Apr 09, 2020

Public workspaceSingle Nucleus Drop-seq (snDrop-seq)

DOI
dx.doi.org/10.17504/protocols.io.zmvf466
  • Song Chen1,
  • Blue B. Lake1,
  • Sarah Urata1,
  • Kun Zhang1
  • 1University of California, San Diego
  • Human Cell Atlas Method Development Community
  • KPMP
Zhang Lab
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.zmvf466
External link: http://genome-tech.ucsd.edu/ZhangLab/
Protocol Citation: Song Chen, Blue B. Lake, Sarah Urata, Kun Zhang 2020. Single Nucleus Drop-seq (snDrop-seq). protocols.io https://dx.doi.org/10.17504/protocols.io.zmvf466
Manuscript citation:
Lake, B.B., Chen, S., Hoshi, M. et al. A single-nucleus RNA-sequencing pipeline to decipher the molecular anatomy and pathophysiology of human kidneys. Nat Commun 10, 2832 (2019). https://doi.org/10.1038/s41467-019-10861-2
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 29, 2019
Last Modified: April 09, 2020
Protocol Integer ID: 21909
Keywords: sequencing, single nuclei, DropSeq
Abstract
The protocol presented here is a Drop-Seq protocol modified for single nuclei.

The original Drop-Seq protocol comes from the McCarroll Lab in the Department of Genetics, Harvard Medical School.
http://mccarrolllab.org/download/905/
Materials
MATERIALS
ReagentDTTSigma AldrichCatalog #D0632
Reagent15 mL Falcon tubes
ReagentPCR tubes
ReagentSSC Thermo Fisher ScientificCatalog #AM9765
Reagent10x PBSThermo Fisher ScientificCatalog #AM9624
ReagentUltraPure Distilled Water Invitrogen - Thermo FisherCatalog #10977-015
ReagentTrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
ReagentTSO: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrGIntegrated DNA Technologies
ReagentSMART PCR primer: AAGCAGTGGTATCAACGCAGAGTIntegrated DNA Technologies
ReagentNew-P5-SMART PCR hybrid oligo: AATGATACGGCGACCACCGAGATCTACACGCCT GTCCGCGGAAGCAGTGGTATCAACGCAGAGT* A*CIntegrated DNA Technologies
ReagentCustom Read 1 primer: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAG AGTACIntegrated DNA Technologies
ReagentBSASigma AldrichCatalog ##A8806
ReagentBarcoded Bead SeqB: 5’ –Bead–Linker-TTTTTTTAAGCAGTGGTATCAAC GCAGAGTACJJJJJJJJJJJJNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3’Chemgenes
ReagentInverted MicroscopeCatalog #Motic AE31
ReagentSyringe Pumps (3)Catalog #Legato 100
ReagentMagnetic StirrerVP ScientificCatalog #710D2
ReagentMagnetic Mixing DiscsVP ScientificCatalog #772DP-N42-5-2
Reagent3 mL syringesBD BiosciencesCatalog #BD #309657
Reagent10 mL syringesBD BiosciencesCatalog #BD 309695
ReagentTubingScientific CommoditiesCatalog #BB31695PE/2
ReagentLuer lock 26-gage needlesBD BiosciencesCatalog #305111
ReagentPDMS co-flow microfluidic droplet generation deviceCatalog #CAD file from McCarroll Lab
Reagent100 micron cell strainers (for beads)VWR international LtdCatalog #21008-950
Reagent40 micron cell strainers (for cells)VWR international LtdCatalog #21008-949
ReagentFuchs-Rosenthal hemocytometerINCYTOCatalog #DHC-F01
ReagentFicoll PM-400 20% in H2OSigma AldrichCatalog #F5415-50ML
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentSarkosylSigma AldrichCatalog #L7414
ReagentEDTA 0.5 MLife TechnologiesCatalog #AM9260G
ReagentTris 2M pH 7.5Sigma AldrichCatalog #T2944
ReagentPerfluorooctanolSigma AldrichCatalog #370533
Reagent30 um UberstrainerpluriSelectCatalog #43-70030-03
Reagent50 mL centrifuge tubesVWR InternationalCatalog #734-1876
ReagentDroplet Generation OilBio-rad LaboratoriesCatalog #186-4006
ReagentMineral OilMillipore SigmaCatalog #M5904
ReagentTris 2M pH 8.0Sigma AldrichCatalog #T3069
Reagent10% SDSTeknovaCatalog #S0288
ReagentTween-20Sigma AldrichCatalog #P9416
ReagentMaxima 5X RT BufferThermo Fisher Scientific
ReagentMaxima™ H Minus Reverse TranscriptaseThermo Fisher ScientificCatalog #EP0753
Reagent10 mM dNTPsTakarabioCatalog #639125
ReagentRNase InhibitorLucigenCatalog #30281-1
Reagent10x Exo I BufferThermo Fisher Scientific
ReagentExo IThermo Fisher ScientificCatalog #FEREN0582
ReagentKapa HiFi Hotstart ReadymixKapa BiosystemsCatalog #KK2601
ReagentAgencourt AMPure XP beadsBeckman CoulterCatalog #A63881
ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
