagmentation are used, adjust suspension volume. Pipetette gently to resuspend

Count nuclei concentration with cell counter and dilute nuclei to 1,000 nuclei/µL with 0.5x PBS + RI.

Accessible chromatin (AC) oligo ligation

45m

Thaw Round 1 AC/RT oligo working plate on ice and spin the plate on swinging bucket at 200 g for 1 min, 4 ºC and leave the plate on ice. Note: Can leave in 4C at the beginning of Day 1 to thaw.

Prepare GLR-A mix following table below. CRITICAL STEP: Prepare GLR-A mix during washing tagmented nuclei, but add ATP, RNase inhibitor and T7 DNA Ligase just before ready to load into Round 1 barcoding plate
Amount260 µL GLR Buffer, 4x  
Amount20.8 µL ATP, 100mM  
Amount52 µL dNTPs, 25 mM each  
Amount13 µL SUPERase In (20U/uL)  
Amount6.76 µL Enzymatics RNase In, (40U/uL)  
Amount10.4 µL DTT, 1M  
Amount78 µL T7 DNA Ligase (3000U/uL)  
Amount1.04 µL Nuclease-free water  

Add 8 µL of nuclei to each well (row A – D) with a multichannel pipette. 

Aliquot 73 µL of GLR-A into 6 tube-strip on PCR cool rack and add 8.5 µL of GLR-A mix to each well with a multichannel pipette. 

Seal and quick spin the plate at 160 g for 15 s, 4 ºC. Gently mix reaction mix, Round 1 barcoded oligos and nuclei 5 times (mixing volume 18 µL)

Seal and quick spin the plate at 160 g for 10 s, 4 ºC and incubate the plate on thermomixer at 25 ºC for 30 min, 300 rpm
Duration00:30:00 AC oligo ligation  

Reverse transcription

45m

Aliquot 20 µL of Maxima H Minus Reverse Transcriptase into 6 tubes of PCR strip tube
Amount120 µL Maxima H Minus RT (200 U/uL)  

Remove Round 1 barcoding plate from thermomixer, put on PCR cool rack, and add 2.2 µL of Maxima H Minus Reverse Transcriptase to each well with a multichannel pipette. CRITICAL STEP: To get accurate volumes, set the speed of multichannel pipette to be very slow for aspirating and dispensing as the enzyme is very viscous

Seal and quick spin the plate at 160 g for 15 s, 4 ºC to bring enzyme to the bottom of the well and mix by gently pipetting 5 times (mixing volume 18 µL). Seal and quick spin the plate at 160 g for 10 s, 4ºC

Incubate the plate on thermocycler using the program: 50ºC for 10 min, 3 cycles of (8ºC for 12 s, 15ºC for 45 s, 20ºC for 45 s, 30ºC 30 s, 42ºC for 2 min, 50ºC for 3 min), 50ºC for 5 min.

Round 2 DNA barcoding

1h 30m

Before reverse transcription finishes, prepare 3 mL of 1x PBS + 0.1% BSA + RI

Amount3000 µL PBS, pH 7.4  
Amount40 µL BSA, 7.5% wt/vol  
Amount4.5 µL SUPERase In (20 U/uL)  
Amount2.25 µL Enzymatics RNase In (40 U/uL)  

Remove the plate from thermocycler and put on ice or PCR cool rack then pool all reactions into a chilled 25 mL reservoir and transfer pooled reaction into a chilled 5 mL DNA LoBind tube. CRITICAL STEP: Before pooling, pipette Round 1 barcoding plate 2 times to kick up nuclei from the bottom of the well and make sure that you transfer all reactions from the well by aspirating slowly and set pipette volume to 26 µL. This technique should be done for all pooling steps. Also keep reactions on ice all the time when handling samples or reaction mixes to prevent RNA degradation and preserve enzyme activity or temperature sensitive reagents like ATP.

Add 2.8 mL of 1x PBS + 0.1% (wt/vol) BSA + RI (2.5x volume) to rinse the basin and transfer buffer to the tube

Add 19.5 µL of 10% (vol/vol) Triton X-100 (final concentration of Triton X-100 is 0.05% (vol/vol)) and mix by inverting the tube 5 times before centrifuge at 900 g for 8 min, 4 ºC
Amount19.5 µL Triton X-100, 10% vol/vol  

Thaw Round 2 barcoded oligos working plate on ice and spin the plate at 200 g, for 1 min, 4 ºC and leave the plate on ice. Note: Can leave in 4C at the beginning of Day 1 to thaw.

