Jan 21, 2025
Version 1
SHARE-seq protocol v2.2 adapted for Mortazavi Lab V.1
- 1University of California, Irvine;
- 2Broad Institute of MIT and Harvard
- IGVF
Protocol Citation: Elisabeth Rebboah, Amelia Hall 2025. SHARE-seq protocol v2.2 adapted for Mortazavi Lab. protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvw1m4wlmk/v1
Manuscript citation:
Ma, S., Zhang, B., LaFave, L.M., Earl, A.S., Chiang, Z., Hu, Y., Ding, J., Brack, A., Kartha, V.K., Tay, T. and Law, T., 2020. Chromatin potential identified by shared single-cell profiling of RNA and chromatin. Cell, 183(4), pp.1103-1116.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 03, 2024
Last Modified: January 21, 2025
Protocol Integer ID: 104662
Keywords: single-cell, single-nucleus, snRNA-seq, scRNA-seq, Multiome, snATAC-seq, scATAC-seq
Funders Acknowledgements:
NHGRI
Grant ID: HG012077
Abstract
This protocol is an updated version of the SHARE-seq protocol as originally described by Ma et al. in Cell (2020): https://www.sciencedirect.com/science/article/pii/S0092867420312538. The updated protocol is used by the Epigenomics Platform and Gene Regulation Observatory at the Broad Institute in the service of data production for the IGVF project. This version is slightly modified from Amelia Hall's Protocols.io SHARE-seq protocol: https://www.protocols.io/view/share-seq-protocol-v2-2-81wgbx1oylpk/v4 with the equipment and personnel in the Mortazavi lab at UCI in mind. Some wording is edited for clarity and some buffer volumes increased to allow for some slight excess. It is also written with our "standard" experimental design using 8 samples and 1 plate set.
Briefly, SHARE-seq (Simultaneous High-throughput ATAC and RNA Expression with sequencing) is a method that simultaneously measures both chromatin accessibility (via ATAC-seq) and gene expression (via RNA-seq) at the single-nucleus level. Nuclei undergo Tn5 transposition to cleave open chromatin, followed by reverse transcription to capture mRNA, with a biotin tag added specifically to the mRNA molecules. The nuclei then undergo three rounds of combinatorial barcoding to label both the DNA fragments and mRNA within each nucleus. After barcoding, the nuclei are aliquoted into subpools and lysed. Biotin-tagged mRNA is pulled out using magnetic streptavidin beads, while the ATAC fragments remain in solution. Library preparation continues with PCR amplification, cleanup, second-strand synthesis (for RNA libraries), and final subpool-level indexing before sequencing.
The products of this protocol are two separate sets of single-nucleus ATAC-seq and RNA-seq libraries ready for sequencing on an Illumina sequencer.
Attachments
1.0 Planning your experiment
1.0 Planning your experiment
This protocol presumes your cells or isolated nuclei have been fixed in nuclease-free formaldehyde (0.2% for cultured cells/nuclei from tissues, 1% for primary PBMCs) and have been frozen at -80ºC as dry pellets. For more details on nuclei isolation, see our tissue-specific nuclei isolation protocols. To process 8 samples at once, we use Miltenyi Biotec products such as the gentleMACS tissue dissociator (cat. #130-096-427) and Nuclei Extraction Buffer (cat. #130-128-024). After nuclei extraction, we follow the Broad's fixation protocol (last section in attached document). Nuclei are counted before and after fixation and recorded in the spreadsheet, "samples into experiment" tab.
2022_07_15_GRO_nuclei_prep_combo.docx34KB SHARE-seq barcodes are hybridized in 3 "rounds" consisting of either 1 or 2 96-well plates per round. When using 3 plates (called the "Plate1" set), each subpool can contain a maximum of 25,000 cells or nuclei. Subpools can contain up to 100,000 cells or nuclei when both plate sets (Plate1 and Plate2) are used for barcoding.
For your experiment, determine the number of:
- Plate sets (1 or 2; in other words 3 plates total with 1 plate per round or 6 plates total with 2 plates per round)
- Samples
- Subpools
Fill these numbers into the spreadsheet, "experiment design" tab. The total volume of each reagent needed and cost per reagent will be automatically calculated on the "reagent_calculation" tab.
This protocol provides reagent calculations for a standard experiment: 1 plate set, 8 samples with 250,000 cells or nuclei per sample (therefore 1 ATAC reaction tube per sample), and 8 subpools of 25,000 cells or nuclei. Buffer volumes may need to be scaled up or down for your experiment accordingly.
Before starting, confirm you have enough of all the reagents needed using the spreadsheet, "reagent calculation" tab on the right. Each reagent is listed with total volume needed for the experiment, the vendor, catalog number, and location in the lab (update as needed!). Place orders for anything that is low on Quartzy and keep track of number of plate sets remaining. The most expensive and critical items are the IDT barcode plates (but you make a lot of aliquots) and the seqWell Tn5 transposase for the ATAC transposition.
Record the Round 1 well(s) corresponding to each sample in the spreadsheet, "samples into experiment" tab. Plate maps (plate map tab) are also helpful visual aids. Print one or both out before loading the Round 1 sample barcoding plate(s) in section 6.
1.1 Ordering plates, oligos, and barcodes from IDT
1.1 Ordering plates, oligos, and barcodes from IDT
Ordering oligo deepwell plates from IDT:
Using the attached Excel file, batch order the oligos on the tabs labeled "Plate1_R1 96", "Plate1_R2 96", and "Plate1_R3 96" from IDT in a 96 well "deepwell" plate. If 192 barcodes are desired (2 sets of plates), then order the oligos on the tabs labeled "Plate2_R1 96", "Plate2_R2 96", and "Plate2_R3 96" in addition to the Plate1 set. Order at 25 nM yield, 100 uM concentration, resuspended in IDTE 8.0 pH buffer, in a 96 well plate format.
SHARE_oligo_plates.xlsx40KB One order from IDT is used to make 2 stock plates from each original plate, and each stock plate is distributed into 9 working oligo plates (accounting for lost volume during pipetting). Therefore one IDT plate order which is approximately $5,400 per set of 3 plates ($10,800 for all 6) should be enough for 18 SHARE-seq experiments.
Several oligos must also be ordered from IDT:
| Type | Name | Sequence | Amount | Concentration | Purification | Approx. volume | |
| DNA | Blocked_ME_Comp | /5Phos/C*T*G* T*C*T* C*T*T* A*T*A* C*A*/3ddC/ | 1 umole | 100 uM | STD | 3 mL | |
| DNA | Read1 | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG | 1 umole | 100 uM | STD | 650 uL | |
| DNA | Round 1 blocking | CCCATGATCGTCCGAGTCTCGTGGGCTCGG | 1 umole | 100 uM | STD | 8 mL | |
| DNA | Round 1 linker | CCGAGCCCACGAGACTCGGACGATCATGGG | 1 umole | 1000 uM | STD | 600 uL | |
| DNA | Round 2 blocking | ATCCACGTGCTTGAGCGCGCTGCATACTTG | 1 umole | 100 uM | STD | 8 mL | |
| DNA | Round 2 linker | CAAGTATGCAGCGCGCTCAAGCACGTGGAT | 1 umole | 1000 uM | STD | 700 uL | |
| DNA | Round 3 blocking | GTGGCCGATGTTTCGCATCGGCGTACGACT | 1 umole | 100 uM | STD | 8 mL | |
| DNA | Round 3 linker | AGTCGTACGCCGATGCGAAACATCGGCCAC | 1 umole | 1000 uM | STD | 600 uL | |
| DNA | RT_primer | /5Phos/GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGNNNNNNNNNN/iBiodT/TTTTTTTTTTTTTTVN | 1 umole | 100 uM | RNASE | 250 uL | |
| RNA | TSO | AAGCAGTGGTATCAACGCAGAGTGAATrGrG+G | 1 umole | 100 uM | RNASE | ||
| DNA | P7 | CAAGCAGAAGACGGCATACGAGAT | 100 nmole | 100 uM | STD | 700 uL | |
| DNA | RNA_PCR_primer | AAGCAGTGGTATCAACGCAGAGT | 100 nmole | 100 uM | STD | 650 uL |
Total cost is approximately $2,300; however we did not get a good yield of the RT primer from IDT and ordered an additional 2 umoles (1375 uL) for $1,200. Since TSO has some RNA bases (the rG's), it is stored at -80ºC (Frozone, top shelf left hand side). Others are stored at -20ºC in SHARE oligo box. Stock plates and working oligo plates are also stored in their own boxes at -20ºC.
Make working aliquots of P7 primer and RNA PCR primer at 25 uM and store at -20ºC in SHARE oligos box.
Finally, order Illumina adapter and subpool indices:
| Type | Name | Sequence | Amount | Concentration | Purification | Approx. volume | |
| DNA | Ad1.1 | AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_1 | AATGATACGGCGACCACCGAGATCTACACATATGCGCTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_2 | AATGATACGGCGACCACCGAGATCTACACTGGTACAGTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_3 | AATGATACGGCGACCACCGAGATCTACACAACCGTTCTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_4 | AATGATACGGCGACCACCGAGATCTACACTAACCGGTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_5 | AATGATACGGCGACCACCGAGATCTACACGAACATCGTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_6 | AATGATACGGCGACCACCGAGATCTACACCCTTGTAGTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_7 | AATGATACGGCGACCACCGAGATCTACACTCAGGCTTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_8 | AATGATACGGCGACCACCGAGATCTACACGTTCTCGTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_9 | AATGATACGGCGACCACCGAGATCTACACAGAACGAGTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_10 | AATGATACGGCGACCACCGAGATCTACACTGCTTCCATCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_11 | AATGATACGGCGACCACCGAGATCTACACCTTCGACTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_12 | AATGATACGGCGACCACCGAGATCTACACCACCTGTTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_13 | AATGATACGGCGACCACCGAGATCTACACATCACACGTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_14 | AATGATACGGCGACCACCGAGATCTACACCCGTAAGATCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_15 | AATGATACGGCGACCACCGAGATCTACACTACGCCTTTCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL | |
| DNA | IDT8_i5_16 | AATGATACGGCGACCACCGAGATCTACACCGACGTTATCGTCGGCAGCGTCAGATGTGTAT | 100 nmole | 100 uM | STD | 800 uL |
Total cost is approximately $600. Make working aliquots at 25 uM and store at -20ºC in SHARE oligos box.