ReagentQubit dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854
ReagentNextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1096
ReagentMiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001
STEP MATERIALS
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentSarkosylSigma AldrichCatalog #L7414
ReagentEDTA 0.5 MLife TechnologiesCatalog #AM9260G
ReagentTris 2M pH 7.5Sigma AldrichCatalog #T2944
ReagentDTTSigma AldrichCatalog #D0632
ReagentSSC Thermo Fisher ScientificCatalog #AM9765
ReagentTris 2M pH 8.0Sigma AldrichCatalog #T3069
ReagentEDTA 0.5 MLife TechnologiesCatalog #AM9260G
Reagent10% SDSTeknovaCatalog #S0288
ReagentEDTA 0.5 MLife TechnologiesCatalog #AM9260G
ReagentTween-20Sigma AldrichCatalog #P9416
Reagent10x Exo I BufferThermo Fisher Scientific
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentExo IThermo Fisher ScientificCatalog #FEREN0582
ReagentBarcoded bead, sequence: TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJ NNNNNNNNT(30); where J=split-pool oligo; N=random oligo ChemgenesCatalog #Macosko-2011- 10
Reagent100 micron cell strainers (for beads)VWR international LtdCatalog #21008-950
ReagentFuchs-Rosenthal hemocytometerINCYTOCatalog #DHC-F01
ReagentSyringe Pumps (3)Catalog #Legato 100
ReagentInverted MicroscopeCatalog #Motic AE31
ReagentMagnetic StirrerVP ScientificCatalog #710D2
ReagentSyringe Pumps (3)Catalog #Legato 100
ReagentInverted MicroscopeCatalog #Motic AE31
ReagentPDMS co-flow microfluidic droplet generation deviceCatalog #CAD file from McCarroll Lab
ReagentTubingScientific CommoditiesCatalog #BB31695PE/2
Reagent15 mL Falcon tubes
ReagentBarcoded bead, sequence: TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJ NNNNNNNNT(30); where J=split-pool oligo; N=random oligo ChemgenesCatalog #Macosko-2011- 10
ReagentMineral OilMillipore SigmaCatalog #M5904
ReagentPerfluorooctanolSigma AldrichCatalog #370533
ReagentMaxima 5X RT BufferThermo Fisher Scientific
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentSMART PCR primer: AAGCAGTGGTATCAACGCAGAGTIntegrated DNA Technologies
ReagentKapa HiFi Hotstart ReadymixKapa BiosystemsCatalog #KK2601
ReagentAgencourt AMPure XP beadsBeckman CoulterCatalog #A63881
ReagentNextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1096
ReagentNextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1096
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentNew-P5-SMART PCR hybrid oligo: AATGATACGGCGACCACCGAGATCTACACGCCT GTCCGCGGAAGCAGTGGTATCAACGCAGAGT* A*CIntegrated DNA Technologies
ReagentAgencourt AMPure XP beadsBeckman CoulterCatalog #A63881
ReagentAgencourt AMPure XP beadsBeckman CoulterCatalog #A63881
ReagentFicoll PM-400 20% in H2OSigma AldrichCatalog #F5415-50ML
ReagentBSASigma AldrichCatalog ##A8806
Reagent10x PBSThermo Fisher ScientificCatalog #AM9624
ReagentUltraPure Distilled Water Invitrogen - Thermo FisherCatalog #10977-015
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
ReagentMaxima 5X RT BufferThermo Fisher Scientific
ReagentFicoll PM-400 20% in H2OSigma AldrichCatalog #F5415-50ML
Reagent10 mM dNTPsTakarabioCatalog #639125
ReagentRNase InhibitorLucigenCatalog #30281-1
ReagentTSO: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrGIntegrated DNA Technologies
ReagentMaxima™ H Minus Reverse TranscriptaseThermo Fisher ScientificCatalog #EP0753
Reagent50 mL centrifuge tubesVWR InternationalCatalog #734-1876
Reagent30 um UberstrainerpluriSelectCatalog #43-70030-03
ReagentCustom Read 1 primer: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAG AGTACIntegrated DNA Technologies
ReagentMiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001
ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
ReagentQubit dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854
ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
ReagentQubit dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854
ReagentTubingScientific CommoditiesCatalog #BB31695PE/2
ReagentLuer lock 26-gage needlesBD BiosciencesCatalog #305111
Reagent10 mL syringesBD BiosciencesCatalog #BD 309695
Reagent3 mL syringesBD BiosciencesCatalog #BD #309657
ReagentMagnetic Mixing DiscsVP ScientificCatalog #772DP-N42-5-2