Prepare 1x Buffer 3.1 as follows: 
Amount210 µL NEBuffer 3.1, 10x  
Amount21 µL Enzymatics RNase In (40U/uL)  
Amount1890 µL Nuclease free water  

Prepare Ligation Mix as follows:
Amount510 µL T4 DNA Ligase Buffer, 10x  
Amount40.8 µL Enzymatics RNase In (40U/uL)  
Amount12.75 µL SUPERase In (20U/uL)  
Amount51 µL BSA (20 mg/mL)  
Amount127.5 µL T4 DNA Ligase (400U/uL)  
Amount1338.8 µL Nuclease free water  

Remove supernatant as much as possible (~20 µL left) and resuspend nuclei with 2.02 mL of 1x Buffer 3.1 and add 2.04 mL of Ligation mix and mix by pipetting 10 times

Transfer nuclei in ligation mix into 25 mL reservoir and add 40 µL of nuclei suspension into each well of Round 2 barcoding plate and mix gently by pipetting 5 times (mixing volume 45 µL)

Seal the plate with sealing film and quick spin the plate at 160 g for 10 s, 4 ºC

Incubate the plate on thermomixer at 37 ºC for 30 min, 300 rpm
Duration00:30:00 Round 2 barcoding  

Prepare Round 2 blocking solution as follows:
Amount47.52 µL BC_0216, 1000 uM  
Amount300 µL T4 DNA Ligase Buffer, 10x  
Amount852.5 µL Nuclease free water  

Remove Round 2 DNA barcoding plate from thermomixer and quick spin at 160 g for 10 s, 4 ºC. Add 10 µL of Round 2 blocking solution to each well with multichannel pipette and mix by pipetting gently 5 times (mixing volume 55 µL)

Seal the plate with sealing film and quick spin at 160 g for 10 s, 4ºC then incubate the plate on thermomixer at 37 ºC for 30 min, 300 rpm
Duration00:30:00 Round 2 blocking  

Round 3 DNA barcoding

Thaw Round 3 barcoded oligos working plate on ice, spin the plate on swinging bucket at 200 g for 1 min, 4 ºC and leave the plate on ice

Place Round 2 DNA barcoding plate on PCR cool rack and pool into 25 mL reservoir. Add 100 µL of T4 DNA Ligase (400 U/µL) into the basin with nuclei from Round 2 barcoding plate and mix well by gently pipetting 10 times and rock the basin from side-to-side 10 times
Amount100 µL T4 DNA Ligase, (400 U/uL)  

Add 50 µL of nuclei suspension to each well of Round 3 DNA barcoding plate and mix gently by pipetting 5 times (mixing volume 55 µL).

Seal the plate with sealing film and briefly spin the plate at 160 g for 10 s, 4ºC. Incubate the plate on thermomixer at 37 ºC for 30min, 300 rpm
Duration00:30:00 Round 3 barcoding  

Prepare Round 3 blocking solution as follows:
Amount41.4 µL BC_0066, 1000 uM  
Amount600 µL EDTA, 500mM  
Amount1758.6 µL Nuclease free water  

Remove Round 3 DNA barcoding plate from thermomixer and add 20 µL of Round 3 blocking solution to each well and gently mix by pipetting 3 times (mixing volume 75 µL)

Without incubation, pool the reaction into 25 mL reservoir placed on ice, transfer supernatant into 15 mL tube and centrifuge at 1,000 g for 8 min, 4ºC. OPTIONAL: EDTA in the reaction inhibits ligase activity, therefor there is no need to change the pipette tips when pooling Round 3 ligation reaction. Set pipetting volume 85 µL when pooling nuclei.

In parallel, prepare chilled wash buffer as follows. 
Amount4000 µL PBS, pH 7.4  
Amount40 µL Triton X-100, 10% vol/vol  
Amount10 µL SUPERase In (20U/uL) 

Also in parallel, thaw 2X Lysis buffer at 37C for ~15 minutes  if previously prepped. If not see step 6 for recipe.

Remove supernatant and add 4 mL of wash buffer. Pipette gently 5 times with p1000 pipette then centrifuge at 1,000 g for 8 min, 4 ºC

Carefully remove supernatant as much as possible and resuspend nuclei with 300 µL of 1x PBS + RI 
Amount500 µL PBS, pH 7.4  
Amount5 µL SUPERase In (20 U/uL)  
Amount2.5 µL Enzymatics Rnase In (40 U/uL)  

Count nuclei concentration with cell counter and aliquot nuclei at required number in each pool in 1.5 mL DNA LoBind tube and adjust total volume of nuclei to 50 µL with 1x PBS + RI. CRITICAL STEP: To sequence all nuclei, recommend using ≤20,000 cells per pool by splitting 50 µL of nuclei suspension into 6 - 12 tubes per plate.