2022_02_08_Ad_Primer_List_vs_IDT8_primer.xlsx44KB For more information including the quotes / invoices from IDT, check this Google drive: https://drive.google.com/drive/folders/1GqWEmHZ9zb7ubwxfA_jdqVxgr9qQtrDu
You can also check order history on our lab's IDT account: order #19920592 is Plate1 round1 and round2, order #19943299 is Plate2 round1 and round2, order #19897236 is Plate sets 1 and 2 round 3, order #19890233 contains blocked_ME_comp, read1, blocking rounds, TSO, P7, and RNA PCR primer, order #19971858 contains linker oligos (at correct concentration...), order #19936774 contains the Illumina IDT8 barcodes and Ad1.1, and order #20256757 is the re-ordered RT primer at 2 umoles.
1.2 Making oligo plates
1.2 Making oligo plates
Thaw IDT deepwell plate at RT for 20-40 minutes and spin down before usage to prevent oligo cross-contamination between wells. Set aside 3 PCR machines for around 1.5 hours. Gather 6 Eppendorf DNA LoBind 96-well PCR plates and 3 sets of 18 color-coded Thermo Armadillo 96-well plates (18 green, 18 blue, and 18 orange). Gather several new boxes of tips. Spray down bench and pipettes with RNase-away and 70% ethanol.
Make 50 mL of STE buffer:
| Reagent | mL | Final concentration | Location | |
| 1M Tris pH 8.0 | 0.5 | 10 mM | RT at bench | |
| 5M NaCl | 0.5 | 50 mM | RT at bench | |
| 0.5M EDTA | 0.1 | 1 mM | RT at bench | |
| H2O | 48.9 | NA | RT at bench | |
| Total | 50 |
STE (oligo annealing buffer) recipe. Store at RT in 50 mL tube for at least a month.
Dilute 180 uL Round 1 linker oligo (1000 uM) with 7,920 uL STE buffer in a 15 mL tube and transfer volume to white plastic reservoir. Using the electronic 12-channel pipette, distribute 80 uL into every well of an Eppendorf LoBind 96-well PCR plate. Using a new set of tips for each well and the manual 12-channel pipette, mix 20 uL from the IDT Round 1 oligo deepwell plate at 100 uM with the Round 1 linker oligo in the 96-well plate.
Dilute 216 uL Round 2 linker oligo (1000 uM) with 7,371 uL STE buffer in a 15 mL tube and transfer volume to white plastic reservoir. Using the electronic 12-channel pipette, distribute 76 uL into every well of an Eppendorf LoBind 96-well PCR plate. Using a new set of tips for each well and the manual 12-channel pipette, mix 24 uL from the IDT Round 2 oligo deepwell plate at 100 uM with the Round 2 linker oligo in the 96-well plate.
Dilute 259.2 uL Round 3 linker oligo (1000 uM) with 7,047 uL STE buffer in a 15 mL tube and transfer volume to white plastic reservoir. Using the electronic 12-channel pipette, distribute 72 uL into every well of an Eppendorf LoBind 96-well PCR plate. Using a new set of tips for each well and the manual 12-channel pipette, mix 28 uL from the IDT Round 3 oligo deepwell plate at 100 uM with the Round 3 linker oligo in the 96-well plate.
Seal the plates with the Bio-Rad PX1 plate sealer at 180ºC for 5 seconds with foil seals (Bio-Rad cat. #1814045). Turn on the plate sealer, open door, and remove the metal support block. Set time and temperature and wait until it reaches 180ºC. Place the support block in the drawer, the 96-well plate on support block, and place a foil seal with white side facing up on the plate so that every well is covered. Select "Seal" to seal the plate. The foil may be warm but not hot when it comes out.
Anneal Round 1, Round 2, and Round 3 plates using the PCR cycling conditions below in 3 PCR machines. The slow ramp is critical for this step! The plates won't work without the exact cycling conditions below.
| Temperature | Time | Cycle | |
| 95ºC | 2 minutes | 1 | |
| -1ºC per cycle | 1 minute | 75 | |
| 20ºC | 2 minutes | 1 | |
| 4ºC | Forever | 1 |
Total time = 1 hr 26 min
After annealing, check if there is significant water evaporation for the wells at the corners/sides of the wells. With the PX1 heat sealing, we don't find that this occurs, but if you used more standard foil seals, there may be some evaporation on the sides. If there is, spin plates briefly and check for volume loss. Adjust the next step for volume remaining; e.g. add 90 uL STE.
Add 100 uL STE to each well of the annealed plate and mix well 7-8 times (200 uL total volume). Transfer 100 uL to another Eppendorf PCR plate. These two plates are your "stock plates" from which you will aliquot into the multicolored "working" oligo plates.
Aliquot 10 uL from your stock plates into 9 blue, green, or orange plates using the 12-channel electronic pipette. One row at a time, dispense 10 uL across all 9 plates, making sure the volumes are even. Check/fix any wells that look "off" manually. Be careful that all 9 plates are in the same orientation; notched corner (H1) at the bottom left. Each round should correspond to a color; record this color code and/or label plates!
Seal plates with plate sealer and foil seals as before. Store the plates in boxes at -20ºC. They are good for at least 6 months, and probably 12 months.
Repeat entire process for Plate2 set, if necessary.
1.3 Assemble Tn5 transposome for cDNA tagmentation
1.3 Assemble Tn5 transposome for cDNA tagmentation
In theory, SHARE-seq generates full-length cDNA which must be tagmented before Illumina sequencing using Tn5 complexed with Illumina Read 1 oligo. To do this, we use commercial unloaded Tn5 from Diagenode and anneal Illumina Read 1 and Blocked_ME_Comp. Illumina Read 1 corresponds to the primer site for where Read 1 will begin during sequencing, and Blocked_ME_Comp blocks the mosaic ends that would otherwise be automatically added by the Tn5 so that only Read 1 gets added to the cDNA.
Prepare tagmentation adapter mix and aliquot 50 uL in a PCR strip tube (4 tubes out of the 8):
| Reagent | uL for 1 aliquot | uL for 4 aliquots | Final concentration | Location | |
| 100 uM Read 1 | 26 | 104 | 50 uM | -20ºC SHARE oligos box | |
| 100 uM Blocked_ME_Comp | 26 | 104 | 50 uM | -20ºC SHARE oligos box | |
| 1M Tris pH 8.0 | 0.52 | 2.08 | 10 mM | RT at bench | |
| 5M NaCl | 0.52 | 2.08 | 50 mM | RT at bench | |
| Total | 53.04 | 212.16 |
Anneal oligos in a thermal cycler as follows:
| Temperature | Time | Cycles | |
| 85ºC | 2 minutes | 1 | |
| -1ºC per cycle | 1 minute | 65 | |
| 20ºC | 2 minutes | 1 | |
| 4ºC | Forever | 1 |
Total time = 1 hr 14 min
Heat a 1 mL aliquot of RNase free 100% glycerol (combustibles bin in hazardous cabinet) to 65ºC in a heat block (spray surface with RNase away and wipe down first). Pipetting slowly and using wide-bore tips, mix 50 uL glycerol with the 50 uL adapter in strip tube and split into 2 aliquots of 50 uL (use the 4 empty tubes in the same strip tube). The annealed adapters can be immediately used, or stored at -20ºC for at least 6 months.
1.4 Make SHARE buffers (month or so before experiment)
1.4 Make SHARE buffers (month or so before experiment)
Make the following buffers (stable for at least a month and probably several months). Save the leftover STE buffer from earlier, or make more.
| Reagent | mL | Final concentration | Location | |
| 1M Tris pH 8.0 | 0.5 | 10 mM | RT at bench | |
| 5M NaCl | 0.5 | 50 mM | RT at bench | |
| 0.5M EDTA | 0.1 | 1 mM | RT at bench | |
| H2O | 48.9 | NA | RT at bench | |
| Total | 50 |
STE recipe. Store at RT in 50 mL tube.
| Reagent | mL | Final (2x) concentration | Location | |
| 1M Tris pH 8.0 | 0.5 | 10 mM | RT at bench | |
| 5M NaCl | 20 | 2 M | RT at bench | |
| 0.5M EDTA | 0.1 | 1 mM | RT at bench | |
| H2O | 29.4 | NA | RT at bench | |
| Total | 50 |
2x BW recipe. Store at RT in 50 mL tube.
| Reagent | mL | Final concentration | Location | |
| 1M Tris pH 8.0 | 0.25 | 5 mM | RT at bench | |
| 5M NaCl | 10 | 1M | RT at bench | |
| 0.5M EDTA | 0.05 | 0.5 mM | RT at bench | |
| 10% Tween 20 | 0.25 | 0.05% | RT at bench | |
| H2O | 39.675 | NA | RT at bench | |
| Total | 50 |
1x BW-T recipe. Store at RT in 50 mL tube.
| Reagent | mL | Final (2x) concentration | Location | |
| 1M Tris pH 8.0 | 1 | 100 mM | RT at bench | |
| 5M NaCl | 0.2 | 100 mM | RT at bench | |
| 20% SDS | 0.2 | 0.40% | RT at bench | |
| H2O | 8.58 | NA | RT at bench | |
| Total | 10 |
2x RCB recipe. Store at RT in 15 mL tube for 6-12 months.
| Reagent | uL | Final (2x) concentration | Location | |
| 1M Tris pH 7.5 | 200 | 20 mM | RT at bench | |
| 1M MgCl2 | 100 | 10 mM | RT at bench | |
| Dimethylformamide (DMF) | 2000 | 20% | RT; Chemicals - flammables cabinet | |
| H2O | 7700 | NA | RT at bench | |
| Total | 10000 |
2x TD recipe. Store aliquots of 250-500 uL at -20ºC in SHARE reagents box.