Protocol materials
ReagentInverted MicroscopeCatalog #Motic AE31
In Materials, Materials, Materials and 2 steps
ReagentTubingScientific CommoditiesCatalog #BB31695PE/2
In Materials, Materials, Materials and 2 steps
ReagentKapa HiFi Hotstart ReadymixKapa BiosystemsCatalog #KK2601
In Materials, Materials, Step 36
ReagentLuer lock 26-gage needlesBecton Dickinson (BD)Catalog #305111
In Materials, Materials, Step 18
ReagentBarcoded Bead SeqB: 5’ –Bead–Linker-TTTTTTTAAGCAGTGGTATCAAC GCAGAGTACJJJJJJJJJJJJNNNNNNNN TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT-3’Chemgenes
Materials
ReagentBSAMerck MilliporeSigma (Sigma-Aldrich)Catalog ##A8806
In Materials, Materials, Step 1
Reagent10x PBSThermo Fisher ScientificCatalog #AM9624
In Materials, Materials, Step 2
ReagentCustom Read 1 primer: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAG AGTACIntegrated DNA Technologies, Inc. (IDT)
In Materials, Materials, Step 49
Reagent100 micron cell strainers (for beads)VWR International (Avantor)Catalog #21008-950
In Materials, Materials, Step 12
ReagentEDTA 0.5 MLife TechnologiesCatalog #AM9260G
In Materials, Materials, Materials, Materials and 3 steps
ReagentSarkosylMerck MilliporeSigma (Sigma-Aldrich)Catalog #L7414
In Materials, Materials, Step 5
ReagentDTTMerck MilliporeSigma (Sigma-Aldrich)Catalog #D0632
In Materials, Materials, Step 5
ReagentPCR tubes
Materials
ReagentSSC Thermo Fisher ScientificCatalog #AM9765
In Materials, Materials, Step 6
ReagentTrypLE™ Express EnzymeThermo Fisher ScientificCatalog #12604013
Materials
Reagent30 um UberstrainerpluriSelectCatalog #43-70030-03
In Materials, Materials, Step 27
Reagent15 mL Falcon tubes
In Materials, Materials, Step 15
ReagentPDMS co-flow microfluidic droplet generation deviceCatalog #CAD file from McCarroll Lab
In Materials, Materials, Step 15
Reagent10 mM dNTPsTakara Bio Inc.Catalog #639125
In Materials, Materials, Step 10
ReagentSyringe Pumps (3)Catalog #Legato 100
In Materials, Materials, Materials and 2 steps
ReagentTris 2M pH 7.5Merck MilliporeSigma (Sigma-Aldrich)Catalog #T2944
In Materials, Materials, Step 5
Reagent50 mL centrifuge tubesVWR International (Avantor)Catalog #734-1876
In Materials, Materials, Step 27
ReagentAgencourt AMPure XP beadsBeckman CoulterCatalog #A63881
In Materials, Materials, Materials, Materials and 3 steps
ReagentFuchs-Rosenthal hemocytometerINCYTOCatalog #DHC-F01
In Materials, Materials, Step 12
ReagentNextera XT DNA Library Preparation KitIllumina, Inc.Catalog #FC-131-1096
In Materials, Materials, Materials and 2 steps
ReagentNuclease-free H2OLife TechnologiesCatalog #AM9930
In Materials, Materials, Materials, Materials, Materials, Materials and 5 steps
ReagentQubit dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q32854
In Materials, Materials, Materials and 2 steps
Reagent3 mL syringesBecton Dickinson (BD)Catalog #BD #309657
In Materials, Materials, Step 18
ReagentMaxima 5X RT BufferThermo Fisher Scientific
In Materials, Materials, Materials and 2 steps
ReagentSMART PCR primer: AAGCAGTGGTATCAACGCAGAGTIntegrated DNA Technologies, Inc. (IDT)
In Materials, Materials, Step 36
Reagent10x Exo I BufferThermo Fisher Scientific
In Materials, Materials, Step 11
ReagentBarcoded bead, sequence: TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJ NNNNNNNNT(30); where J=split-pool oligo; N=random oligo ChemgenesCatalog #Macosko-2011- 10
In Materials, Materials and 2 steps
ReagentMagnetic Mixing DiscsVP ScientificCatalog #772DP-N42-5-2
In Materials, Materials, Step 18
Reagent40 micron cell strainers (for cells)VWR International (Avantor)Catalog #21008-949
Materials
ReagentUltraPure Distilled Water Invitrogen - Thermo FisherCatalog #10977-015
In Materials, Materials, Step 2
Reagent10 mL syringesBecton Dickinson (BD)Catalog #BD 309695
In Materials, Materials, Step 18
ReagentNew-P5-SMART PCR hybrid oligo: AATGATACGGCGACCACCGAGATCTACACGCCT GTCCGCGGAAGCAGTGGTATCAACGCAGAGT* A*CIntegrated DNA Technologies, Inc. (IDT)
In Materials, Materials, Step 43
ReagentExo IThermo Fisher ScientificCatalog #FEREN0582
In Materials, Materials, Step 11
ReagentTris 2M pH 8.0Merck MilliporeSigma (Sigma-Aldrich)Catalog #T3069
In Materials, Materials, Step 7
ReagentDroplet Generation OilBio-Rad LaboratoriesCatalog #186-4006
Materials
ReagentRNase InhibitorLucigenCatalog #30281-1
In Materials, Materials, Step 10
ReagentMaxima™ H Minus Reverse TranscriptaseThermo Fisher ScientificCatalog #EP0753
In Materials, Materials, Step 10
ReagentPerfluorooctanolMerck MilliporeSigma (Sigma-Aldrich)Catalog #370533
In Materials, Materials, Step 28
ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
In Materials, Materials, Materials and 2 steps
ReagentMagnetic StirrerVP ScientificCatalog #710D2
In Materials, Materials, Step 13
ReagentFicoll PM-400 20% in H2OMerck MilliporeSigma (Sigma-Aldrich)Catalog #F5415-50ML
In Materials, Materials, Materials and 2 steps
ReagentMineral OilMerck MilliporeSigma (Sigma-Aldrich)Catalog #M5904
In Materials, Materials, Step 28
Reagent10% SDSTeknovaCatalog #S0288
In Materials, Materials, Step 8
ReagentMiSeq v3 (150 cycle) KitIllumina, Inc.Catalog #MS-102-3001
In Materials, Materials, Step 49
ReagentTSO: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrGIntegrated DNA Technologies, Inc. (IDT)
In Materials, Materials, Step 10
ReagentTween-20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416
In Materials, Materials, Step 9
Prepare Buffers and Solutions
Prepare Buffers and Solutions
BSA
Make a 10% stock solution using BSA powder
ReagentBSAVWR InternationalCatalog ##A8806