Nuclei lysis

Add 50 µL of 2x Lysis buffer and 10 µL of 20 mg/mL Proteinase K to each pool, mix well by gently vortexing and brief spin the tube down at room temperature for 10 s to collect all nuclei suspension to the bottom of the tube and incubate on thermomixer at 55 ºC for 2 h, 350 rpm to lyse nuclei and reverse crosslink formaldehyde fixation.
Duration02:00:00 Nuclei lysis  

Put nuclei lysate at -80 ºC to inactivate Proteinase K before continue to day 2 experiment. CRITICAL STEP: Lysis buffer tends to precipitate at room temperature or low temperature. Redissolve by incubating the tube at 37 ºC until it completely dissolves before adding to nuclei suspension. PAUSE POINT: Nuclear or cell lysate can be store at -80 ºC for up to 6 months before continue to day 2 experiment.

Dynabeads MyOne streptavidin beads preparation

20m

Prepare 3.5 mL of 1x B&W-T + RI for bead washing:
Amount3500 µL B&W-T, 1x  
Amount5 µL SUPERase In (20U/uL)  

Vortex the bottle of Dynabeads MyOne C1 thoroughly and aliquot required volume (44 µL/pool * number of pool) into 1.5 mL tube. Add 800 µL of 1x B&W-T + RI, mix by vortexing and pulse spin on mini centrifuge at room temperature for 3 s
Amount44 µL MyOne C1 beads  

Place the tubes onto the magnetic rack until liquid is clear; Remove supernatant with p1000 pipette

Resuspend the beads with 800 µL of 1x B&W-T + RI, vortex and pulse spin on mini centrifuge at room temperature for 3 s

Place the tubes onto the magnetic rack until solution is clear and remove supernatant with p1000 pipette

Repeat washes two more times (total of 3 washes)

Resuspend the beads with 100 µL of 2x B&W + RI per pool:
Amount100 µL 2x B&W-T  
Amount2 µL SUPERase In (20U/uL)  

cDNA/DNA capture

1h 30m

During bead preparation, take the tubes of lysate out of -80 ºC and place onto thermomixer set at 55 ºC for 2 min until lysate is completely thawed

Add 5 µL of 0.1 M PMSF (from -20 ºC) to each tube, pulse vortex for 10 s and pulse spin on mini centrifuge at room temperature for 5 s and incubate at room temperature for 10 min with no shaking
Amount5 µL PMSF, 100 mM  
Duration00:10:00   

Add 100 µL of streptavidin beads in 2x B&W + RI to each tube of lysate (no pipetting required) then agitate the tubes on mixer at room temperature for 1 h, 1,200 rpm. CRITICAL STEP: We recommend to use orbital shaker for microtubes. The speed of mixer can be adjusted as long as the beads do not settle on the bottom of the tube
Duration01:00:00 Binding to beads  

Pulse spin the tubes on mini centrifuge at room temperature for 5 s, place onto magnetic rack until solution is clear and remove supernatant with p200 pipette. CRITICAL STEP: Every time before placing the tube back to the magnet, quick spin the tubes on mini centrifuge for 3-5 s to collect all supernatant/lysate/buffer and beads to the bottom of the tube. Use p200 pipette to remove supernatant to avoid disturbing the beads and prevent bead loss.

Prepare 1 mL of 1x B&W-T + RI (750 uL per lysate) for bead washing as follows:
Amount1000 µL B&W-T, 1x  
Amount1.4 µL SUPERase In (20U/uL)  

Add 250 µL of 1 x B&W-T + RI and agitate the bead at room temperature for 5 min, 1,500 rpm to wash the beads
Duration00:05:00 wash with 1x B&W-T + RI  

Place the tube onto magnetic rack until solution is clear and remove supernatant. Continue to template switching oligo blocking on AC DNA immediately.

Blocking template switching oligo

30m

During working on Steps 109-110, prepare Nextera adapter 1 blocking solution per pool:
Amount250 µL SSC, 6x  
Amount2.5 µL Nextera adapter 1 blocker, 100 uM  
Amount1 µL SUPERase In (20U/uL)  

Add 250 µL of 6x SSC to each tube without bead suspension and wait until the supernatant is clear then remove supernatant with p200 pipette
Amount250 µL SSC, 6x  

Add 250 µL of Nextera adapter 1 blocking solution to each tube and agitate the tubes on mixer at room temperature for 1 min, 1,500 rpm then reduce the speed to 500 rpm for 14 min. CRITICAL STEP: Agitate the tubes at high speed 1,500 rpm for 1 min to make sure the beads are resuspended well, then shake gently at 500 rpm for 14 min to allow hybridization of Nextera adapter 1 blocker and Nextera adpter 1 on AC DNA and make sure that the beads do not settle.
Duration00:15:00 incubate with Nextera Blocking Solution  

Place the tube onto magnetic rack until solution is clear and remove supernatant with p200 pipette.