1.5 Make SHARE buffers (day before experiment)
1.5 Make SHARE buffers (day before experiment)
The day before you plan to do the experiment (typically a Monday), prepare the following buffers.
| Reagent | uL | Final concentration | Location | |
| 100% RNase-free glycerol (wide bore tips) | 500 | 50% | RT; Chemicals - combustibles bin in hazardous cabinet | |
| 1M Tris pH 7.5 | 50 | 50 mM | RT at bench | |
| 5M NaCl | 20 | 100 mM | RT at bench | |
| 5mM EDTA | 20 | 0.1 mM | RT at bench | |
| 1M DTT | 1 | 1 mM | -20ºC SHARE reagents | |
| 10% NP-40 | 10 | 0.1% | RT at bench | |
| H2O | 390 | NA | RT at bench | |
| Total | 991 |
Dilution buffer recipe. Store at RT in 1.5 mL tube.
| Reagent | uL | Final concentration | Location | |
| 1M Tris pH 8.3 | 125 | 125 mM | RT at bench (adjust pH manually) | |
| 100 mM GTP | 50 | 5 mM | -20ºC SHARE reagents | |
| 5M NaCl | 30 | 150 mM | RT at bench | |
| 1M MgCl2 | 12.5 | 12.5 mM | RT at bench | |
| 1M DTT | 40 | 40 mM | -20ºC SHARE reagents | |
| H2O | 742.5 | NA | RT at bench | |
| Total | 1000 |
5x SMART RT recipe adapted from smart-seq v3 protocol. Store in 1.5 mL tube in -20ºC SHARE reagents box.
| Reagent | mL | Final concentration | Location | |
| 1M Tris pH 7.5 | 0.3 | 10 mM | RT at bench | |
| 5M NaCl | 0.06 | 10 mM | RT at bench | |
| 1M MgCl2 | 0.09 | 3 mM | RT at bench | |
| H2O | 29.55 | NA | RT at bench | |
| Total | 30 |
NI recipe. Make TWICE in 2 50 mL tubes, 60 mL total, and store at RT.
| Reagent | mL | Final concentration | Location | |
| 1M Tris pH 7.5 | 0.5 | 10 mM | RT at bench | |
| 5M NaCl | 0.1 | 10 mM | RT at bench | |
| 1M MgCl2 | 0.15 | 3 mM | RT at bench | |
| 10% NP-40 | 0.5 mL | 0.1% | RT at bench | |
| H2O | 48.75 | NA | RT at bench | |
| Total | 50 |
NIB recipe. Store at RT in 50 mL tube. (The NP-40 makes this a permeabilization buffer.)
Prepare 3 BSA-coated 1.5 mL tubes per sample plus one additional 1.5 mL tube. Either follow Parse protocol (prepare 1% BSA in nuclease-free water, fill tubes, incubate at 30 minutes RT in the cell culture hood, aspirate solution, and let dry for another 30 minutes in the hood) or quick BSA coating (add ~150 uL 7.5% BSA, vortex, remove solution, let tube sit on ice briefly, and remove any additional BSA with a pipette).
Also prepare 1 BSA-coated 15 mL tube and 4 BSA-coated reservoirs that can hold at least 10 mL. The clear Eppendorf reservoirs with divots at the bottom are better for recovering as many uL as possible compared to the shallow white reservoirs, but the 12-channel pipette doesn't fit them (the 8-channel does). We've used both and cell recovery is still ok with the white ones; the BSA coating is more important (and can be done a few minutes ahead of time if you forget! Use the quick method!)
1.6 Make SHARE buffers (fresh the morning of the experiment)
1.6 Make SHARE buffers (fresh the morning of the experiment)
When you come in to lab the morning of the experiment, set the swinging bucket centrifuge to 4ºC, turn on the microscope and add the adapter for slides, and gather two large ice buckets.
Wipe down bench and all pipettes with RNase-away and 80% ethanol and and gather new boxes of tips. You will need several new boxes of 200 uL X-tips for the 12-channel Rainin pipette during barcoding.
Turn on a thermomixer for the ATAC Tn5 transposition, set to 37ºC for 30 minutes and 500 rpm, and put the 1.5 mL block on the thermomixer.
Prepare the following buffers:
| Reagent | mL | Final concentration | Location | |
| NI | 50 | RT at bench | ||
| Enzymatic RI | 0.125 | 0.1 U/uL | -20ºC SHARE reagents box | |
| SUPERase RI | 0.125 | 0.1 U/uL | -20ºC SHARE reagents box | |
| 7.5% BSA | 0.267 | 0.04% | 4ºC | |
| Total | 50.517 |
NI-2RI recipe. Store on ice in 50 mL tube until use.
| Reagent | uL | Final concentration | Location | |
| NIB | 1000 | NA | RT at bench | |
| Enzymatic RI | 7 | 0.28 U/uL | -20ºC SHARE reagents box | |
| SUPERase RI | 7 | 0.14 U/uL | -20ºC SHARE reagents box | |
| Total | 1014 |
NIB-2RI recipe. Store on ice in 1 mL tube until use. Need around 100 uL per sample.
| Reagent | uL | Final concentration | Location | |
| NI-2RI | 10000 | NA | RT at bench | |
| 5% digitonin | 20 | 0.01% | -20ºC SHARE reagents box | |
| Total | 10020 |
NID-2RI recipe. Store on ice in 15 mL tube until use. To make 5% digitonin, weigh 250 mg powdered digitonin in fume hood and mix with 5 mL nuclease-free water, let dissolve, filter through Steriflip 0.22 µm filter unit with 50 mL tube, and aliquot in labeled 1.5 mL tubes. Store at -20ºC in SHARE reagents box.
| Reagent | uL | Final concentration | Location | |
| NI | 10000 | NA | RT at bench | |
| Enzymatic RI | 25 | 0.1 U/uL | -20ºC SHARE reagents box | |
| Total | 10025 |
NI-RI recipe. Store on ice in 15 mL tube.
| Reagent | uL (1 plate set) | uL (2 plate sets) | Final concentration | Location | |
| H2O | 2755 | 5510 | NA | RT at bench | |
| T4 ligase buffer (10x) | 576 | 1152 | 1x | -20ºC SHARE reagents box | |
| Enzymatic RI | 14.4 | 28.8 | 0.05 U/uL | -20ºC SHARE reagents box | |
| SUPERase RI | 46.08 | 92.16 | 0.32 U/uL | -20ºC SHARE reagents box | |
| 7.5% BSA | 92.16 | 184.32 | 0.1% | 4ºC | |
| Total | 3483.64 | 6967.28 |
Hybridization buffer recipe. Store on ice in 5 or 15 mL tube.
2.0 Washing and counting fixed cells or nuclei (1-2 hours)
2.0 Washing and counting fixed cells or nuclei (1-2 hours)
Thaw fixed samples on ice. If they were fixed in a BSA-coated tube, keep them in the same tube.
Otherwise, once thawed, use 500 uL NI-2RI to resuspend each fixed cell or nuclei pellet and transfer entire volume to a BSA-coated tube.
Spin 750xg, 4ºC, 5 minutes in swinging bucket centrifuge. Gently remove supernatant. Keep samples on ice as you work through them.
Wash with 500 uL NID-2RI without disturbing pellet.
Spin 750xg, 4ºC, 5 minutes in swinging bucket centrifuge. Gently remove supernatant.
Add 100 uL NIB-2RI to each sample and gently resuspend, incubate for 5 minutes on ice to permeabilize the nuclei.
Add 900 uL NI-RI to each sample, mix by inverting tubes.
Spin 750xg, 4ºC, 5 minutes in swinging bucket centrifuge. Set centrifuge to room temperature after you take out the samples.
Gently remove supernatant, using a P20 to remove as much buffer as possible.
Resuspend in approximately 50 uL NI-RI for every million cells/nuclei input; i.e. for 1 million nuclei, resuspend in 50 uL. For 2 million nuclei, resuspend in 150 uL NI-RI.
(SUPERase RI inhibits the Tn5 transposition, so using RI instead of 2RI is very important here.)
If the fixed cell pellet has an estimated 1 million cells or nuclei, use 2.5 uL sample and 17.5 uL NucBlue fixed cell ReadyProbes (DAPI) dye to count (1:8). If the pellet had >= 4 million, 2 uL sample and 20 uL dye (1:11) may be easier to count.
Load 10 uL into one side of a disposable hemocytometer and label the slide. Place the slide in the microscope adapter and focus on the grid using phase contrast on the transillumination (non-fluorescent) channel. Take a picture on the transillumination channel as well as the DAPI channel (nuclei should be very bright blue with rounded edges) and count cells/nuclei within the grid. Save picture. Repeat for a grid on the opposite side.
Determine concentration by multiplying the average counts across two grids by the dilution factor and also by 10 to get the number of cells/nuclei per uL. E.g. if count 1 is 104 and count 2 is 92, multiply the average (98) by dilution factor (in this case 11) and 10 = 10,120 nuclei / uL.
Determine the volume of cell/nuclei suspension that is 10,000 cells or nuclei (one ATAC transposition) for the total number of ATAC reactions (10,000 cells/reaction).