1X PBS
Make a 1X stock solution using by diluting 10X PBS into nuclease-free distilled water
Reagent10x PBSVWR InternationalCatalog #AM9624

ReagentUltraPure Distilled Water VWR InternationalCatalog #10977-015

Cell Loading Buffer (makesAmount1 mL )
Prepare enough for the number of samples (Amount1 mL per sample ) that will be processed in one experiment
Amount300 µL 20% Ficoll PM-400
ReagentFicoll PM-400 20% in H2OVWR InternationalCatalog #F5415-50ML
Amount700 µL 1X PBS

PBS-BSA: make this fresh before each experiment
  • Cell Loading Buffer
  • 0.01% BSA (use the 10% stock)
Lysis Buffer (makesAmount1.2 mL )
Prepare enough for the number of samples (Amount1 mL per sample ) that will be processed in one experiment
Amount960 µL H2O
ReagentNuclease-free H2OVWR InternationalCatalog #AM9930
Amount12 µL 20% Sarkosyl
ReagentSarkosylVWR InternationalCatalog #L7414
Amount48 µL 0.5 M EDTA
ReagentEDTA 0.5 MVWR InternationalCatalog #AM9260G
Amount120 µL 2M Tris, pH 7.5
ReagentTris 2M pH 7.5VWR InternationalCatalog #T2944
Amount60 µL 1M DTT
Add this just prior to starting each DropSeq experiment
ReagentDTTVWR InternationalCatalog #D0632


6X SSC
Make 6X SSC working stock from 20X SSC

ReagentSSC VWR InternationalCatalog #AM9765

10 mM Tris pH 8.0
Make 10 mM Tris pH 8.0 working stock from 2M Tris pH 8.0

ReagentTris 2M pH 8.0VWR InternationalCatalog #T3069

TE-SDS (makeAmount50 mL )
  • 10 mM Tris pH 8.0 + 1 mM EDTA
  • 0.5% SDS
ReagentEDTA 0.5 MVWR InternationalCatalog #AM9260G

Reagent10% SDSVWR InternationalCatalog #S0288

TE-TW (makeAmount500 mL )
  • 10 mM Tris pH 8.0 + 1 mM EDTA
  • 0.01% Tween-20
ReagentEDTA 0.5 MVWR InternationalCatalog #AM9260G

ReagentTween-20VWR InternationalCatalog #P9416

RT mix (makesAmount200 µL )
Amount75 µL H2O
ReagentNuclease-free H2OVWR InternationalCatalog #AM9930
Amount40 µL Maxima 5x RT Buffer
ReagentMaxima 5X RT BufferVWR International
Amount40 µL 20% Ficoll PM-400
ReagentFicoll PM-400 20% in H2OVWR InternationalCatalog #F5415-50ML
Amount20 µL 10 mM dNTPs
Reagent10 mM dNTPsVWR InternationalCatalog #639125
Amount5 µL RNase Inhibitor
ReagentRNase InhibitorVWR InternationalCatalog #30281-1
Amount10 µL 50 uM Template Switch Oligo
ReagentTSO: AAGCAGTGGTATCAACGCAGAGTGAATrGrGrGVWR International
Amount10 µL Maxima H- RTase
Add after beginning breakage portion of the protocol (Step 27).
ReagentMaxima™ H Minus Reverse TranscriptaseVWR InternationalCatalog #EP0753

Exonuclease Mix (makesAmount200 µL )
Amount20 µL 10x Exo I Buffer
Reagent10x Exo I BufferVWR International
Amount170 µL H2O
ReagentNuclease-free H2OVWR InternationalCatalog #AM9930
Amount10 µL Exo I
ReagentExo IVWR InternationalCatalog #FEREN0582

Droplet Formation
Droplet Formation
Preparing the Barcoded Beads from Dry Resin

ReagentBarcoded bead, sequence: TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJ NNNNNNNNT(30); where J=split-pool oligo; N=random oligo VWR InternationalCatalog #Macosko-2011- 10

The beads will arrive as a dry resin. To prepare the beads for an experiment from the dry resin, follow these steps:
  1. Wash the resin with Amount30 mL ethanol
  2. Wash twice with Amount30 mL TE-TW
  3. Resuspend in Amount20 mL TE-TW
  4. Pass through 100 micron strainer
  5. Count the beads using a Fuchs-Rosenthal hemocyctometer
  6. Store the counted beads at Temperature4 °C

Note
To pellet the beads when washing, centrifuge at 1000xg for Duration00:01:00


Note
Do NOT vortex the barcoded beads. Vortexing will shear the beads and cause damage. To mix, simply invert tube gently a couple of times until mixed.