Wash the beads twice with 1x B&W-T + RI as described above at room temperature for 5 min each round.
Duration00:05:00 wash with 1x B&W-T + RI  
Duration00:05:00 wash #2 with 1x B&W-T + RI  

In parallel, prepare Tris-T + RI during second bead wash
Amount250 µL Tris-HCl, pH 8.0, 10 mM  
Amount2.5 µL Tween 20, 10% vol/vol  
Amount0.63 µL SUPERase In (20U/uL)  

Wash the beads with 250 µL of Tris-T + RI (5 min) the same way as 1x B&W-T + RI wash (at room temperature for 5 min, 1,500 rpm). In parallel, prepare GLR-B mix. CRITICAL STEP: If GLR-B mix is not ready, leave the beads in the tube with Tris-T + RI on ice until GLR-B mix is ready
Duration00:05:00 wash with Tris-T + RI  

Gap filling, ligation and complete reverse transcription

2h 15m

During washing, prepare GLR-B mix as follows:
Amount50 µL GLR buffer, 4x  
Amount4 µL ATP, 100mM  
Amount20 µL Ficoll PM 400, 20% wt/vol  
Amount10 µL dNTPs, 25 mM each  
Amount5 µL SUPERase In (20U/uL)  
Amount2 µL DTT , 1M  
Amount12.5 µL Hemo Klentag  
Amount2.5 µL T7 DNA Ligase (3000U/uL)  
Amount89 µL Nuclease free water  

Place the tubes onto magnetic rack until solution is clear, remove supernatant with p200 pipette and add 250 µL of nuclease-free water to each tube without bead suspension
Amount250 µL Nuclease free water  

Remove water and resuspend the beads with 195 µL of GLR-B mix by gently vortexing and quick spin the tubes on mini centrifuge for 3 s

Rotate the tubes in incubator at 37 ºC with slow speed for 15 min to allow for gap filling on AC DNA and ligate Nextera adapter 1 blocker to the AC DNA. OPTIONAL: For any step required rotator, thermomixer can be alternatively used as long as the tube is shaken gently and the beads do not settle.
Duration00:15:00 Gap filling and ligation  

Remove the tubes from incubator and add each tube with 5 µL of 100 µM TSO and 5 µL of Maxima H Minus reverse transcriptase and mix well by gently vortexing. 
Amount5 µL TSO oligo, 100 uM  
Amount5 µL Maxima H Minus RT, (200 U/uL)  

 Continue to incubate at room temperature for 30 min with slow rotation.
Duration00:30:00 complete reverse transcription  

Incubate at 42 ºC for 90 min with slow rotation.
Duration01:30:00 complete reverse transcription  

PAUSE POINT: The beads can be stored in Tris-T buffer at 4 ºC overnight before continuing to 1st PCR (Remove supernatant and replace with Tris-T buffer). However, we recommend to continue to the 1st PCR immediately if possible.

First PCR, cDNA/DNA amplification

1h 30m

Before finishing 42C incubation, set up the first PCR mix to amplify both cDNA and accessible chromatin (AC) DNA and prepare PCR strip tubes with individual hinged cap (4 tubes per pool):
Amount110 µL KAPA HiFi HotStart ReadyMix, 2x  
Amount6.9 µL BC_0108, 10 uM  
Amount17.6 µL BC_0062, 10 uM  
Amount6.9 µL BC_0082, 10 uM  
Amount6.9 µL Hash_PCR, 10 uM  
Amount74.8 µL Nuclease free water  

Note: 
Sequence of Hash_PCR: 	ACACTCTTTCCCTACACGACGCTCTTCCGATCT

After finishing incubation at 42 ºC for 90 min, place the tubes onto the magnetic rack until liquid is clear and remove supernatant with p200 pipette 

Add 250 µL of nuclease-free water to each tube without bead resuspension. Once liquid is clear, remove supernatant.
Amount250 µL Nuclease free water  

Resuspend the beads with 220 µL of first PCR mix, quick spin and aliquot 55 µL of bead suspension in PCR mix to each of 4 PCR strip tubes. Transfer all the leftover beads to 4 PCR tubes equally. CRITICAL STEP: Transfer the beads in PCR mix directly to the bottom of the tube, so there is no need to spin the tube before placing on thermocycler. Try to transfer PCR mix with the beads into PCR strip tubes as quick as possible to minimize bead settling before the reaction starts.

