Apr 04, 2020
SARS-CoV-2 Genome Sequencing Using Long Pooled Amplicons on Illumina Platforms
- John-Sebastian Eden1,2,
- Eby Sim2,3,4
- 1Westmead Institute for Medical Research;
- 2University of Sydney;
- 3Centre for Infectious Diseases and Microbiology - Public Health;
- 4NSW Health Pathology - ICPMR
- Coronavirus Method Development Community
Protocol Citation: John-Sebastian Eden, Eby Sim 2020. SARS-CoV-2 Genome Sequencing Using Long Pooled Amplicons on Illumina Platforms. protocols.io https://dx.doi.org/10.17504/protocols.io.befyjbpw
Manuscript citation:
https://www.biorxiv.org/content/10.1101/2020.03.15.992818v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol in our group and have generated more than 300 SARS-CoV-2 genomes
Created: March 31, 2020
Last Modified: April 04, 2020
Protocol Integer ID: 35032
Keywords: COVID-19, COVID19 , Illumina, Genome sequencing, Viral RNA extraction , cDNA synthesis , Nanopore, Nextera XT, Invitrogen, RT-PCR,
Abstract
This protocol describes methods to sequence SARS-CoV-2 with pooled amplicons (14 x 2.5kb) using Illumina Platforms.
Attachments
Materials
| ITEM | SUPPLIER | CATALOGUE | |
| General consumables, chemicals & equipment | |||
| Ethanol, 200 proof, for molecular biology (500 mL) | Sigma-Aldrich | E7023-500ML | |
| UltraPure DNase/RNase-free distilled water (500 mL) | Invitrogen | 10977015 | |
| β-Mercaptoethanol (10 mL) | Sigma-Aldrich | M6250-10ML | |
| 0.2 mL strip of 8 tubes, flat cap, natural (120 pack) | SSIbio | 3245-00 | |
| DNA LoBind tubes, 1.5 mL (250 tubes) | Eppendorf | 0030108051 | |
| Conical Tubes, 50 mL (500 tubes) | Eppendorf | 0030122178 | |
| PCR plate 96 LoBind, semi-skirted (25 plates) | Eppendorf | 0030129504 | |
| PCR Film, self-adhesive (100 pieces) | Eppendorf | 0030127781 | |
| SimpliAmp Thermal Cycler | Applied Biosystems | A24811 | |
| Mother E-Base device | Invitrogen | EBM03 | |
| 12 channel VOYAGER pipette (5 – 125 µl) | Integra | 4732 | |
| Single pipette charging stand | Integra | 4210 | |
| Part 1 - Viral RNA extraction | |||
| Quick-RNA viral kit (50 preps) | Zymo | R1034 | |
| Collection tubes (500 pack) | Zymo | C1001-500 | |
| Part 2 - cDNA synthesis | |||
| SuperScript IV VILO master mix (50 reactions) | Invitrogen | 11756050 | |
| Part 3 - Genome amplification | |||
| Platinum SuperFi Green PCR master mix (500 reactions) | Invitrogen | 12359050 | |
| Custom DNA oligos (100 µM) | IDT | ~ | |
| 1 Kb Plus DNA ladder (250 µg) | Invitrogen | 10787018 | |
| E-Gel 48 Agarose gels, 1% | Invitrogen | G800801 | |
| Part 4 - PCR pooling and cleanup | |||
| Qubit 1X dsDNA HS assay kit (500 assays) | Invitrogen | Q33231 | |
| Qubit dsDNA BR Assay Kit (500 assays) | Invitrogen | Q32853 | |
| Agencourt AMPure XP (60 mL) | Beckman Coulter | A63881 | |
| Buffer EB (250 mL) | Qiagen | 19086 | |
| Part 5 - DNA library preparation and sequencing | |||
| Nextera XT DNA Library Preparation Kit (96 samples) | Illumina | FC-131-1096 | |
| Nextera XT Index Kit v2 Set B (96 indexes, 384 samples) | Illumina | FC-131-2002 | |
| High Sensitivity D5000 ScreenTape | Agilent | 5067-5592 | |
| High Sensitivity D5000 Reagents | Agilent | 5067-5593 | |
| High Sensitivity D5000 Ladder | Agilent | 5067-5594 | |
| iSeq 100 i1 Reagent (4 pack) | Illumina | 20021534 | |
| iSeq 100 System | Illumina | 20021532 | |
SARS-CoV-2 amplicon WGS materials
SARS-CoV-2 amplicon WGS materials.pdf Safety warnings
Please refer to the Safety Data Sheets (SDS) for health and environmental hazards.