We typically do SHARE using 25 ATAC reactions (250k cells) as the basic "unit" of SHARE. Divide 250k by the concentration of cells or nuclei per uL to get the volume of sample. Adjust volume to 50 uL by adding NI-RI. E.g. 250k nuclei / 10,120 nuclei per uL= 24.7 uL, then normalize to 50 uL with 25.3 uL NI-RI.
3.0 ATAC Tn5 transposition (1.5 hours)
3.0 ATAC Tn5 transposition (1.5 hours)
Prepare 50 uL of 250k cells or nuclei per sample in BSA-coated 1.5 mL tubes using your concentration calculations. Use NI-RI to bring volume to 50 uL. Keep on ice.
In the meantime, a second technician can begin on transposome assembly.
Assemble transposome by mixing assembled Tn5 from seqWell and dilution buffer in a 0.5 mL tube. Incubate at RT for 30 minutes. The assembled transposome can be stored at -20ºC for up to two weeks.
| Reagent | uL / rxn | uL / sample (25 rxns) | uL for 8.5 samples | Location | |
| 1x seqWell Tn5 | 0.6 | 15 | 127.5 | -20C SHARE reagents box | |
| Dilution buffer | 1.875 | 46.9 | 398.65 | RT at bench | |
| Total | 2.475 | 61.9 | 526.15 |
Transposome assembly recipe for ATAC Tn5 reaction. Track the batch of Tn5 used.
Make TB buffer fresh:
| Reagent | uL / rxn | uL / sample (25 rxns) | uL for 8 samples | Location | |
| 0.2M Tris-acetate | 8.25 | 226.875 | 1815 | RT at bench | |
| 5M K-acetate | 0.66 | 18.15 | 145.2 | RT at bench | |
| 1M Mg-acetate | 0.5 | 13.75 | 110 | RT at bench | |
| 100% DMF | 8 | 220 | 1760 | RT; Chemicals - flammables cabinet | |
| H2O | 24.04 | 661.1 | 5288.8 | RT | |
| PIC (protease inhibitor cocktail) | 0.2 | 5.5 | 44 | -20ºC SHARE reagents box, in large glass bottle | |
| Enzymatic RI | 0.85 | 23.375 | 187 | -20ºC SHARE reagents box | |
| Total | 42.5 | 1168.75 | 9350 |
1x TB recipe. Store on ice in 15 mL tube until use. Pipette DMF in fume hood. Volumes are actually for 27.5 reactions so don't need extra volume here.
Add 1062.5 uL 1x TB to cells or nuclei in NI-RI (50 uL total volume). You can add 531 uL twice with a P1000. (This is for the standard 25 reaction per sample; 42.5 uL 1x TB per reaction). Incubate at RT for 10 minutes. This is a permeabilization step.
(Take care in adding the buffer, 1.5 mL ATAC tubes will be very full! I don't recommend using 2 mL tubes because it will be harder to remove supernatant without disturbing the invisible pellet later.)
Add 61.9 uL of assembled Tn5 to each ATAC tube, mix well by careful pipetting. (2.475 uL per reaction).
Close 1.5 mL tube tightly and shake in the thermomixer set to 500rpm for 30 minutes, 37ºC. This is the Tn5 transposition reaction.
Every 5 minutes, take the entire block off the thermomixer and invert to mix. This resets the timer on the thermomixer, so use an external timer!
Carefully add 400 uL NID-2RI to each tube and spin down at 750xg, 23ºC, for 5 minutes in swinging bucket centrifuge. Do not be concerned if you do not see a pellet. (Reduced volume of NID-2RI from 500 uL to 400 uL to prevent tube overflowing.)
Remove supernatant carefully as best as you can. Gently resuspend cells or nuclei with 500 uL NI-2RI, and spin down at 750xg, 23ºC, 5 minutes in swinging bucket centrifuge.
Remove supernatant carefully as best as you can and resuspend cells or nuclei in 60 uL NI-2RI. Trust that they are there!
4.0 Optional PolyAdenylation module (45 minutes)
4.0 Optional PolyAdenylation module (45 minutes)
If your samples are from hematopoietic compartment (PBMCs, HSCs), you’ll want to use the optional exogenous polyAdenylation module in this section before Reverse Transcription to improve RNA capture (since PBMCs have a lot of nucleases). If not, skip ahead to section 5.0 Reverse Transcription (starting at step 55).
For each ATAC tube, mix 60 uL cells/nuclei in NI-2RI from the previous step with 240 uL PolyA master mix (recipe below), and incubate at 37ºC for 15 minutes in a thermomixer without mixing. (Each 1.5mL ATAC tube is a single polyA reaction).
| Reagent | uL / ATAC tube | uL for 8.5 ATAC tubes | Location | |
| H2O | 126.6 | 1076.1 | RT at bench | |
| 5x SMART RT buffer | 60 | 510 | -20ºC SHARE reagents box | |
| Enzymatic RI | 1.8 | 15.3 | -20ºC SHARE reagents box | |
| SUPERase RI | 3.6 | 30.6 | -20ºC SHARE reagents box | |
| rATPs (NEB: P0756S) | 30 | 255 | Need to order! | |
| E coli PolyA (NEB: M0276S) | 18 | 153 | Need to order! | |
| Total | 240 | 2040 |
Polyadenylation master mix recipe. Volumes are exact hence the extra + 0.5 volume. Prepare in 5 mL tube and store on ice.
Add 200 uL NID-2RI, spin down at 1000xg, 5 minutes, 23ºC in swinging bucket centrifuge.
Remove supernatant and add 200 uL NI-2RI, mix by inverting.
Spin down at 1000xg, 5 minutes, 23ºC in swinging bucket centrifuge, remove as much supernatant as possible.
Resuspend cells so the total volume is 60 uL NI-2RI.
5.0 Reverse Transcription (1 hour)
5.0 Reverse Transcription (1 hour)
Make the following master mix for reverse transcription:
| Reagent | uL / ATAC tube | uL for 11 ATAC tubes | Location | |
| 5x SMART RT buffer | 70 | 770 | -20ºC SHARE reagents box | |
| Enzymatic RI | 2.19 | 24.1 | -20ºC SHARE reagents box | |
| SUPERase RI | 4.38 | 48.18 | -20ºC SHARE reagents box | |
| dNTPs | 17.5 | 192.5 | -20ºC SHARE reagents box | |
| 100 uM RT primer | 35 | 385 | -20ºC SHARE oligos box | |
| H2O | 10.94 | 120.34 | RT at bench | |
| 50% PEG | 105 | 1155 | -20ºC SHARE reagents box | |
| Maxima H Minus Reverse Transcriptase (add right before RT reaction) | 35 | 385 | -20ºC SHARE reagents box | |
| Total | 280 | 3080 |
RT master mix recipe. Volumes are exact hence the extra +3 volume; mix is viscous and we have consistently ran out. Need a LOT of Maxima H Minus; the tubes in the -20ºC SHARE reagents box have been pooled from many.
For each ATAC 25 reaction tube, add 280 uL RT mix to 60 uL cells or nuclei in NI-2RI. Aliquot 50 uL to 7 wells in an Eppendorf DNA LoBind 96 well plate. If needed (for example if you ended up with >60 uL of resuspended cells), use an 8th well. Record where each sample (ATAC reaction) was loaded! Then, run the RT thermocycler protocol as described below.
| Temperature | Time | Cycles | |
| 50ºC | 10 minutes | 1 | |
| 8ºC | 12 seconds | 3 | |
| 15ºC | 45 seconds | 3 | |
| 20ºC | 45 seconds | 3 | |
| 30ºC | 30 seconds | 3 | |
| 42ºC | 2 minutes | 3 | |
| 50ºC | 3 minutes | 3 | |
| 50ºC | 5 minutes | 1 |
Total time = 41 minutes.
While RT is going, set thermomixer to 23ºC for the hybridization reaction and put the 96 well block on. Take out oligo plates and thaw at RT.
Pool all reactions for a given sample in a BSA-coated 1.5 mL tube, add 200 uL NID-2RI per 7-8 wells of the RT plate, spin down at 750xg, 5 minutes, 23ºC using a swinging bucket centrifuge. Note: the pellet may look larger than before - this is due to BSA dropping out of solution.
Remove supernatant. Gently resuspend pellet with 500 uL NI-2RI to wash, spin down at 750xg, 5 minutes, 23ºC in a swinging bucket centrifuge.
6.0 Hybridization (1.5 hours)
6.0 Hybridization (1.5 hours)
Remove supernatant and resuspend each sample in NI-2RI. The amount each sample is resuspended in depends on the number of samples and sets of plates per experiment. For a single sample and one set of plates, resuspend in 1,152 uL NI-2RI. For 8 samples on one set of plates, resuspend each sample in 144 uL NI-2RI.
| Fraction of plate | uL NI-2RI | |
| 2 plates | 2304 | |
| 1 plate | 1152 | |
| 1/2 plate | 576 | |
| 1/3 plate | 384 | |
| 1/4 plate | 288 | |
| 1/8 plate | 144 |
Add hybridization buffer to each sample. If volume exceeds 1.5 mL, transfer sample to a BSA-coated reservoir and add hybridization buffer. Mix gently.
| Fraction of plate | uL Hybridization buffer | |
| 2 plates | 6967.28 | |
| 1 plate | 3483.64 | |
| 1/2 plate | 1741.82 | |
| 1/3 plate | 1161.21 | |
| 1/4 plate | 840.91 | |
| 1/8 plate | 435.46 |
Making sure oligo plates are completely thawed, spin all 3 plates at 100xg, 23ºC, 1 minute in swinging bucket centrifuge to prevent cross-contamination between wells.
Place Round 1 oligo plate on a flat surface and carefully remove seal.