Place the tubes on thermocycler and run following program: 95 ºC for 3 min,  9 cycles of (98 ºC for 20 s, 58 ºC for 45 s, 72 ºC for 3 min), 72 ºC for 5 min, 4 ºC hold.  

PAUSE POINT PCR reaction can be stored at -20 ºC for a month or 4 ºC for a week.

Place strip tubes onto 0.2 mL magnetic rack until supernatant is clear and pool 1st round PCR products from 4 strip tubes of the same pool into 1.5 mL DNA LoBind tube

Vortex the tube and quick spin on mini centrifuge for 3 s before splitting PCR products into two parts (100 µL each), “AC” for chromatin accessibility (AC) library preparation and “R” for RNA library preparation. Note: AC and R in this step are the same PCR products but will be bead size-selected at different bead volume ratio.

sn/scATAC libraries: purifiation and validation

Perform one round of 1.2x KAPA Pure Beads purification following manufacturer’s instructions by using 120 µL of KAPA Pure Beads with 100 µL of PCR products and elute with 40 µL of nuclease-free water
1. Binding
Amount120 µL KAPA Pure Beads  Duration00:08:00   
2. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
3. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
4. Drying
Duration00:01:00   Temperature37 °C   
5. Elution
 Amount40 µL Nuclease free water   Duration00:10:00   Temperature37 °C   

Transfer eluent into new PCR strip tubes. The resultant is called AC-A.

Use 2 µL of AC-A product to determine DNA concentration with Qubit dsDNA HS assay kit following manufacturer’s instruction

Verify ~10 ng of AC-A in 6% TBE gel and run in 1x TBE buffer at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as reference

sn/scATAC libraries: 2nd PCR and library preparation

6h 30m

In PCR strip tubes, use 5 ng of AC-A as template for enrichment of AC DNA over cDNA and adjust volume of template to 10 µL with nuclease-free water and quick spin down the tubes. CRITICAL STEP: If the concentration of PCR product is higher than 5 ng/µL, it tends to have high error to pipette the volume smaller than 1 µL. We recommend to aliquot AC-A, dilute into 0.5 ng/µL in total 30-50 µL and use 10 µL as template for AC 2nd PCR.
Amount10 µL AC-A DNA (total 5 ng)  

Prepare PCR mix as follows:
Amount25 µL KAPA HiFi HotStart ReadyMix, 2x  
Amount2.5 µL SPLiT_N701, 10 uM  
Amount2.5 µL EvaGreen, 20x  
Amount7.5 µL Nuclease free water  

Add 37.5 µL of PCR mix and 2.5 µL of 10 µM Ad1_N50X (attached tables) into the tube with AC-A template
Amount2.5 µL Ad1_N5XX, 10 uM  

Mix by gently vortexing, quick spin PCR tubes on mini centrifuge at room temperature for 3 s and run qPCR on real-time PCR machine: 95 ºC for 3 min,  12 (or fewer) cycles of (98 ºC for 20 s, 58 ºC for 45 s, 72 ºC for 1 min), 72 ºC for 5 min, 4 ºC hold.  

PAUSE POINT: PCR reaction can be stored at -20 ºC for a month or 4 ºC for a week.

Purify PCR product with DNA Clean & Concentrator following manufacturer's instructions and elute with 40 µL of DNA Elution Buffer. Resultant is called AC-B

Use 2 µL of AC-B to determine DNA concentration with Qubit dsDNA HS assay kit following manufacturing’s instruction

Verify ~10 ng of AC-B in 6% TBE gel and run in 1x TBE buffer at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as a reference in separate lane. CRITICAL STEP: We expect to see nucleosome pattern with larger size (~125 bp larger) compare to standard ATAC-seq due to the presence of cell barcodes and linker sequences

Pool equimolar ratio of AC-B libraries (~200-250 ng/pool) and perform PAGE size-selection at the size between 300-1,000 bp.