Before start
The basic protocol uses Illumina sequencing but an addendum is added at the end to take sample amplicons and sequence them using Oxford Nanopore Technology.
Viral RNA extraction
Viral RNA extraction
Note
Here we provide an example low throughput viral RNA extraction protocol; however, any platform that extracts viral or pathogen RNA (or total nucleic acid) should be suitable. We typically use the residual viral extracts from clinical samples following diagnostic RT-PCRs, which include extracts off both Qiagen BioRobot EZ1 and Roche MagnaPure 96 platforms. Please ensure appropriate PPE and containment to avoid exposure to infectious samples, noting that following the addition of the DNA/RNA Shield, the virus will be inactivated.
Combine 100 µL 2X DNA/RNA Shield with 100 μl respiratory sample (sputum, aspirate or swab medium), then mix well by gentle vortexing.
Add 400 µL Viral RNA Buffer to each 200 μl sample and mix well by gentle vortexing.
Transfer the mixture into a Zymo-Spin IC column placed in a collection tube. Centrifuge at 12000 x g for 00:02:00 to bind viral RNA to matrix.
Transfer the column into a new collection tube.
Add 500 µL Viral Wash Buffer to the column, centrifuge at 12.000 x g for 00:00:30 .
Transfer the column into a new collection tube.
Repeat steps 6 & 7:
Add 500 µL Viral Wash Buffer to the column, centrifuge at 12.000 x g for 00:00:30 .
Transfer the column into a new collection tube.
Add 500 µL Ethanol (95-100%) to the column and centrifuge at 12.000 x g for 00:02:00 to ensure complete removal of the wash buffer.
Transfer the column into a clean elution tube (2 ml Eppendorf PCR clean, DNA LoBind tube).
Add 25 µL DNase/RNase-Free Water directly to the column matrix, incubate for 00:05:00 and then centrifuge at 12.000 x g for 00:00:30 to elute the viral RNA.
The eluted viral RNA can be used immediately or stored frozen at -80 °C .
cDNA synthesis
cDNA synthesis
Note
cDNA is prepared from viral RNA using SuperScript IV VILO Master Mix, which combines both random and oligo-dT priming for first strand synthesis. The oligo-dT priming is essential as the reverse primer for the final amplicon sits close to the viral poly-A tail in the 3’ UTR. When using individual components to set up cDNA synthesis instead of the VILO mastermix, use the recommended protocol for a random hexamer primed reaction but supplement the reaction with oligo-dT so the final random hexamer/oligo-dT ratio is 3:1.
Setup the following reaction mix for each sample and a no template control (NTC):
| REAGENT | VOLUME (μl) | |
| SuperScript IV VILO MasterMix (5X) | 5 | |
| Nuclease free water | 15 | |
| Viral RNA | 5 | |
| TOTAL | 25 |
Incubate the reaction as follows:
| STEP | TEMP (°C) | TIME (mm:ss) | |
| Priming | 25 | 10:00 | |
| Extension | 50 | 20:00 | |
| Denature RT | 85 | 05:00 | |
| Hold | 4 | ∞ |
Keep the cDNA On ice if being used immediately or store frozen at -20 °C .