Load Round 1 oligo plate as follows:
- Set up 1.5 mL sample tubes in desired orientation in a large 1.5 mL tube rack.
- Double-check the order matches your printed plate map.
- Set an 8-channel Move-It pipette to 45 uL and mix samples in 1.5 mL tubes 2-3x by pipetting gently.
- Adjust spacing of tips to 9.5 on the Move-It pipette
- Transfer 45 uL of cells/nuclei to Round 1 plates and mix 2-3x by pipetting gently.
- Change tips between wells!
If you only have a few samples, use regular multichannel and BSA-coated reservoir to transfer samples to plate.
Seal plate with sticky plate seal (the white ones that come in Parse kits work well) and shake at 300rpm for 25 minutes at 23ºC.
Prepare Blocking oligo 1 as below and transfer to a reservoir (does not have to be BSA-coated).
| Reagent | uL (1 plate set) | uL (2 plate sets) | Location | |
| Round 1 blocking oligo (100 uM) | 266.07 | 532.14 | -20ºC SHARE oligos box | |
| T4 ligase buffer (10x) | 221.76 | 443.52 | -20ºC SHARE reagents box | |
| H2O | 721.77 | 1443.54 | RT at bench | |
| Total | 1209.6 | 2419.2 |
Add blocking oligo mix as follows:
- Using an 8- or 12-channel pipette, transfer 10 uL Blocking oligo 1 to each well, pipetting up and down to mix thoroughly, changing tips between columns or rows.
- Seal with white plate seal and shake at 300rpm for 15 minutes at 23ºC.
Pool samples as follows:
- Set an 8- or 12-channel pipette to 70 uL and pipette each column or row in the Round 1 plate up and down 2-3 times to mix without introducing bubbles (i.e. pipette partial volumes, don't go to the full stops).
- Draw up all volume and dispense into a BSA-coated reservoir.
- After the first column or row, also pipette up and down 2-3 times after ejecting each column or row, avoiding bubbles.
- After all wells have been pooled, pipette up and down 4-5 times to mix in the reservoir.
Discard Round 1 plate after all wells are pooled.
Carefully remove seal from Round 2 oligo plate(s) and transfer 55 uL of the pooled mixture to each well using an 8- or 12-channel pipette, pipetting 2-3x to mix each column or row. Change tips between columns or rows. Shake at 300rpm for 25 minutes at 23ºC.
Prepare Blocking oligo 2 as below and transfer to a reservoir (does not have to be BSA-coated).
| Reagent | uL (1 plate set) | uL (2 plate sets) | Location | |
| Round 2 blocking oligo (100 uM) | 319.31 | 638.61 | -20ºC SHARE oligos box | |
| T4 ligase buffer (10x) | 221.76 | 443.52 | -20ºC SHARE reagents box | |
| H2O | 668.54 | 1336.86 | RT at bench | |
| Total | 1209.6 | 2419.2 |
Add blocking oligo mix as follows:
- Using an 8- or 12-channel pipette, transfer 10 uL Blocking oligo 2 to each well, pipetting up and down to mix thoroughly, changing tips between columns or rows.
- Seal with white plate seal and shake at 300rpm for 15 minutes at 23ºC.
Pool samples as follows:
- Set an 8- or 12-channel pipette to 80 uL and pipette each column or row in the Round 2 plate up and down 2-3 times to mix without introducing bubbles (i.e. pipette partial volumes, don't go to the full stops).
- Draw up all volume and dispense into a BSA-coated reservoir.
- After the first column or row, also pipette up and down 2-3 times after ejecting each column or row, avoiding bubbles.
- After all wells have been pooled, pipette up and down 4-5 times to mix in the reservoir.
Carefully remove seal from Round 3 oligo plate(s) and transfer 65 uL of the pooled mixture to each well using an 8- or 12-channel pipette, pipetting 2-3x to mix each column or row. Change tips between columns or rows. Shake at 300rpm for 25 minutes at 23ºC.
Prepare Blocking oligo 3 as below and transfer to a reservoir (does not have to be BSA-coated).
| Reagent | uL (1 plate set) | uL (2 plate sets) | Location | |
| Round 3 blocking oligo (100 uM) | 278.25 | 556.5 | -20ºC SHARE oligos box | |
| H2O | 931.35 | 1862.7 | RT at bench | |
| Total | 1209.6 | 2419.2 |
Add blocking oligo mix as follows:
- Using an 8- or 12-channel pipette, transfer 10 uL Blocking oligo 3 to each well, pipetting up and down to mix thoroughly, changing tips between columns or rows.
- Seal with white plate seal and shake at 300rpm for 15 minutes at 23ºC.
7.0 Ligation (45 minutes)
7.0 Ligation (45 minutes)
Using an 8- or 12-channel pipette and BSA-coated reservoir, pool the contents of each well in the reservoir. Use a P1000 to transfer the mixture to a 15 mL BSA-coated conical tube.
Total volume should be ~7 mL for experiments done with 1 plate set and ~14 mL for 2 plate sets.
Spin down at 750xg for 5 minutes at 23ºC in a swinging bucket centrifuge.
Carefully aspirate and discard supernatant and gently resuspend pellet with 1 mL NID-2RI to wash.
Spin down at 750xg for 5 minutes at 23ºC in a swinging bucket centrifuge.
Carefully aspirate and discard supernatant and add 1 mL NI-2RI without disturbing pellet (let flow down side of tube slowly.)
Spin down at 750xg for 5 minutes at 23ºC in a swinging bucket centrifuge.
Carefully aspirate and discard supernatant and resuspend pellet in 80 uL NI-2RI.
Mix sample with 320 uL ligation mix (recipe below) and aliquot 50 uL to 8 PCR strip tubes.
| Reagent | uL (1 plate set) | uL (2 plate sets) | Location | |
| H2O | 279.1 | 558.14 | RT at bench | |
| Enzymatic RI | 3.52 | 7.04 | -20ºC SHARE reagents box | |
| SUPERase RI | 1.1 | 2.2 | -20ºC SHARE reagents box | |
| T4 ligase buffer (10x) | 44 | 88 | -20ºC SHARE reagents box | |
| T4 ligase (400 U/uL) | 22 | 44 | -20ºC SHARE reagents box | |
| 7.5% BSA | 2.34 | 4.69 | 4ºC | |
| Total | 352 | 704 |
Ligation mix recipe. x1.1 from original protocol because volumes were exact. Prepare in 1.5 mL tube and store on ice.
Shake at 300rpm for 30 min at 23ºC.
Pool samples in a BSA-coated 1.5mL tube, spin down 750xg, 5 minutes, 23ºC. Carefully aspirate and discard supernatant.
Gently resuspend pellet with 1mL NI-2RI.
Spin down at 750xg, 5 minutes, 23ºC. Carefully aspirate and discard supernatant.
Presume 80-85% loss of nuclei over the course of the protocol, so for every 30,000 retained nuclei, resuspend in 10 uL NI-2RI (goal is ~3,000 cells or nuclei/uL).
For example: With 2 million starting cells (250k per sample, 8 samples), presume 300k are retained, and resuspend in 100 uL NI-2RI.
Using 4 uL cells, mix with 16 uL NucBlue fixed cell ReadyProbes (DAPI) dye. Count intact nuclei (bright blue, consistent size, rounded edges) in a manual hemocytometer. (Decreased DF from original protocol; ~3,000 cells or nuclei/uL at 1:4 dilution = ~75 cells or nuclei per grid.)
To get number of cells or nuclei per uL, multiply average of two counts by DF (4) and conversion factor of 10.
7.1 Lysis and subpool generation (1 hour 15 minutes)
7.1 Lysis and subpool generation (1 hour 15 minutes)
Here you will aliquot cells or nuclei into "subpools", and then digest the remaining proteins away to leave only barcoded nucleic acids. The number of cells or nuclei per subpool strongly depends on the experimental setup: a 96 barcode (single plate) experiment should not contain more than 25,000 cells or nuclei per subpool - the risk of barcode collisions (two different cells with the same randomly generated barcode) increases substantially (>2.5%). A 192 barcode (two plate) experiment has a maximum count of 100,000 cells or nuclei per subpool, though theoretically 200,000 should be possible.
Determine volume of sample for your target subpool size (for example, 25,000 nuclei target / 3,125 nuclei per uL = 8 uL). Bring the volume of each subpool up to 50 uL using NI-2RI in PCR strip tubes.
Prepare proteinase K master mix (lysis buffer).
| Reagent | uL / subpool | uL for 8.5 subpools | Location | |
| 2x RCB | 50 | 425 | RT at bench | |
| Proteinase K (20 mg/mL) | 2 | 17 | -20ºC SHARE reagents box | |
| SUPERase RI | 2 | 17 | -20ºC SHARE reagents box | |
| Total | 54 | 459 |
Proteinase K master mix recipe. Volumes are exact hence the extra + 0.5 volume. Prepare in 1.5 mL tube and store on ice.
Add 54 uL proteinase K mastermix to each subpool in 50 uL NI-2RI.
Incubate subpools at 55ºC for one hour on the thermal cycler with lid set to 65ºC.
STOPPING POINT. End of day 1! Can store subpool lysates in PCR strip tube in a rack at -80ºC for up to a week.
8.0 Reverse crosslinking pull-down (1.5 hours)
8.0 Reverse crosslinking pull-down (1.5 hours)
The morning of day 2, gather two large ice buckets, magnetic racks (one for 1.5 mL tubes and one for PCR strip tubes), and spray down bench and pipettes with RNase-away and 70% ethanol.
Should have prepared 2x BW, 1x BW-T, and STE buffers in section 1.4 but if not prepare them now. Gather MyOne C1 Dynabeads and an aliquot of Ampure XP beads from 4ºC fridge and equilibrate to room temperature. Prepare fresh 80% ethanol, 500 uL per sample, in a clean Eppendorf reservoir.
