Sequential RNA-FISH on Human Articular Cartilage

Peter Maye; Mejeong Lee; David Rowe; Martin Lotz; Merissa Olmer; dong.shin

Apr 17, 2025

Sequential RNA-FISH on Human Articular Cartilage

DOI

dx.doi.org/10.17504/protocols.io.ewov19w42lr2/v1

Peter Maye^1,2,
Mejeong Lee^1,2,
David Rowe^1,2,
Martin Lotz^3,2,
Merissa Olmer^3,2,
dong.shin^4,2

¹UConn Health;
²Human Biomolecular Atlas Project (HuBMAP);
³Scripps Research;
⁴University of Connecticut

Human BioMolecular Atlas Program (HuBMAP) Method Development Community
UCH Center for Regenerative Skeletal Medicine

Peter Maye

UConn Health

DOI: dx.doi.org/10.17504/protocols.io.ewov19w42lr2/v1

Protocol Citation: Peter Maye, Mejeong Lee, David Rowe, Martin Lotz, Merissa Olmer, dong.shin 2025. Sequential RNA-FISH on Human Articular Cartilage . protocols.io https://dx.doi.org/10.17504/protocols.io.ewov19w42lr2/v1

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it's working

Created: September 17, 2024

Last Modified: April 17, 2025

Protocol Integer ID: 107793

Keywords: Articular Cartilage, Sequential RNA-FISH, MERFISH, Human, Human Biomolecular Atlas Project (HuBMAP)

Funders Acknowledgements:

NIH Common Fund

Grant ID: U54AR078664

Abstract

This protocol covers the harvesting, preservation, and implementation of sequential RNA-FISH on human articular cartilage. Distinct elements of this protocol that worked well for human articular cartilage include: (1) the use of Paxgene fixative and stabilizer for the initial preservation of RNA immediately following the initial tissue harvest. (2) the permeabilization of tissue sections for probe access by sequential treatment with a hydrogen peroxide-formamide solution followed by digestion with protease plus, and treatment with HCl.  (3) Finally, while the probe design and hybridization chemistry were essentially identical to MERFISH, after covering the tissue in an acrylamide hydrogel, the tissue was not fully cleared by digestion as the loose attachment of chondrocytes sitting inside their lacunae would be lost.  Thus, the imaging procedure first captured background matrix autofluorescence, which in the image processing pipeline was background subtracted.  Collectively, this protocol worked well on articular cartilage samples derived from 6 different human donors of varying age and ancestry. 

Materials

PAXgene Tissue Fix Container (765312, PreAnalytiX)
PAXgene Tissue STABILIZER (765512, PreAnalytiX)
Sucrose (F5-3, Fisher Chemical)
Cryofilm (C-FS 105, SECTION-LAB Co. Ltd. Japan).
PFA (15714, Electron Microscopy Sciences)
PBS (BP3994, Fisher Scientific)
Cryomatrix (6769006, Epredia)
RNAscope Protease Plus (322331, ACD)
Hydrogen Peroxide (H1065, Spectrum)
20xSSC (AM9763, Invitrogen)
Formamide (AM9342, Thermo Fisher)
HCl (SA48-500, Fisher Chemical)
Murine RNase Inhibitor (M0314L, New England Biolabs)
Yeast tRNA (15401-029, invitrogen)
TE Buffer, RNase Free (AM9858, Invitrogen)
Triton-X 100, RNase Free (AC327372500, Thermo Fisher)
Bis-Acrylamide 19:1, 40% (1610144, BioRad)
TEMED (T7024-25ML, Sigma)
Ammonium persulfate (19913-100G, Sigma)
5M NaCl (AM9759, Invitrogen)
1M Tris-HCl (15568025, Thermo Fisher)
Gelslick (50640, Lonza)
Proteinase K (P8107S, New England Biolabs)
0.5M EDTA (AM9260G, Invitrogen)
Dextran Sulfate (S4030, EMD Milipore)

Protocol materials

ReagentPAXgene Tissue FIXQiagenCatalog #765312Step 3
 
ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763In 6 steps
 
Reagent1M Tris-HCl Thermo Fisher ScientificCatalog #15568025In 3 steps
 
ReagentTE Buffer, RNase Free InvitrogenCatalog #AM9858In 3 steps
 
Reagent0.5M EDTAInvitrogenCatalog #AM9260GStep 39
 
ReagentCryofilmSection-Lab Co. Ltd.Catalog #C-FS 105Step 8
 
ReagentRNase Inhibitor New England BiolabsCatalog #M0314LStep 23
 
ReagentPAXgene Tissue STABILIZERQiagenCatalog #765512Step 4
 
ReagentGelslickLonzaCatalog #50640Step 31
 
Reagent5M Sodium ChlorideInvitrogenCatalog #AM9759In 3 steps
 
ReagentAmmonium persulfate Merck MilliporeSigma (Sigma-Aldrich)Catalog #19913-100GStep 29
 