Use 2 µL of AC sequencing libraries to determine for DNA concentration with Qubit dsDNA HS assay

Verify ~5 -10 ng of AC sequencing libraries in 6% TBE gel and run in 1x TBE buffer at 250 volts for 23 min or by TapeStation

sn/scATAC libraries: Quality validation by MiSeq sequencing

Validate AC sequencing libraries with MiSeq sequencing using v2 reagent kit by loading at 20 pm based on Qubit dsDNA HS quantification with at least 5% PhiX spike in following Illumina  loading guide. The sequencing configuration is 75 cycles for read 1, 94 cycles for index 1, 8 cycles for index 2, and 75 cycles for read 2.
Note
CRITICAL STEP: For MiSeq sequencing, quantification of sequencing library concentration by Qubit and determination of average library size is sufficient. For high-throughput sequencing, we recommend to run sequencing libraries on Bioanalyzer, TapeStation or equivalent instrument that can determine accurate average library size and contamination of adapter dimers peaks at approximately 125-175 bp. We recommend to run qPCR to quantify sequencing library concentration using the average library size derived from TapeStation. For a two-channel sequencing system such as NovaSeq, we recommend to spike-in with minimum of 10% PhiX or consult sequencing core.

Mix 1:1 ratio of "SN2-AC R1" sequencing primer pairs for sequencing read 1 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2_Read1, 100 uM  
Amount3 µL PhiX_Read1, 100 uM  
Amount594 µL Hybridization buffer, HT1  

Mix 1:1 ratio of "SN2-AC R2" sequencing primer pairs for sequencing index 1 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2-AC_BCread, 100 uM  
Amount3 µL PhiX_Read1, 100 uM  
Amount594 µL Hybridization buffer, HT1  

Mix 1:1 ratio of "SN2-AC R4" sequencing primer pairs for sequencing read 2 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2-AC_Read2, 100 uM  
Amount3 µL PhiX_Read2, 100 uM  
Amount594 µL Hybridization buffer, HT1  

sn/scRNA libraries: purification and validation

Perform 1 round of 0.8x KAPA Pure Beads purification following manufacturer’s instructions by mixing 100 µL of 1st PCR product + with 80 µL of KAPA Pure Beads and elute with 40 µL of nuclease-free water. Resultant is called R-A.
1. Binding
Amount80 µL KAPA Pure Beads  Duration00:08:00   
2. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
3. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
4. Drying
Duration00:01:00   Temperature37 °C   
5. Elution
Amount40 µL Nuclease free water  Duration00:10:00     

Use 2 µL of R-A to determine DNA concentration with Qubit dsDNA HS assay following manufacturer’s instructions

Verify 5-10 ng of R-A in 6% TBE gel and run in 1x TBE buffer at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as a reference

sn/scRNA libraries: 2nd PCR, purification, and validation

In PCR strip tubes, use 5 ng of R-A as template for enrichment of cDNA over AC DNA and adjust the volume of template to 10 µL with nuclease-free water and quick spin down the tubes. CRITICAL STEP: If the concentration of PCR product is higher than 5 ng/µL, it tends to have high error to pipette the volume smaller than 1 µL. We recommend to aliquot R-A, dilute into 0.5 ng/µL in total 30-50 µL and use 10 µL as template for RNA 2nd PCR

Prepare PCR mix for second round amplification of cDNA as follows:
Amount25 µL KAPA HiFi HotStart ReadyMix, 2x  
Amount2 µL BC_0108, 10 uM  
Amount2 µL BC_0062, 10 uM  
Amount2.5 µL EvaGreen, 20x  
Amount8.5 µL Nuclease free water  

Add 40 µL of PCR mix to each tube, gently vortex and quick spin PCR tubes on mini centrifuge at room temperature for 3 s

Run the reactions on real-time PCR using following program: 95 ºC for 3 min,  12 (or fewer) cycles of (98 ºC for 20 s, 67 ºC for 45 s, 72 ºC for 3 min), 72 ºC for 5 min, 4 ºC hold. 

PAUSE POINT PCR reaction can be stored at -20 ºC for a month or 4 ºC for a week.

Purify PCR products with 1 round of 0.8x KAPA Pure Beads and elute with 40 µL of nuclease-free water. The resultant purified DNA is called R-B
1. Binding
Amount40 µL KAPA Pure Beads  Duration00:08:00   
2. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
3. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
4. Drying
Duration00:01:00   Temperature37 °C   
5. Elution
Amount40 µL Nuclease free water  Duration00:10:00   Temperature37 °C   

Determine DNA concentration with Qubit dsDNA HS assay using 2 µL of R-B

Verify ~5-10 ng of R-B in 6% TBE gel by running at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as a reference. CRITICAL STEP: If the smear of R-B is between 375 bp and above, continue to cDNA tagmentation. If there is strong smear smaller than 375 bp, repeat another round of 0.8x KAKA Pure Beads and elute with 40 µL of nuclease-free water.