While preparing the following buffers, thaw subpool lysates on ice.
Add RNase inhibitors fresh. Note that the RNase inhibitor concentrations are adjustable - these concentrations work well for 25,000-100,000 cells or nuclei.
| Reagent | uL / subpool | uL for 8.5 subpools | Location | |
| 2x BW | 110 | 935 | RT at bench | |
| SUPERase RI | 2 | 17 | -20ºC SHARE reagents box | |
| Total | 112 | 952 |
2x BW/RI recipe. Volumes are exact hence the extra + 0.5 volume. Store on ice in 1.5 mL tube.
| Reagent | uL / subpool | uL for 8 subpools | Location | |
| 1x BW-T | 500 | 4,000 | RT at bench | |
| SUPERase RI | 10 | 80 | -20ºC SHARE reagents box | |
| Total | 510 | 4,080 |
1x BW-T/RI recipe. Store on ice in a clean Eppendorf reservoir.
| Reagent | uL / subpool | uL for 8 subpools | Location | |
| STE | 200 | 1,600 | RT at bench | |
| SUPERase RI | 1 | 8 | -20ºC SHARE reagents box | |
| Total | 201 | 1,608 |
1x STE/RI. Store on ice in a clean Eppendorf reservoir.
Ensure subpool lysates are thawed. Mix each subpool lysate with 2.5 uL 100mM PMSF in 100% isopropanol (IPA) and incubate at RT for 10 minutes to neutralize lysis.
To make 1 mL PMSF in 100% IPA, use 17mg PMSF and weigh into a 1.5mL Eppendorf tube. Fill tube with IPA up the 1 mL mark and dissolve powder. Can be stored at -20ºC for several months.
While subpools are incubating, in a separate 1.5 mL tube, mix 10xN uL of room temperature MyOne C1 Dynabeads (vortex well to mix before pipetting) with 100xN ul of 1x BW-T and place on a magnetic rack until liquid becomes clear (~2 minutes).
(N = number of subpools. For example, for 8 subpools mix 80 uL of MyOne C1 Dynabeads with 800 uL 1x BW-T.)
Remove the clear supernatant and discard. Take tube off the magnet and resuspend with 100xN uL 1x BW-T without RI (for example for 8 subpools, 800 uL 1x BW-T). Ensure beads are fully resuspended and not stuck to the side of the tube. Place tube back on magnetic rack and wait until liquid becomes clear (~2 minutes).
Repeat previous step for a second wash.
Remove the clear supernatant and discard. Take tube off the magnet and resuspend with 100xN uL BW-T/RI. Ensure beads are fully resuspended and not stuck to the side of the tube. Place tube back on magnetic rack and wait until liquid becomes clear (~2 minutes).
Remove the clear supernatant and discard. Resuspend beads in 110xN uL 2x BW/RI. (For 8 subpools, 880 uL).
Add 100 uL of washed beads to each subpool lysate in PCR strip tubes and vortex briefly to mix. (Do not pipette in order to save volume, cDNA is unamplified at this stage!)
Rotate/nutate at RT for 60 minutes.
Put PCR strip tubes on the small magnetic rack and wait until liquid becomes clear (~2 minutes). Using a multichannel pipette, transfer supernatant containing transposed ATAC chromatin fragments (~200uL) to a new set of PCR strip tubes for library preparation. The cDNA fragments remain bound to the beads. The supernatant is stable at RT for several hours (but we prepare the ATAC libraries right away, using a paired system where one person handles the cDNA, and the other can handle the ATAC, see section 10 below).
We like to use a color scheme where tube labels written in blue pen = ATAC and red pen = cDNA (before labeling final libraries/cDNA with printed labels).
Take PCR strip tube containing cDNA/RNA-bound beads off the magnet and resuspend beads in each subpool with 100 uL 1xBW-T/RI using a multichannel pipette. Take care not to lose any volume. Place tubes back on magnetic rack and wait until liquid becomes clear (~2 minutes). Remove the clear supernatant and discard.
Repeat previous step twice for a total of three washes.
With tubes still on the magnet, add 100 uL 1xSTE/RI with multichannel pipette to wash without resuspending beads.
9.0 RNA library preparation: template switch (2 hours)
9.0 RNA library preparation: template switch (2 hours)
Make the template switch mix using the recipe below:
| Reagent | uL / subpool | uL for 8 subpools | Location | |
| H2O | 1.25 | 10 | RT at bench | |
| 50% PEG 6000 | 15 | 120 | -20ºC SHARE reagents box | |
| 5x SMART RT buffer | 10 | 80 | -20ºC SHARE reagents box | |
| Ficoll PM-400 (20%) | 10 | 80 | RT at bench | |
| 10 mM dNTPs | 5 | 40 | -20ºC SHARE reagents box | |
| RNase inhibitor (Lucigen) | 10 | 80 | -20ºC SHARE reagents box | |
| 100 uM TSO | 1.25 | 10 | -80ºC SHARE reagents box | |
| Maxima H Minus Reverse Transcriptase (add right before reaction) | 2.53 | 20.24 | -20ºC SHARE reagents box | |
| Total | 55 | 440 |
Template switch mix recipe. Prepare in 1.5 mL tube and store on ice.
Remove the clear supernatant from the beads and discard. Resuspend beads in 50 uL template switch mix per tube using a multichannel pipette, being careful to avoid beads drying out after removing supernatant (add volume to all tubes quickly without changing tips then go back and resuspend beads well with multichannel).
Rotate/nutate at RT for 30 minutes. In the meantime, turn on a thermomixer and set to 42ºC.
Incubate at 42ºC for 90 minutes, shaking at 300rpm, resuspend beads at start, 30 minutes, 60
minutes, and at the end of the incubation by flicking the tubes to mix settled beads best as you can. Don't pipette to mix in order to avoid RNase contamination and volume loss.
10.0 ATAC library preparation (3 hours)
10.0 ATAC library preparation (3 hours)
Label 3 1.5 mL tubes and 2 purple MinElute spin columns (from 4ºC fridge) per subpool. For one set of 1.5 mL tubes, label nicely using label printer with subpool and experiment IDs.
Mix supernatant with ATAC fragments from step 105 (~200 uL) thoroughly with 5x volume Qiagen PB binding buffer (1,000 uL) in a labeled 1.5 mL tube, then add 600 uL to MinElute spin column.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Add the remaining 600 uL ATAC supernatant mixed with PB to the same columns. Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Add 750 uL of Qiagen PE wash buffer to the columns. Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to capture any excess buffer. Discard flowthrough and 2 mL collection tube. Place columns in labeled 1.5 mL tubes.
Add 11 uL of EB (10mM Tris, pH 8.0) directly to the column matrix. Incubate for 1 minute at room temperature.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to elute the DNA.
Add another 11 uL EB directly to the column matrix, incubate for 1 minute at room temperature, and spin again for 1 minute, 15,000rpm in benchtop centrifuge for a total of ~20 uL eluate.
Prepare ATAC PCR mix:
| Reagent | uL / subpool | uL for 8.5 subpools | Location | |
| NEBNext 2x PCR mastermix | 25 | 212.5 | -20ºC SHARE reagents box | |
| P7 primer 25 uM | 1 | 8.5 | -20ºC SHARE oligos box | |
| H2O | 3 | 25.5 | RT at bench | |
| Total | 29 | 246.5 |
ATAC PCR mix recipe. Volumes are exact hence the extra + 0.5 volume. Prepare in 1.5 mL tube and store on ice.
Mix ~20 uL subpool eluates with 29 uL PCR mix and 1 uL IDT8 i5 1-16 primer at 25 uM! Record which subpool got which primer in spreadsheet, "Experiment" tab.
Run ATAC PCR as described below:
| Temperature | Time | Cycles | |
| 72ºC | 5 minutes | 1 | |
| 98ºC | 30 seconds | 1 | |
| 98ºC | 10 seconds | 5 | |
| 65ºC | 30 seconds | 5 | |
| 72ºC | 60 seconds | 5 | |
| 4ºC | Hold | 1 |
Total time = 22 minutes.
Next you will run a qPCR to determine the additional number of PCR cycles for the ATAC libraries.
Prepare ATAC qPCR mastermix:
| Reagent | uL / subpool | uL for 8 + 2 subpools | Location | |
| NEBNext 2x PCR mastermix | 5 | 50 | RT at bench | |
| Ad1.1 25uM oligo | 0.2 | 2 | -20ºC SHARE reagents box | |
| P7 primer 25 uM | 0.2 | 2 | -20ºC SHARE reagents box | |
| 10x SYBR green | 0.9 | 9 | ||
| H2O | 3.7 | 37 | ||
| Total | 10 | 100 |
ATAC qPCR mix recipe. Volumes are small & exact hence the extra +1 volume and another +1 for the NTC. Prepare in 0.5 mL or 1.5 mL tube and store on ice.
Aliquot 10 uL qPCR mix to N+1 wells in a green Bio-Rad qPCR plate (use middle of plate, e.g. D3-D11), taking care not to introduce bubbles.
Add 5 uL from each ATAC subpool and mix without introducing bubbles. For the last well, add 5 uL nuclease-free water for a no template control (NTC) to check for PCR mastermix contamination. Store remaining ATAC subpools (45 uL) on ice while qPCR is running.
Run the qPCR cycle program below on a Bio-Rad CFX96. Plate read at 72ºC.
| Temperature | Time | Cycles | |
| 98ºC | 30 seconds | 1 | |
| 98ºC | 10 seconds | 25 | |
| 65ºC | 30 seconds | 25 | |
| 72ºC | 60 seconds | 25 | |
| 12ºC | Hold | 1 |
Total time = 1 hour 15 minutes
Determine number of additional PCR cycles for the rest of the ATAC subpools.