ReagentDextran SulfateMerck Millipore (EMD Millipore)Catalog #S4030In 2 steps
 
ReagentYeast tRNA InvitrogenCatalog #15401-029Step 23
 
Reagent2-MethylbutaneMerck MilliporeSigma (Sigma-Aldrich)Catalog #M32631Step 7
 
ReagentHClFisher ScientificCatalog #SA48-500Step 14
 
Reagent40mm diameter coverslipBioptechsCatalog #40-1313-03193In 2 steps
 
Reagent10% SDSInvitrogenCatalog #AM9823Step 39
 
ReagentPhosphate Buffered SalineFisher ScientificCatalog #BP3994Step 10
 
ReagentFormamide, deionized, nuclease-freeAmbionCatalog #AM9342In 4 steps
 
ReagentTEMEDMerck MilliporeSigma (Sigma-Aldrich)Catalog #T7024-25MLStep 29
 
ReagentTissue-Plus™ O.C.T. CompoundFisher ScientificCatalog #23-730-571Step 6
 
ReagentRNAscope Protease Plus Avanced Cell DiagnosticsCatalog #322331Step 13
 
ReagentProteinase K, Molecular Biology Grade - 2 mlNew England BiolabsCatalog #P8107SStep 39
 
ReagentSucroseFisher ScientificCatalog #S5-3Step 5
 
ReagentHydrogen Peroxide Spectrum Chemical MFG CorpCatalog #H1065Step 11
 
ReagentTriton-X 100, RNase FreeThermo Fisher ScientificCatalog #AC327372500In 2 steps
 
ReagentParaformaldehyde (PFA)Electron Microscopy SciencesCatalog #15714Step 9
 
ReagentBis-Acrylamide 19:1, 40% Bio-Rad LaboratoriesCatalog #1610144In 2 steps

Tissue Collection and Preservation

Procurement of Medial Femoral Cartilage With Subchondral Bone for FISH: Using an autoclaved 12” hacksaw with 24TPI blade, cut a 3-5mm slab from the middle region of the medial femoral condyle. 

The posterior (non-weight bearing NWB) and central (weight bearing WB) regions are cut down to maximum 5mmx5mmx5mm pieces, 3 pieces per region.

Three pieces of tissue, from one region, are placed in 12mLs ofReagentPAXgene Tissue FIXQiagenCatalog #765312 for Duration24:00:00   on a  Temperature4 °C   rocker. 

Pour off fixation solution and replace with ReagentPAXgene Tissue STABILIZERQiagenCatalog #765512aand incubate for Duration24:00:00   at Temperature4 °C    on a rocker.  Tissue samples can be shipped in PAXgene Stabilizer on TemperatureOn ice   and/or stored in the  PAXgene stabilizer at Temperature-20 °C   until ready for tissue processing.

Tissue Embedding

Place the sample into 12ml of 30% ReagentSucroseFisher ScientificCatalog #S5-3  at Temperature4 °C   for Duration24:00:00   on a rocker. The 30% sucrose solution was prepared in DEPC-treated water followed by autoclaving.

Blot the sample with a kimwipe and place the sample into a cryomold with ReagentTissue-Plus™ O.C.T. CompoundFisher ScientificCatalog #23-730-571 . 

Grasp the cryomold with a pair of forceps and hold at the surface of a container containing Reagent2-MethylbutaneMerck MilliporeSigma (Sigma-Aldrich)Catalog #M32631  prechilled with dry ice.  Once completely frozen, store at Temperature-80 °C   .

Cryosectioning and Section Fixation

Cut ~10 micron sections in a cryostat using Cryofilm.
ReagentCryofilmSection-Lab Co. Ltd.Catalog #C-FS 105  

Immediately place tissue sections into the 4% PFA solution. Fix forDuration01:30:00   at TemperatureRoom temperature  . Detach the section from the Cryofilm in the 4% PFA solution in a well-ventilated area, preferably a fume hood, then fix for Duration00:30:00  more atTemperatureRoom temperature  .ReagentParaformaldehyde (PFA)Electron Microscopy SciencesCatalog #15714  

Tissue Permeabilization

2h 35m

Rinse section in PBS for Duration00:15:00  at TemperatureRoom temperature  .ReagentPhosphate Buffered SalineFisher ScientificCatalog #BP3994  