Genome Amplification
Genome Amplification
Note
Next we take the cDNA prepared from viral RNA and amplify 14 regions (~2.5kb each) that tile across the viral genome. The PCRs are performed in parallel and is NOT a multiplexed reaction. The general approach is demonstrated by the following schematic:
The amplicon primers are as follows:
| PCR | PRIMER | SEQUENCE (5' - 3') | LENGTH (nt) | |
| A1 | SARS2_A1F_31 | ACCAACCAACTTTCGATCTCTTGT | 2562 | |
| SARS2_A1R_2569 | GCTTCAACAGCTTCACTAGTAGGT | |||
| A2 | SARS2_A2F_4295 | ACAGTGCTTAAAAAGTGTAAAAGTGCC | 2579 | |
| SARS2_A2R_6847 | ACAGTATTCTTTGCTATAGTAGTCGGC | |||
| A3 | SARS2_A3F_8596 | ACTTGTGTTCCTTTTTGTTGCTGC | 2479 | |
| SARS2_A3R_11049 | GAACAAAGACCATTGAGTACTCTGGA | |||
| A4 | SARS2_A4F_12711 | TACGACAGATGTCTTGTGCTGC | 2536 | |
| SARS2_A4R_15225 | TAACATGTTGTGCCAACCACCA | |||
| A5 | SARS2_A5F_16847 | ACTATGGTGATGCTGTTGTTTACCG | 2432 | |
| SARS2_A5R_19254 | ACCAGGCAAGTTAAGGTTAGATAGC | |||
| A6 | SARS2_A6F_21358 | ACAAATCCAATTCAGTTGTCTTCCTATTC | 2490 | |
| SARS2_A6R_23823 | TGTGTACAAAAACTGCCATATTGCA | |||
| A7 | SARS2_A7F_25602 | ACTAGCACTCTCCAAGGGTGTT | 2571 | |
| SARS2_A7R_28146 | AGGTTCCTGGCAATTAATTGTAAAAGG | |||
| B1 | SARS2_B1F_1876 | ATCAGAGGCTGCTCGTGTTGTA | 2575 | |
| SARS2_B1R_4429 | AGTTTCCACACAGACAGGCATT | |||
| B2 | SARS2_B2F_6287 | TGGTGTATACGTTGTCTTTGGAGC | 2565 | |
| SARS2_B2R_8828 | CACTTCTCTTGTTATGACTGCAGC | |||
| B3 | SARS2_B3F_10363 | TGTTCGCATTCAACCAGGACAG | 2440 | |
| SARS2_B3R_12780 | CCTACCTCCCTTTGTTGTGTTGT | |||
| B4 | SARS2_B4F_14546 | AGGAATTACTTGTGTATGCTGCTGA | 2607 | |
| SARS2_B4R_17131 | ACACTATGCGAGCAGAAGGGTA | |||
| B5 | SARS2_B5F_18897 | TGTTAAGCGTGTTGACTGGACT | 2559 | |
| SARS2_B5R_21428 | TGACCTTCTTTTAAAGACATAACAGCAG | |||
| B6 | SARS2_B6F_23123 | CCAGCAACTGTTTGTGGACCTA | 2551 | |
| SARS2_B6R_25647 | AGGTGTGAGTAAACTGTTACAAACAAC | |||
| B7 | SARS2_B7F_27447 | TCACTACCAAGAGTGTGTTAGAGGT | 2420 | |
| SARS2_B7R_29837 | TTCTCCTAAGAAGCTATTAAAATCACATGG |
Prepare the primers for each amplicon set by combining 4.5 µL forward primer (100 μM) , 4.5 µL reverse primer (100 μM) and 171 µL nuclease free water into clean PCR strips, as below:
One standard RT-PCR is shown below, but each sample requires 14 reactions in total, each containing the different amplicon primers A1-A7 & B1-B7.
| REAGENT | VOLUME (μl) | |
| Platinum SuperFi Green Mastermix (2X) | 10 | |
| Nuclease free water | 6.5 | |
| Primer pool (5 μM) | 2 | |
| Viral cDNA | 1.5 | |
| TOTAL | 20 |
Setup the following reaction mix for each sample and the no template control (NTC) according to requirements (one sample has 14.5 reactions, 14 primers + 0.5 for pipetting error):
| REAGENT | VOLUME (μl), s=samples | ||||
| S=1 | S=3 | S=6 | S=12 | ||
| Platinum SuperFi Green Mastermix (2X) | 145 | 435 | 870 | 1740 | |
| Nuclease free water | 94.25 | 282.75 | 565.5 | 1131 | |
Dispense 16.5 µL reaction mix into each well as required, a suggested plate setup is provided below for a 6 sample plate:
Using a 8-channel multipipettor, add 2 µL of the diluted and premixed primer sets into each well according to the plate layout.
Using a 8-channel multipipettor, add 1.5 µL viral cDNA into each well according to the plate layout.
Seal the plate, and centrifuge for 00:00:30 in a plate spinner.
Incubate the reaction as follows:
| STEP | TEMP (°C) | TIME (mm:ss) | CYCLES | |
| Hot start | 98 | 02:00 | 1X | |
| Denaturation | 98 | 00:15 | 40X | |
| Annealing | 65 | 00:30 | ||
| Extension | 72 | 02:00 | ||
| Final extension | 72 | 05:00 | 1X | |
| Hold | 4 | ∞ |
Analyse 5 µL each RT-PCR reaction on a 1% agarose gel with DNA staining dye.