For this experiment, roughly 1/3 of the plateau at 1600 RFU (yellow line) = 500 RFU (pink line); amplification curves for 6 out of 8 subpools cross 500 by 4 cycles (blue line) so we went with 4 additional PCR cycles and got good library yields (>20 ng/uL concentration).
For this experiment, roughly 1/3 of the plateau at 2500 RFU (yellow line) = 800 RFU (pink line); amplification curves for 3 out of 4 subpools cross 800 by ~7 cycles (blue line) so we went with 7 additional PCR cycles and got ok library yields (~10 ng/uL concentration).
Run additional PCR cycles for the rest of the subpools (45 uL) using the qPCR cycle schema. The tubes already have master mix and primer so you don't have to add anything, just put them back on the thermal cycler and run additional cycles.
| Temperature | Time | Cycles | |
| 98ºC | 30 seconds | 1 | |
| 98ºC | 10 seconds | 2-10 | |
| 65ºC | 30 seconds | 2-10 | |
| 72ºC | 60 seconds | 2-10 | |
| 4ºC | Hold | 1 |
The number of additional cycles expected is complex and based on cell type as well as cell number. Generally libraries with a large number of cells (25,000-50,000+) will need only 2-4 additional cycles of amplification. Smaller numbers of cells (2,000-10,000) will need more like 6-10 additional cycles of amplification. These are generalities, your samples may vary.
After PCR reamplification, add 1 uL of Exonuclease I (NEB cat # M0293L) to each subpool and place subpools back in thermocycler for “ExoCleanup” program (parameters below) to get rid of excess primer.
| Temperature | Time | Cycles | |
| 37ºC | 15 minutes | 1 | |
| 80ºC | 15 minutes | 1 | |
| 4ºC | Hold | 1 |
Total time = 30 minutes
Clean sample using Qiagen MinElute DNA clean up kit as before. This time, add 225 uL Qiagen PB binding buffer (250 uL if qPCR stage was skipped) to each subpool, mix well with pipette, and load entire volume (~270 uL) into purple MinElute spin columns (should have labeled another set earlier).
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Add 750 uL of Qiagen PE wash buffer to the columns. Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to capture any excess buffer. Discard flowthrough and 2 mL collection tube. Place columns in labeled 1.5 mL tubes.
Add 6 uL of EB (10mM Tris, pH 8.0) directly to the column matrix. Incubate for 1 minute at room temperature.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to elute the DNA.
Add another 6 uL EB directly to the column matrix, incubate for 1 minute at room temperature, and spin again for 1 minute, 15,000rpm in benchtop centrifuge for a total of ~10 uL eluate.
Measure concentration of ATAC libraries with Qubit. If using the 1x kit, mix 199 uL Qubit 1x dsDNA solution and 1 uL of sample in 0.5 mL Qubit tubes (vortex briefly to mix). If using original kit, make a master mix with 198 uL buffer and 1 uL dsDNA dye per N+1 subpools, aqliuot 199 uL to Qubit tubes, add 1 uL sample, and vortex. Incubate in the dark for ~2 minutes then read tube concentrations using Qubit dsDNA High Sensitivity program. Record concentrations in spreadsheet, "Experiment" tab.
Either now or later once cDNA is ready, prepare diluted libraries for BioAnalyzer or Fragment Analyzer. For BA, prepare at least 1uL of 1 ng/uL normalized sample (0.6 uL of sample + concentration/2 uL EB). For FA, prepare at least 2 uL of 6 ng/uL normalized sample.
Store ATAC libraries at -20ºC.
11.0 cDNA amplification and cleanup (3.5 hours)
11.0 cDNA amplification and cleanup (3.5 hours)
After the 90 minute template switch incubation is done, mix each cDNA subpool with 100 uL H2O. Place tubes back on magnetic rack and wait until liquid becomes clear (~2 minutes).
Using a multichannel pipette, remove the clear supernatant and discard. Add 200 uL 1xSTE/RI to subpools to wash without resuspending beads.
Prepare cDNA PCR mix:
| Reagent | uL / subpool | uL for 8.5 subpools | Location | |
| Kapa Hifi 2x master mix | 25 | 212.5 | -20ºC SHARE reagents box | |
| RNA PCR primer 25 uM | 0.8 | 6.8 | -20ºC SHARE oligos box | |
| P7 primer 25 uM | 0.8 | 6.8 | -20ºC SHARE oligos box | |
| H2O | 23.4 | 198.9 | RT at bench | |
| Total | 50 |
cDNA PCR mix recipe. Volumes are exact hence the extra + 0.5 volume. Prepare in 1.5 mL tube and store on ice.
Remove the clear supernatant from the cDNA subpools and discard. Add 50 uL cDNA PCR mix to each tube (still containing beads) with a P100 or P200 and mix well using a multichannel pipette.
Run cDNA PCR as described below:
| Temperature | Time | Cycles | |
| 95ºC | 3 minutes | 1 | |
| 98ºC | 20 seconds | 5 | |
| 65ºC | 45 seconds | 5 | |
| 72ºC | 3 minutes | 5 | |
| 4ºC | Hold | 1 |
Total time = 32 minutes
Place tubes back on magnetic rack and wait until liquid becomes clear (~2 minutes). Transfer all 50 uL supernatant into new PCR tubes. Discard tubes with beads.
Next you will run a qPCR to determine the additional number of PCR cycles for the cDNA libraries.
Prepare qPCR mastermix:
| Reagent | uL / subpool | uL for 8 +2 subpools | Location | |
| Kapa Hifi 2x master mix | 3.75 | 37.5 | -20ºC SHARE reagents box | |
| RNA PCR primer 25 uM | 0.12 | 1.2 | -20ºC SHARE oligos box | |
| P7 primer 25 uM | 0.12 | 1.2 | -20ºC SHARE reagents box | |
| EVAgreen 20x | 0.5 | 5 | -20ºC SHARE reagents box (clear tube wrapped with foil) | |
| H2O | 3.01 | 30.1 | RT at bench | |
| Total | 7.5 | 75 |
cDNA qPCR mix recipe. Volumes are small & exact hence the extra +1 volume and another +1 for the NTC. Prepare in 0.5 mL or 1.5 mL tube and store on ice.
Aliquot 7.5 uL qPCR mix to N+1 wells in a green Bio-Rad qPCR plate (use middle of plate, e.g. D3-D11), taking care not to introduce bubbles.
Add 2.5 uL from each cDNA subpool and mix without introducing bubbles. For the last well, add 2.5 uL nuclease-free water for a no template control (NTC) to check for PCR mastermix contamination. Store remaining cDNA subpools (47.5 uL) on ice while qPCR is running.
Run the qPCR cycle program below on a Bio-Rad CFX96. Plate read at 72ºC.
| Temperature | Time | Cycles | |
| 95ºC | 3 minutes | 1 | |
| 98ºC | 20 seconds | 20 | |
| 65ºC | 20 seconds | 20 | |
| 72ºC | 3 minutes | 20 | |
| 12ºC | Hold | 1 |
Total time = 1 hour 38 minutes
Determine number of additional PCR cycles for the rest of the cDNA subpools.
For this experiment, roughly 1/3 of the plateau at 3000 RFU (yellow line) = 1000 RFU (pink line); amplification curves for 7 out of 8 subpools cross 1000 by ~12 cycles (blue line) so 12 additional PCR cycles would be appropriate.
For this experiment, roughly 1/3 of the plateau at 3300 RFU (yellow line) = 1100 RFU (pink line); amplification curves for 3 out of 4 subpools cross 1100 by ~13 cycles (blue line). We went with 12 additional PCR cycles and got ok library yields (~20 ng/uL average concentration). 13 may have been better.
Run additional PCR cycles for the rest of the subpools (47.5 uL) using the qPCR cycle schema. The tubes already have master mix and primer so you don't have to add anything, just put them back on the thermal cycler and run additional cycles.
| Temperature | Time | Cycles | |
| 95ºC | 3 minutes | 1 | |
| 98ºC | 20 seconds | 6-13 | |
| 65ºC | 20 seconds | 6-13 | |
| 72ºC | 3 minutes | 6-13 | |
| 4ºC | Hold | 1 |
Make sure Ampure XP beads are at room temperature. Add 28.5 uL Ampure beads (0.6x) per subpool for primary samples or 38 uL Ampure beads (0.8x) per subpool for cell line samples and mix well.
Bind subpools and beads for 5 minutes at RT.
Place tubes on magnetic rack and wait until liquid becomes clear (~5 minutes). Remove the clear supernatant and discard.
Keeping subpools on magnet, add 200 uL fresh 80% ethanol and wait 30 seconds. Remove the clear supernatant and discard.
Repeat previous step for a second wash.
Dry for ~5 minutes. Don’t let the beads look cracked, they should look glossy, and just at the point of turning matte.
Take subpools off magnet and resuspend in 10 uL EB. Use P10 to add 10 uL then mix well with multichannel pipette.
Incubate 5 minutes at RT.
Place tubes on magnetic rack and wait until liquid becomes clear (~2 minutes). Transfer all 10 uL supernatant into new PCR tubes. Discard tubes with beads.
Measure concentration of cDNA with Qubit. If using the 1x kit, mix 199 uL Qubit 1x dsDNA solution and 1 uL of sample in 0.5 mL Qubit tubes (vortex briefly to mix). If using original kit, make a master mix with 198 uL buffer and 1 uL dsDNA dye per N+1 subpools, aqliuot 199 uL to Qubit tubes, add 1 uL sample, and vortex. Incubate in the dark for ~2 minutes then read tube concentrations using Qubit dsDNA High Sensitivity program. Record concentrations in spreadsheet, "Experiment" tab.