Hash libraries: 2nd PCR, purification, and validation

In PCR strip tubes, use 5 ng of R-A as template for enrichment of hashing libraries and adjust the volume of template to 10 µL with nuclease-free water and quick spin down the tubes. CRITICAL STEP: If the concentration of PCR product is higher than 5 ng/µL, it tends to have high error to pipette the volume smaller than 1 µL. We recommend to aliquot R-A, dilute into 0.5 ng/µL in total 30-50 µL and use 10 µL as template for 2nd PCR

Set up 2nd PCR mix during incubation
Amount25 µL KAPA Hifi Hotstart ReadyMix, 2X  
Amount2.5 µL HASH_L0X, 10 uM  
Amount2.5 µL EvaGreen, 20X  
Amount7.5 µL Nuclease free water  

Sequences of HASH_L0X (pick one of L01-3):
HASH_L01: AATGATACGGCGACCACCGAGATCTACACGTAACATGCGACACTCTTTCCCTACACGACG
HASH_L02: AATGATACGGCGACCACCGAGATCTACACGTGGATCAAAACACTCTTTCCCTACACGACG
HASH_L03: AATGATACGGCGACCACCGAGATCTACACCACTACGAAAACACTCTTTCCCTACACGACG

Add 37.5 µL of PCR mix and 2.5 µL of 10 µM SPLiT_N7XX (attached tables) primers into the tube with R-A template
Amount2.5 µL SPLiT_N7XX, 10 uM  

Run PCR on thermocycler using program follows: 72 ºC for 3 min, 98 ºC for 30 s,  9-12 cycles of (98 ºC for 30 s, 63 ºC for 30 s, 72 ºC for 45 s), 72 ºC for 3 min, 4 ºC hold. Terminate the reaction when it reaches mid-exponential growth.

Pool all reactions together, purify an aliquot of 50 uL with 1X beads. Elute purified hash libraries with 30 µL of nuclease-free water. 
1. Binding
Amount50 µL KAPA Pure Beads  Duration00:08:00   
2. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
3. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
4. Drying
Duration00:01:00   Temperature37 °C   
5. Elution
Amount30 µL Nuclease free water  Duration00:10:00   Temperature37 °C   

20m

Use 1 µL of hash sequencing libraries to determine for DNA concentration with Qubit dsDNA HS assay

Verify ~ 5 ng of hash libraries in 6% TBE gel at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as a reference.

sn/scRNA libraries: cDNA tagmentation and library preparation

Mix ME and Nextera Adapter 1 (Ad1) oligos 1:1 for final 50 uM each. Briefly vortex and quick spin the tube. Anneal transposons on thermocycler using following program: 95 ºC 5 min, slowly cool down to 65 ºC (0.1 ºC/s), 65 ºC 5 min, slowly cool down to 4 ºC (0.1 ºC/s) and hold at 4 ºC.

Load Tn5 (In-house, 11.32 uM) 
Amount20 µL Tn5, (In-house, 11.32 uM)  
Amount6.8 µL 50 uM, Nextera Adapter 1/ME  

Incubate 1 hour at room temperate with gentle shaking.
Duration01:00:00   

Prepare Tagmentation mix as follows in 1.5 mL tube and aliquot 18 µL per pool into 0.2 mL PCR strip tubes with hinged cap.
Amount2 µL Tango Buffer, 10X  
Amount2 µL DMF, 100%  
Amount12 µL Nuclease free water  
Amount2 µL Loaded Tn5, 8.44 uM  

Transfer 2 µL of diluted cDNA (total 10-20 ng) with multichannel pipette into tagmentation mix, mix by pipetting 10 times, gently vortex and quick spin on mini centrifuge at room temperature for 5 s

Place the tubes on thermocycler that set at 55 ºC for 7 min with the heated lid
Duration00:07:00   

Remove the tube from thermocycler and stop reaction by adding 5 µL of 0.2 % (wt/vol) SDS, mix by pipetting 5 times, gently spin down the tubes on mini centrifuge for 5 s and incubate at room temperature for 5 min
Amount5 µL 0.2% SDS  
Duration00:05:00   

Set up Tagmentation PCR mix during incubation
Amount25 µL KAPA Hifi Hotstart ReadyMix, 2X  
Amount2.5 µL BC_0118, 10 uM  
Amount2.5 µL EvaGreen, 20X  
Amount7.5 µL Nuclease free water  

Add  2.5 SPLiT_N7XX (attached tables) primers to 10 uL tagmented cDNA, then 37.5 of Tagmentation PCR mix respectively, mix well and gently spin down the tube on mini centrifuge for 3 s
Amount2.5 µL SPLiT_N7XX, 10 uM  
Amount10 µL tagmented cDNA  
Amount37.5 µL Tagmentation PCR Mix  

Run PCR on thermocycler using program follows: 72 ºC for 3 min, 98 ºC for 30 s,  9-12 cycles of (98 ºC for 30 s, 63 ºC for 30 s, 72 ºC for 45 s), 72 ºC for 3 min, 4 ºC hold. Terminate the reaction when it reaches mid-exponential growth.