15m

Place the section in a solution containing 0.3% Hydrogen Peroxide, 5% Formamide buffered in 0.5x SSC for Duration01:00:00   at TemperatureRoom temperature  . (Warning: when making solution add Formamide to diluted Hydrogen Peroxide. ReagentHydrogen Peroxide Spectrum Chemical MFG CorpCatalog #H1065  ReagentFormamide, deionized, nuclease-freeAmbionCatalog #AM9342   ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  Peroxides are potentially explosive)

repeat step 10

15m

Add 50 ul of RNAscope Protease Plus on the section and incubate for Duration00:30:00   at Temperature37 °C  ReagentRNAscope Protease Plus Avanced Cell DiagnosticsCatalog #322331  

30m

Transfer the section into 0.1 N HCl solution and incubate for Duration00:05:00   at TemperatureRoom temperature  ReagentHClFisher ScientificCatalog #SA48-500  

Transfer section to 2x SSC and incubate for Duration00:30:00   at TemperatureRoom temperature  .ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  

30m

Probe Synthesis and Preparation for Hybridization

12m

Encoding Probe Design: Probe Dealer Software created by Dr. Siyuan Wang's lab was used to design encoding probes. This software is a user friendly Matlab Program the runs with a graphical user interface. Instructions on how to use it and download it are freely available from Dr. Siyuan Wang's Lab https://campuspress.yale.edu/wanglab/probedealer/

Encoding Probe Synthesis: Probes were synthesized at IDT in a 96-well plate format 25nmole synthesis scale. The number of oligonucleotides designed against each gene is variable and dependent on transcript length and sequence similarity to other genes. We try and have a minimum of 50 oligos pooled together for each gene. Ideally, more is better as the signal-to-noise ratio improves.  For smaller transcripts, where the oligo pool is under 50 oligos, we have duplicated readout probe target sites for better detection. 

blue: 30bp antisense sequence, red: complementary sequence to readout probe

Readout Probe Synthesis, Resuspension, and Storage: Cy5 and Alexa750 disulfide conjugated readout probes were ordered from Biosynthesis (www.biosyn.com). Probes were resuspended in TE Buffer containing 0.1% v/v Triton X-100 at a concentration ofConcentration100 micromolar (µM)   and stored Temperature-20 °C   .  Probes were aliquoted into multiple tubes to prevent repeated freeze-thawing to extend life. The sequence information for readout probes was previously detailed in https://doi.org/10.1073/pnas.1612826113.
ReagentTE Buffer, RNase Free InvitrogenCatalog #AM9858  ReagentTriton-X 100, RNase FreeThermo Fisher ScientificCatalog #AC327372500  

Anchor Probe Synthesis, Resuspension, and Storage:  An anchor probe was ordered from IDT, resuspending in RNase-free TE buffer at a concentration of Concentration100 micromolar (µM)  , at stored at Temperature-20 °C   .  The anchor probe targets the polyA mRNA tails and crosslinks the mRNA to the acrylamide gel through the 5' Acrydite modification. T+ identifies the locked nucleic acid modification to increase binding affinity. \5Acryd\TTGAGTGGATGGAGTGTAATT+TT+TT+TT+TT+TT+TT+TT+TT+TT+T
IDT Ordered: 100 nmole synthesis scale, RNase-Free, HPLC Purified.
ReagentTE Buffer, RNase Free InvitrogenCatalog #AM9858  

Encoding Probe Preparation: Each encoding probe is resuspended into a final concentration of Concentration500 micromolar (µM)  with RNase-free TE buffer. (For a 25nmole synthesis this would be 50ul).  Then oligos designed against each gene are pooled together.    (500um x 50ul)/(50 oligos x 50ul/oligo)=10uM per oligo within the pool. This is essentially a 2000x concentration to make a 5nM amount per oligo for experiments.  This is sufficiently concentrated to mix one gene probe pool with many other gene probe pools for your studies.
ReagentTE Buffer, RNase Free InvitrogenCatalog #AM9858  

Prepare Amount25 µL  of encoding probe at Concentration10 nanomolar (nM)   per oligo for one section in 30% Formamide and 10% Dextran Sulfate in 2xSSC. 
ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  ReagentFormamide, deionized, nuclease-freeAmbionCatalog #AM9342  
ReagentDextran SulfateMerck Millipore (EMD Millipore)Catalog #S4030  

Heat at Temperature80 °C   for Duration00:10:00  , then cool down.

10m

Prepare 25 ul of 2 uM of Anchor probe in 2x SSC containing 2% RNase inhibitor, 0.2% tRNA, 10% Dextran Sulfate, and 30% Formamide.ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  ReagentFormamide, deionized, nuclease-freeAmbionCatalog #AM9342  ReagentRNase Inhibitor New England BiolabsCatalog #M0314L  ReagentYeast tRNA InvitrogenCatalog #15401-029  
ReagentDextran SulfateMerck Millipore (EMD Millipore)Catalog #S4030  

Combine probe pool with anchor probe mix. (This is a sufficient amount of encoding probe for one tissue section. Scale up as desired).  