STOPPING POINT. End of day 2! Can store cDNA at -20ºC for several months. Tagmentation and BA/FA typically happens on the the 3rd day.
12.0 cDNA tagmentation, amplification, and indexing (2-2.5 hours)
12.0 cDNA tagmentation, amplification, and indexing (2-2.5 hours)
At the start of day 3, take Ampure XP beads out of the 4ºC fridge. Label 2 1.5 mL tubes and 1 purple MinElute tube per subpool. Prepare 1 mL fresh 80% ethanol per subpool in an Eppendorf reservoir (can empty the one used in day 2 and re-fill). Turn on a thermal cycler and set at 55ºC, lid temperature 65ºC.
Prepare diluted cDNA for BioAnalyzer or Fragment Analyzer. For BA, prepare at least 1uL of 1 ng/uL normalized sample (0.6 uL of sample + concentration/2 uL EB). For FA, prepare at least 2 uL of 6 ng/uL normalized sample. Run BA or FA for ATAC libraries and cDNA to check length distribution of fragments. Record average length in base pairs in spreadsheet, "Experiment" tab.
Ideally, dilute 50ng cDNA to 5ng/ul (need at least 10 uL) in nuclease-free water.
Note: expect > 50ng cDNA. If cDNA amount is low, you can use as little as 20ng cDNA for tagmentation. Adjust the volume of DNA and H2O accordingly
Dilution Diagenode Tn5 1:50 in dilution buffer. Assemble transposome by mixing diluted Tn5, dilution buffer, annealed oligo, and incubate the mix at RT for 30 minutes (see recipe below). See section 1.3 above, steps 19-21 for an overview of annealing the adapter oligos in preparation for this step. Diluted enzyme with annealed adapter is stable for at least 6 months at -20ºC.
| Reagent | uL / subpool | uL for 8 + 1 subpools | Location | |
| 1x Tn5 | 1.25 | 11.25 | -20ºC SHARE reagents box | |
| Dilution buffer (see step 23) | 1.25 | 11.25 | RT at bench | |
| Annealed tagmentation adapter in glycerol | 2.5 | 22.5 | -20ºC SHARE reagents box | |
| Total | 5 | 45 |
Transposome assembly mix for tagmentation reaction. Volumes are small & exact hence the extra +1 volume. Prepare in 0.5 mL or 1.5 mL tube and store on ice.
Mix 10 uL of 5ng/ul cDNA with 10 uL H2O, 25 uL 2x TD buffer (see step 22), and 5 uL assembled Tn5 in a PCR strip tube. Incubate at 55ºC for 5 minutes on a thermal cycler. Take tubes off thermal cycler and proceed immediately to next step when time is up to avoid over-tagmentation.
Clean sample using Qiagen MinElute DNA clean up kit. Add 250 uL Qiagen PB binding buffer to each tagmented library (volume will fit in strip tube, just be careful), mix well with pipette, and load entire volume (~300 uL) into labeled purple MinElute spin columns.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Add 750 uL of Qiagen PE wash buffer to the columns. Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature. Discard flowthrough.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to capture any excess buffer. Discard flowthrough and 2 mL collection tube. Place columns in labeled 1.5 mL tubes.
Add 11 uL of EB (10mM Tris, pH 8.0) directly to the column matrix. Incubate for 1 minute at room temperature.
Spin for 1 minute, 15,000rpm in benchtop centrifuge at room temperature to elute the DNA.
Add another 11 uL EB directly to the column matrix, incubate for 1 minute at room temperature, and spin again for 1 minute, 15,000rpm in benchtop centrifuge for a total of ~22 uL eluate.
Prepare post-tagmentation PCR mix:
| Reagent | uL / subpool | uL for 8 + 1 subpools | Location | |
| NEBNext 2x PCR master mix | 25 | 225 | -20ºC SHARE reagents box | |
| P7 primer 25 uM | 1 | 9 | RT at bench | |
| H2O | 3 | 27 | -20ºC SHARE reagents box | |
| Total | 29 | 261 |
Post-tagmentation PCR mix recipe. Volumes are small & exact hence the extra +1 volume. Prepare in 0.5 mL or 1.5 mL tube and store on ice.
In PCR strip tubes, mix ~20 uL subpool eluates with 29 uL PCR mix and 1 uL IDT8 i5 1-16 primer at 25 uM! Record which subpool got which primer in spreadsheet, "Experiment" tab. Use different primers than the corresponding ATAC libraries if combining RNA and ATAC libraries on the same sequencing run!
Run post-tagmentation PCR as described below:
| Temperature | Time | Cycles | |
| 72ºC | 5 minutes | 1 | |
| 98ºC | 30 seconds | 1 | |
| 98ºC | 10 seconds | 7 | |
| 65ºC | 30 seconds | 7 | |
| 72ºC | 60 seconds | 7 | |
| 12ºC | Hold | 1 |
Total time = 27 minutes
After PCR reamplification, add 1 uL of Exonuclease I (NEB cat # M0293L) to each subpool and place subpools back in thermocycler for “ExoCleanup” program (parameters below) to get rid of excess primer.
| Temperature | Time | Cycles | |
| 37ºC | 15 minutes | 1 | |
| 80ºC | 15 minutes | 1 | |
| 4ºC | Hold | 1 |
Total time = 30 minutes
The final bead cleanup is a double elution to remove small MW fragments (less than ~250bp) which represent tagmentation events where the Illumina R2 is likely destroyed, and there is no actual cDNA retained (the SHARE scaffold takes up around 234bp). Leaving these fragments present drastically reduces the efficiency of RNA sequencing.
Make sure Ampure XP beads are at room temperature. Add 35 uL Ampure beads (0.7x) per cDNA library and mix well.
Bind libraries and beads for 5 minutes at RT.
Place tubes on magnetic rack and wait until liquid becomes clear (~5 minutes). Remove the clear supernatant and discard.
Keeping libraries on magnet, add 200 uL fresh 80% ethanol and wait 30 seconds. Remove the clear supernatant and discard.
Repeat previous step for a second wash.
Dry for ~5 minutes. Don’t let the beads look cracked, they should look glossy, and just at the point of turning matte.
Take libraries off magnet and resuspend in 50 uL EB. Use a P100 or P200 to add 50 uL then mix well with multichannel pipette.
Incubate 5 minutes at RT.
Place tubes on magnetic rack and wait until liquid becomes clear (~2 minutes). Transfer all 50 uL supernatant into new PCR tubes. Discard tubes with beads.
Repeat with 35ul Ampure beads. Add 35 uL Ampure beads (0.7x) per cDNA library and mix well.
Bind libraries and beads for 5 minutes at RT.
Place tubes on magnetic rack and wait until liquid becomes clear (~5 minutes). Remove the clear supernatant and discard.
Keeping libraries on magnet, add 200 uL fresh 80% ethanol and wait 30 seconds. Remove the clear supernatant and discard.
Repeat previous step for a second wash.
Dry for ~5 minutes. Don’t let the beads look cracked, they should look glossy, and just at the point of turning matte.
Take libraries off magnet and resuspend in 10 uL EB. Use a P10 to add 10 uL then mix well with multichannel pipette.
Place tubes on magnetic rack and wait until liquid becomes clear (~2 minutes). Transfer all 10 uL supernatant into new PCR tubes. Discard tubes with beads.
Measure concentration of RNA libraries with Qubit. If using the 1x kit, mix 199 uL Qubit 1x dsDNA solution and 1 uL of sample in 0.5 mL Qubit tubes (vortex briefly to mix). If using original kit, make a master mix with 198 uL buffer and 1 uL dsDNA dye per N+1 subpools, aqliuot 199 uL to Qubit tubes, add 1 uL sample, and vortex. Incubate in the dark for ~2 minutes then read tube concentrations using Qubit dsDNA High Sensitivity program. Record concentrations in spreadsheet, "Experiment" tab.
Prepare diluted cDNA libraries for BioAnalyzer or Fragment Analyzer. For BA, prepare at least 1uL of 1 ng/uL normalized sample (0.6 uL of sample + concentration/2 uL EB). For FA, prepare at least 2 uL of 6 ng/uL normalized sample. Run BA or FA for cDNA libraries to check length distribution of fragments. Record average length in base pairs in spreadsheet, "Experiment" tab.
13.0 Library quantification and sequencing
13.0 Library quantification and sequencing
After confirmation of satisfactory BA or FA traces, quantify all libraries to be sequenced together using a KAPA quantification kit (Roche cat number: 7960140001).
Run KAPA reactions in duplicate, using 10 uL reactions, loading standards in order of ascending concentration (load NTC, then std6, std5..... std1), and using two dilutions. Dilute a library first to 1:1000 in water, then serially dilute 1:1000 again to get a 1:10^6 dilution. Also dilute the 1:1000 again at 1:100 to get a 1:100,000 dilution. Duplicates of both 1:10^6 and 1:100,000 are used to calculate the concentration of the libraries.
Using KAPA concentrations and average length, calculate molarity of libraries. Prepare 2nM dilutions (at least 15 uL) and pool libraries according to read distribution. If lowest concentration is < 2nM, dilute all other samples to lowest concentration.
Prepare loading pool by diluting the 2nM pool to appropriate loading concentration (1000 pM has been working well for us). Add 5% PhiX spike-in. Sequence libraries with an Illumina 300-cycle kit (need 100 bp for read 1, 100 bp for read 2, and another 100 bp for index 1). Determine kit size based on number of cells or nuclei you want to sequence; aim for at least 10,000 reads per cell (20,000+ is better). We typically use P4 (1.8B reads). R1/R2/I1/I2 = PE 100/100/99/8.
See attached guide for sequencing in the Mortazavi Lab.
Mortazavi Lab Nextseq2000 Sequencing Guide.docx455KB