Reagent100 micron cell strainers (for beads)VWR InternationalCatalog #21008-950

ReagentFuchs-Rosenthal hemocytometerVWR InternationalCatalog #DHC-F01

Arrangement of components

ReagentSyringe Pumps (3)VWR InternationalCatalog #Legato 100

ReagentInverted MicroscopeVWR InternationalCatalog #Motic AE31

ReagentMagnetic StirrerVWR InternationalCatalog #710D2
Set up the syringe pumps next to the inverted microscope. Note: arrange the bead pump so that the syringe is pointing downward ratherly than horizontally. Place the magnet stirrer close to the barrel of the bead syringe.

Source: http://mccarrolllab.org/download/905/

Prepare Pump System

ReagentSyringe Pumps (3)VWR InternationalCatalog #Legato 100

  1. Power on the syringe pumps (switches located on the back left of the pump)
  2. Set up correct flow rates using the screen on the pump
  • Oil: 15,000 ul/hr
  • Cells: 4,000 ul/hr
  • Beads: 4,000 ul/hr
Prepare microfluidic cell

ReagentInverted MicroscopeVWR InternationalCatalog #Motic AE31

ReagentPDMS co-flow microfluidic droplet generation deviceVWR InternationalCatalog #CAD file from McCarroll Lab

ReagentTubingVWR InternationalCatalog #BB31695PE/2

Reagent15 mL Falcon tubesVWR International

  1. Cut and remove protective plastic top layer for one device on the chip
  2. Cut the outflow tubing to proper length and connect it to the device so that the collection from the outflow can be safely collected
  3. Use clean 15 mL tubes to catch the droplets
  4. Use a waste container to catch waste

Prepare the beads

ReagentBarcoded bead, sequence: TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJ NNNNNNNNT(30); where J=split-pool oligo; N=random oligo VWR InternationalCatalog #Macosko-2011- 10
  1. Take an aliquot of beads (final concentration: 120,000 beads/mL)
  2. Spin down in a tabletop centrifuge
  3. Remove the TE-TW storage buffer
  4. Wash with DTT minus lysis buffer
  5. Resuspend in Lysis buffer
Prepare nuclei according to the protocol "Isolation of single nuclei from solid tissues" steps 1-14.
dx.doi.org/10.17504/protocols.io.ufketkw

Dilute nuclei to 100 cells/ul. Use PBS-BSA for final dilution







Prepare syringes and lines for microfluidic device

Prepare enough syringes and lines for all samples at once (4-6 samples per experiment)

  1. Oil syringe: 10 ml
  2. Cell/Sample syringes: 3 ml
  3. Bead syringes: 3 ml with magnetic mixing disc
  4. Measure out tubing for the lines; make sure they are long enough to reach the microfluidic device from where the syringes will sit on the pumps
  5. For each line cut one blunt end (for blunt end needle) and one angled end (insert into the device)
  6. UV all tubing and needles



Reagent10 mL syringesVWR InternationalCatalog #BD 309695

Reagent3 mL syringesVWR InternationalCatalog #BD #309657

ReagentMagnetic Mixing DiscsVWR InternationalCatalog #772DP-N42-5-2

ReagentTubingVWR InternationalCatalog #BB31695PE/2

ReagentLuer lock 26-gage needlesVWR InternationalCatalog #305111

Load Syringes

Note
To load syringe, firmly press the tip of a 1000 ul pipette into the head of the syringe and slowly pull back on the plunger to draw in the solution. Pressing the tip in firmly helps reduce the introduction of bubbles. While holding the syringe in a vertical orientation, gently push out the air bubbles. Affix a 26G needle and tubing.

Note
Before droplet generation, coat connecting tubing and syringes with 1% BSA to prevent non-specific binding of nuclei to the surface, and then rinse with PBS

  1. Flush the tubing with corresponding buffer; keep syringes vertical when flushing
  2. Use Amount1 mL cell buffer to flush syringe/tube for each sample
  3. Use Amount1 mL DTT minus lysis buffer to flush syring/tube for each bead setup
  4. Load the syringes; keep syringes vertical when loading
  5. Load cells/nuclei into cell syringes, making sure there are no air bubbles
  6. Load beads into bead syringes, making sure there are no air bubbles
  7. After beads are loaded in the syringe, keep horizontal to prevent clogging



System Assembly

  1. Place oil syringe in pump and secure; using the screen, hold the free tube over the waste collection, then slowly move the pusher to the plunger until oil drips out
  2. Push the angled end of the tubing into the device
  3. Place cell/sample syringe in pump and secure; using the screen, hold the free tube over the wase collection, then slowly move the pusher to the plunger until buffer drips out
  4. Push the angled end of the tubing into the device
  5. Before placing the bead syringe, turn on the magnetic mixer for stirring disc (speed 25-30). Carefully rotate bead syringe by hand to mix up the beads in the lysis buffer.
  6. Place bead syringe in pump and secure. Make sure the magnetic disc is circling up and down vertically in the syringe to keep the beads well mixed.
  7. Using the screen, hold the free tube over the wase collection, then slowly move the pusher to the plunger until buffer drips out
  8. Push the angled end of the tubing into the device