Hybridization

Transfer the section into 30% Formamide in 2xSSC
solution and incubate at room temperature for 15 minutes.
ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  ReagentFormamide, deionized, nuclease-freeAmbionCatalog #AM9342  

Hybridize the section with encoding probe solution
forDuration42:00:00   at Temperature37 °C  

1d 18h

Wash section in 30% Formamide in 2xSSC solution
for Duration00:30:00   at Temperature37 °C   and repeat wash 3-5 times.

30m

Gel Embedding Tissue Section

30m

 Transfer the section into a 4% acrylamide solution containing 300 mM NaCl and 50 mM Tris solution. Let it incubate forDuration00:30:00   at TemperatureRoom temperature  .
ReagentBis-Acrylamide 19:1, 40% Bio-Rad LaboratoriesCatalog #1610144  
Reagent5M Sodium ChlorideInvitrogenCatalog #AM9759  Reagent1M Tris-HCl Thermo Fisher ScientificCatalog #15568025  

30m

Place a 10 ul drop of 4% acrylamide solution containing 300mM NaCl, 50mM Tris,
0.03% APS and 0.15% TEMED in the center of bind-silane functionalized
40mm round coverslip. ReagentBis-Acrylamide 19:1, 40% Bio-Rad LaboratoriesCatalog #1610144  Reagent5M Sodium ChlorideInvitrogenCatalog #AM9759  ReagentAmmonium persulfate Merck MilliporeSigma (Sigma-Aldrich)Catalog #19913-100G  ReagentTEMEDMerck MilliporeSigma (Sigma-Aldrich)Catalog #T7024-25ML  Reagent1M Tris-HCl Thermo Fisher ScientificCatalog #15568025  
Reagent40mm diameter coverslipBioptechsCatalog #40-1313-03193  

Immediately transfer the section onto the drop of acrylamide.

 Place a Gelslick-functionalized coverslip (size 22x22mm) gently over the section to
sandwich the droplet, being careful not to create bubbles.
ReagentGelslickLonzaCatalog #50640  

Push the Gelslick-functionalized coverslip gently to make a thin gel. Remove the extra
gel solution.

 Allow polymerization to happen for Duration01:00:00   at TemperatureRoom temperature  .

Remove the Gelslick-functionalized coverslip from the
section

Add 65 ul of 4% acrylamide solution in 300mM NaCl, 50mM Tris
with 0.03% APS and 0.15% TEMED onto the tissue section. 

Place the Gelslick-functionalized slide (size 75x50mm) gently over the slide to sandwich the droplet, being careful not to create bubbles

Allow the polymerization to happen for Duration01:00:00   at TemperatureRoom temperature  .

Remove the Gelslick-functionalized slide from the
section

Tissue Digestion, Imaging, and Sequential Hybridization of Readout Probes

1h 30m

Prepare tissue digestion solution (50 mM Tris, 300mM NaCl, 1mM EDTA, 0.5% Triton-X100, 1% SDS, Proteinase K (200ug/ml) ) and add 3ml per 40mm round coverslip. Incubate the for Duration01:00:00   at Temperature37 °C  
Reagent1M Tris-HCl Thermo Fisher ScientificCatalog #15568025  ReagentTriton-X 100, RNase FreeThermo Fisher ScientificCatalog #AC327372500  Reagent5M Sodium ChlorideInvitrogenCatalog #AM9759  Reagent0.5M EDTAInvitrogenCatalog #AM9260G  
Reagent10% SDSInvitrogenCatalog #AM9823  
ReagentProteinase K, Molecular Biology Grade - 2 mlNew England BiolabsCatalog #P8107S 
Reagent40mm diameter coverslipBioptechsCatalog #40-1313-03193   

Thoroughly rinse sections for Duration00:30:00   in 2xSSC at TemperatureRoom temperature  . Repeat wash 5 times.
ReagentSSC, RNase-free, 20×AmbionCatalog #AM9763  

30m

From this point forward the tissue section is ready for sequential rounds of readout probe hybridization and imaging. For human articular cartilage, tissue digestion did not fully clear the tissue.  Therefore, we imaged the matrix background under every channel and subtracted it from readout probe rounds of imaging. Additionally, because the matrix was easily detectable, we used it in replace of fiduciary beads for image registration.  Additional details of MERFISH protocols can be found at https://moffittlab.github.io/.

Acknowledgements

This work would not have been possible without the additional help of several individuals including: Jeffrey Moffitt, Ji Yu, Steven Lepowsky, Pamir Alpay, and Ion Moraru.  We are also deeply grateful to the postmortem human donors whose generous tissue contributions made this study possible.

Public workspaceSequential RNA-FISH on Human Articular Cartilage

Sequential RNA-FISH on Human Articular Cartilage