20m

Purify PCR products at least two rounds of 0.7x KAPA Pure beads to make sure that no adapter dimers are leftover in the sequencing libraries. Elute the last round of bead purified RNA libraries with 30 µL of nuclease-free water. CRITICAL STEP: Adapter dimers can cluster more efficiently than regular sequencing libraries and is more sensitive on the patterned flow cell such as NovaSeq S4. This can lead to the reduction of sequencing output and sequencing quality
1. Binding
Amount35 µL KAPA Pure Beads  Duration00:08:00   
2. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
3. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
4. Drying
Duration00:01:00   Temperature37 °C   
5. Elution
Amount50 µL Nuclease free water  Duration00:10:00   Temperature37 °C   
6. Binding
Amount35 µL KAPA Pure Beads  Duration00:08:00   
7. Washing
Amount180 µL Ethanol, 100%  Duration00:00:30   
8. 2nd wash
Amount180 µL Ethanol, 100%  Duration00:00:30   
9. Drying
Duration00:01:00   Temperature37 °C   
10. Elution
Amount30 µL Nuclease free water  Duration00:10:00   Temperature37 °C   

Use 1 µL of RNA sequencing libraries to determine for DNA concentration with Qubit dsDNA HS assay

Verify ~ 5 ng of RNA libraries in 6% TBE gel at 250 volts for 23 min with 0.5 µL of Low DNA Mass Ladder as a reference

sn/scRNA and hash libraries: Quality validation by MiSeq sequencing

Validate sequencing libraries with MiSeq sequencing using v3 reagent kit by loading at 22 pm based on Qubit dsDNA HS quantification with at least 5% PhiX spike.  The sequencing configuration is 70 cycles for read 1, 6 cycles for index, and 102 cycles for read 2.a

Note
CRITICAL STEP: For MiSeq sequencing, quantification of sequencing library concentration by Qubit and determination of average library size is sufficient. For high-throughput sequencing, we recommend to run sequencing libraries on Bioanalyzer, TapeStation or equivalent instrument that can determine accurate average library size and contamination of adapter dimers peaks at approximately 125-175 bp. We recommend running qPCR to quantify sequencing library concentration using the average library size derived from TapeStation. For a two-channel sequencing system such as NovaSeq, we recommend spike-in with a minimum of 10% PhiX or consult sequencing core.

Mix 1:1 ratio of "SN2-R R1" sequencing primer pairs for sequencing read 1 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2_Read1, 100 uM  
Amount3 µL PhiX_Read1, 100 uM  (Hash libraries uses the same Read 1 sequencing primer as PhiX)
Amount594 µL Hybridization buffer, HT1  

Mix 1:1 ratio of "SN2-R Index1" sequencing primer pairs for sequencing index 1 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2-R_Index1  
Amount3 µL PhiX_Read1  
Amount594 µL Hybridization buffer, HT1  

Mix 1:1 ratio of "SN2-R R2" sequencing primer pairs for sequencing read 2 on Illumina workflow A (HiSeq 2500, MiSeq, NovaSeq 6000 platforms).
Amount3 µL SNARE2-R_Read2  
Amount3 µL PhiX_Read2  
Amount594 µL Hybridization buffer, HT1  

	Oligo name	Sequence
	SNARE2-Truhash001	ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAAGTGAGTTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash002	ACACTCTTTCCCTACACGACGCTCTTCCGATCTCCTTCCGGTABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash003	ACACTCTTTCCCTACACGACGCTCTTCCGATCTTCCGACGCATBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash004	ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTAGCACABAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash005	ACACTCTTTCCCTACACGACGCTCTTCCGATCTGAATGCCGGTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash006	ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTCAGGTCTBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash007	ACACTCTTTCCCTACACGACGCTCTTCCGATCTCGTACAGAGCBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
	SNARE2-Truhash008	ACACTCTTTCCCTACACGACGCTCTTCCGATCTCTATATCGTCBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Public workspaceSNARE-seq2 with Nuclei Hashing

SNARE-seq2 with Nuclei Hashing