Run Pumps for Droplet Formation

  1. Start oil pump
  2. Start bead pump
  3. Start cells/sample pump

Check for Droplet Formation

  1. Have outflow line go to waste
  2. Watch the beads move from the syringe to the device
  3. Once the beads get to the bead chamber in the device, use a clean microscope slide to catch a drop of output
  4. Check slide under a different microscope to see if droplets are uniform in size and shape
  5. Once droplets are uniform begin collecting

Collect

  1. Collect uniform droplets in 15 ml Falcon tubes until cells/sample runs out
  2. The pump will sound an alarm once the cell/sample runs out; turn off alarm
  3. STOP collecting in the 15 ml Falcon tube immediately (place a waste container under the outflow)

Stop pumps

  1. Stop all pumps in any order
  2. Place the 15 ml Falcon tube with droplets on ice

When running more than one sample Go togo to step #20
Repeat Step 20- Step 24 for each sample

Clean up (AFTER Reverse Transcription is set up to incubate)

  1. Turn off magnetic mixer
  2. Remove syringes from pumps; remove tubing from microfluidic device
  3. Power off pumps (switches located on the back left of the pump)
  4. Cell/sample outflow tubing goes in biohazardous solid waste
  5. All other lines can go in regular waste
  6. Cell/sample syringes go in biohazardous solid waste
  7. All other syringes can go in regular waste
  8. Cell/sample needles go in biohazardous sharps waste
  9. All other needles go in regular sharps waste

STAMP Collection
STAMP Collection
Single cell/nuclei Transcriptomes Attached to MicroParticles (STAMP)
Note
STAMPs are the barcoded beads with mRNA attached; for stability, work on ice/keep cold when working with STAMPs/RNA

Note
Add Maxima H- RTase to RT Mix (Step 10)

Prepare waste and collection tube

  • Need one 50 mL Falcon tube for waste (can use same waste from preparing syringes)
  • Need one new clean 50 mL Falcon tube for collection
  • Need one 30 um Uberstrainer
  • Autopipette, 5 mL pipette, and attachment for strainer


Reagent50 mL centrifuge tubesVWR InternationalCatalog #734-1876

Reagent30 um UberstrainerVWR InternationalCatalog #43-70030-03

Breakage

  1. Be careful not to disturb the oil/droplet band (direct buffer down the side of the 15 mL Falcon tube and control output so there is smooth flow)
  2. Before droplet breakage, add Amount600 µL mineral oil and incubate in water bath at Temperature72 °C forDuration00:05:00
  3. Let sit on ice for Duration00:05:00
  4. Remove the oil from the bottom of the 15 mL Falcon tube
  5. Add Amount5 mL cold 6X SSC
  6. Add Amount1 mL Perfluorooctanol (PFO) directly to the oil/droplet band to break the droplets; dispense in a circular motion directly over/onto the droplet bad
  7. Gently roll/rotate the 15 mL Falcon tube on ice to help break the droplets

ReagentMineral OilVWR InternationalCatalog #M5904

ReagentPerfluorooctanolVWR InternationalCatalog #370533

Filter/Collection

Set up the 30 um Uberstrainer over the waste tube
  1. Place strainer over waste tube (goal: save beads, discard supernatant)
  2. Attach autopipette attachment to strainer
  3. Angle/tilt tube so that no liquid will go up through the autopipette when using it for a vacuum
  4. Use Amount1 mL cold 6X SSC to moisten the filter

Filter the beads (over waste tube)
  1. Pass the aqueous (top layer) phase through the strainer
  2. Pass the organic (bottom layer) phase through the strainer
  3. Use a couple mililiters cold 6X SSC to rinse the 15 mL Falcon tube to try and get all the beads from the sides; pass the rinse through the strainer
  4. Rinse strainer/filter twice with cold 6X SSC

Collect the beads (over new/clean 50 mL Falcon tube)
  1. Carefully reverse the strainer over a new/clean 50 mL Falcon tube
  2. Wash strainer with Amount1 mL cold 6X SSC . Repeat four more times (5 washes total)
  3. Visually inspect the strainer to make sure all the beads have come off it

Spin Down

  1. Using a Temperature4 °C centrifuge , spin down the 50 mL Falcon tube at 1000xg for Duration00:01:00
  2. Carefully remove, supernatant, leaving approximately Amount1 mL cold 6X SSC


Transfer to 1.5 mL tube

  1. Resuspend beads in remaining Amount1 mL cold 6X SSC
  2. Transfer to a new/clean 1.5 mL microfuge tube
  3. Spin down (1000xg for Duration00:01:00 )
  4. Wash twice with Amount1 mL cold 6X SSC
  5. Wash with Amount300 µL 5X RT buffer
  6. Remove as much of the 5X RT buffer as possible without taking up any beads

ReagentMaxima 5X RT BufferVWR International

Reverse Transcription
Reverse Transcription
This step generates cDNA strands on the RNA hybridized to the bead primers. One RT mix is sufficient for processing approximately 90,000 beads.

  1. Add Amount200 µL RT Mix to the beads
  2. Incubate at TemperatureRoom temperature with rotation for Duration00:30:00
  3. Incubate at Temperature42 °C with rotation for Duration01:30:00
  4. Wash beads once with Amount1 mL TE-SDS
  5. Wash beads twice with Amount1 mL TE-TW
  6. If proceeding to Exonuclease I treatment, wash once with Amount1 mL 10 mM Tris pH 8.0
Note
Stopping point: if stopping, stop at TE-TW wash step. Beads can be stored at Temperature4 °C in TE-TW



Exonuclease I Treatment
Exonuclease I Treatment
This step chews back the excess bead primers that did not capture an RNA molecule. One Exonuclease Mix is sufficient for processing approximately 90,000 beads.

  1. After washing once with Amount1 mL 10 mM Tris pH 8.0 , resuspend in Amount200 µL Exonuclease Mix
  2. Incubate at Temperature37 °C with rotation for Duration00:45:00
  3. Wash beads once with Amount1 mL TE-SDS
  4. Wash beads twice with Amount1 mL TE-TW
  5. If proceeding to PCR, wash once with Amount1 mL H2O
Note
Stopping point: if stopping, stop at TE-TW wash step. Beads can be stored at Temperature4 °C in TE-TW


PCR
PCR
This steps utilizes PCR to amplify the cDNA constructed during the Reverse Transcription step.

Bead Count

  1. After washing once with Amount1 mL H2O , spin down to pellet beads
  2. Remove supernatant
  3. Add Amount1 mL H2O
  4. Mix well by pipette to evenly resuspend the beads
  5. Quickly remove Amount20 µL and pipette into a Fuchs-Rosenthal hemocytometer chamber
  6. Count all 16 boxes

Calculate number of beads to split into PCR tubes

  1. Calcuate the concentraion (beads/ul) = (#beads counts/16) x 5
  2. Apportion 2,000 beads into each PCR tube (want approximately 100 STAMPs per PCR tube)
Prepare Master Mix

Master Mix (Amount50 µL per PCR reaction )

Amount24.6 µL H2O
ReagentNuclease-free H2OVWR InternationalCatalog #AM9930
Amount0.4 µL 100 uM SMART PCR Primer
ReagentSMART PCR primer: AAGCAGTGGTATCAACGCAGAGTVWR International
Amount25 µL 2x Kapa HiFi Hotstart ReadyMix
ReagentKapa HiFi Hotstart ReadymixVWR InternationalCatalog #KK2601

PCR

  1. Spin down tubes
  2. Add Amount50 µL PCR Master Mix to each reaction
  3. Mix well by pipette
  4. Run the following program on a thermocycler

Temperature95 °C for Duration00:03:00
4 cycles of
Temperature98 °C for Duration00:00:20
Temperature65 °C for Duration00:00:45
Temperature72 °C for Duration00:03:00
13 cycles of
Temperature98 °C for Duration00:00:20
Temperature67 °C for Duration00:00:20
Temperature72 °C for Duration00:03:00
Then
Temperature72 °C for Duration00:05:00
Temperature4 °C forever



Purification and Quantification
Purification and Quantification
Magnetic Bead Purification

  1. Using either KAPA PureBeads or AMPure XP beads, add Amount30 µL room temperature magnetic beads to each PCR sample (this is a 0.6x beads to samples ratio based on volume)
  2. Purify according to manufacturer's instructions
  3. Elute in Amount10 µL H2O
ReagentAgencourt AMPure XP beadsVWR InternationalCatalog #A63881

Quantification

Can be performed by preferred method (qPCR, Qubit Assay, BioAnalyzer, Tapestation); we used Qubit Assay.

  1. Use Amount2 µL sample input for this quantification
  2. Quantify according to manufacturer's instructions

ReagentQubit 4 FluorometerVWR InternationalCatalog #Q33238

ReagentQubit dsDNA HS Assay KitVWR InternationalCatalog #Q32854


Note
The yield for 2000 beads generated from a 50 cell/ul total yield should be approximately 1-100ng.

QC Cutoff: > 1ng total


Amplified cDNA Gel

  1. Confirm average size of cDNA library via gel electrophoresis
  2. Average size should be between 1300-2000 bp

Tagmentation
Tagmentation
This step simultaneously tags and fragments the cDNA library using transposomes



Nextera Kit

  1. Preheat a thermocycler to Temperature55 °C
  2. Working in a cold rack/on ice: for each sample, combine Amount600 pg purified cDNA with H2O in a total volume of Amount5 µL
  3. To each tube, add Amount10 µL Nextera TD buffer "Tagment DNA" and Amount5 µL Amplicon Tagment enzyme "Amplicon Mix" (the total volume of the reaction is now Amount20 µL )
  4. Mix by pipette approximately 5 times
  5. Spin down
  6. Incubate at Temperature55 °C for Duration00:05:00
  7. Add Amount5 µL Neutralization Buffer (the total volume of the reaction is now Amount25 µL )
  8. Mix by pipette approximately 5 times
  9. Spin down (bubbles are normal)
  10. Incubate at TemperatureRoom temperature for Duration00:05:00
ReagentNextera XT DNA Library Preparation KitVWR InternationalCatalog #FC-131-1096


PCR work up of tagmented library

Prepare PCR Master Mix (Amount24 µL per PCR reaction )
Amount15 µL Nextera PCR mix
ReagentNextera XT DNA Library Preparation KitVWR InternationalCatalog #FC-131-1096
Amount8 µL H2O
ReagentNuclease-free H2OVWR InternationalCatalog #AM9930
Amount1 µL 10 uM New-P5-SMART PCR hybrid oligo
ReagentNew-P5-SMART PCR hybrid oligo: AATGATACGGCGACCACCGAGATCTACACGCCT GTCCGCGGAAGCAGTGGTATCAACGCAGAGT* A*CVWR International

PCR

  1. Add Amount24 µL Tagmentation PCR Master Mix to each tube
  2. To each individual tube, add Amount1 µL 10 uM Nextera N7XX oligo The total volume of the reaction is now Amount50 µL
  3. Mix well and run the following program on a thermocycler

Temperature95 °C for Duration00:00:30
12 cycles of
Temperature95 °C for Duration00:00:10
Temperature55 °C for Duration00:00:30
Temperature72 °C for Duration00:00:30
Then
Temperature72 °C for Duration00:05:00
Temperature4 °C forever

Purification and Quantification
Purification and Quantification
Magnetic Bead Purification

  1. Using either KAPA PureBeads or AMPure XP beads, add Amount30 µL room temperature magnetic beads to each PCR sample (this is a 0.6x beads to samples ratio based on volume)
  2. Purify according to manufacturer's instructions
  3. Elute in Amount12 µL to Amount15 µL H2O
ReagentAgencourt AMPure XP beadsVWR InternationalCatalog #A63881

2nd Magnetic Bead Purification

  1. Using either KAPA PureBeads or AMPure XP beads, perform a 0.6x purification
  2. Purify according to manufacturer's instructions
  3. Elute in Amount12 µL to Amount15 µL H2O
ReagentAgencourt AMPure XP beadsVWR InternationalCatalog #A63881


Quantification

Can be performed by preferred method (qPCR, Qubit Assay, BioAnalyzer, Tapestation); we used Qubit Assay.

  1. Use Amount1 µL sample input for this quantification
  2. Quantify according to manufacturer's instructions
  3. Convert ng/ul to nM

ReagentQubit 4 FluorometerVWR InternationalCatalog #Q33238

ReagentQubit dsDNA HS Assay KitVWR InternationalCatalog #Q32854



Note
The yield for 2000 beads generated from a 50 cell/ul final cell concentration should be approximately 400-1000 pg/ul.

QC Cutoff >1ng

Sequencing Library Gel

  1. Confirm average size of Sequencing library via gel electrophoresis
  2. Average size should be between 500-680 bp

Note
Smaller-sized libraries will have more polyA reads; larger libraries may have lower sequence cluster density and cluster quality. Although the target size is 500-680 bp, the range can be as broad as 420-700 bp.

Sequencing
Sequencing
MiSeq Sequencing - QC for estimation of library quality and number of nuclei captured

  1. Pool, denature, and dilute to loading concentration according to manufacturer's instructions
  2. Sequencing specifications
  • Read 1: 30 bp
  • Read 2: 75~100 bp
  • Read 1 Index: 8 bp
  • Custom Read 1 primer

Hiseq 2500 Sequencing

1. Combine 8-12 snDrop-seq libraries to make a 10 µl library pool at 3 nM for denaturation.
2. After final dilution, load a combined library at 12 pM to the sequencer
  • Read 1: 30 bp
  • Read 2: 75~100 bp
  • Read 1 Index: 8 bp
  • Custom Read 1 primer

ReagentCustom Read 1 primer: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAG AGTACVWR International

ReagentMiSeq v3 (150 cycle) KitVWR InternationalCatalog #MS-102-3001

Sequencing
Sequencing
snDrop-seq data processing

Mapping, demultiplexing and QC processing: https://github.com/chensong611/Dropseq_pipeline
  • Paired-end reads are removed if read 1 had more than four non-T bases in the last ten bases (to remove all non-poly(T)-captured contaminated reads)
  • Paired-end reads are removed if read 1 had one or more bases with a poor quality score (<10)
  • The right mate of each read pair is trimmed to remove any portion of the SMART adaptor sequence or any large stretches of poly(A) tails (6 consecutive bp or larger)
  • The trimmed reads are aligned to the human genome (GENCODE GRCH38) with STAR (e.g. v2.5) with default parameter settings
  • Reads that mapped to intronic or exonic regions as per the GENCODE gene annotation are included in gene counts
  • Barcode synthesis errors are corrected by inserting N at the last base of the cell barcode for reads in which the first 11 bases of the cell barcode are identical and the last T base of the UMI is the same
  • UMI counts for each gene of each nucleus are assigned by collapsing UMI reads that had only 1 edit distance to create a digital expression matrix (genes as rows, cells or nuclei as columns)