When using Invitrogen E-Gel 48 Agarose precast gels, preload each well with 10 μl of EB buffer. All bands are expected to be ~2.5kb, so run with an appropriate DNA ladder. To aid in pooling visualisation, it is preferable to run all set A and B reactions for one sample on the same row.
PCR pooling and cleanup
PCR pooling and cleanup
An example gel is provided below for two different samples:
Pool the individual amplicons for each sample into a single well of a clean plate or PCR strip. The aim here is to roughly balance the amount of DNA from each amplicon to provide even coverage across the genome. Target the final volume in the pool to be ~40 µL (i.e. 3 µL for all 14 amplicons when yield is even).
Adjust the final volume of the pooled PCR product to 50 µL by aliquoting when exceeding or adding an appropriate volume of clean EB buffer when less.
Add 40 µL room temperature AMPure XP beads (0.8X bead ratio). Gently pipette the entire volume up and down 15 times to mix thoroughly.
Incubate at Room temperature for 00:10:00 .
Place the plate/tubes onto the magnetic stand for at least 00:02:00 , until the solution appears clear. Do not remove from magnetic stand during washing steps, and take care to not disturb beads.
Remove and discard the supernatant from each well by pipetting.
Add 200 µL freshly prepared 80% EtOH to each well without disturbing the beads.
Incubate at Room temperature for 00:00:30 .
Remove and discard the supernatant from each well by pipetting.
Repeat steps 35 to 37 for a total of two EtOH washes:
Add 200 µL freshly prepared 80% EtOH to each well without disturbing the beads.
Incubate at Room temperature for 00:00:30 .
Remove and discard the supernatant from each well by pipetting.
Allow the beads to air dry for 00:05:00 to 00:15:00 . Visually inspect wells to ensure any small droplets are completely removed by pipetting or evaporation.
Remove the plate/tubes from the magnetic stand.
Resuspend the dried bead pellet with 40 µL EB buffer .
Gently pipette the entire volume up and down 15 times to mix thoroughly.
Place the plate/tubes onto the magnetic stand at room temperature for at least 00:02:00 , until the solution appears clear.
Transfer the cleared supernatant containing the purified DNA into a suitable plate, strip or tube. Use immediately or store frozen at -20 °C .
Quantify all purified DNA using the Qubit dsDNA broad range assay.
For any samples >10ng/μl, roughly dilute using EB buffer so the final concentration is between 1 nanogram per microliter (ng/μL) to 10 nanogram per microliter (ng/μL) .
Re-quantify all purified and adjusted DNA using the Qubit dsDNA high sensitivity assay.
Dilute to 0.2 nanogram per microliter (ng/μL) using EB buffer (ensure at least 20 µL total volume ) and proceed to library prep.
DNA library preparation and sequencing
DNA library preparation and sequencing
Note
The following protocol follows the Illumina Nextera XT DNA library prep kit except for two important changes: i) all reaction volumes are halved to save on reagents and ii) that following the clean up after library amplification, the libraries are manually normalised rather than with the provided normalisation beads.
Combine 5 µL Tagment DNA Buffer (TD) and 2.5 µL pooled, diluted (0.2 ng/μl) amplicons for each sample into a PCR plate or strip.
Mix well by pipetting 10 times.
Add 2.5 µL Amplicon Tagment Mix (ATM) to each well on top of the TD/DNA mix.
Mix well by pipetting 10 times. Seal and briefly centrifuge.
Incubate the reaction mix as follows:
| STEP | TEMP (°C) | TIME (mm:ss) | |
| Tagmentation | 55 | 05:00 | |
| Hold | 10 | ∞ |
Following tagmentation, immediately remove the reaction from the thermocycler and add 2.5 µL Neutralize Tagment Buffer (NT) to stop the reaction.
Mix well by pipetting 10 times. Seal and briefly centrifuge.
Incubate at Room temperature for 00:05:00 .
Add indices and Nextera PCR Master Mix (NPM) to the neutralised tagmentation reaction for each sample as below:
| REAGENT | VOLUME (μl) | |
| Neutralised tagmentation reaction | 12.5 | |
| i7 adapter | 2.5 | |
| i5 adapter | 2.5 | |
| Nextera PCR Master Mix | 7.5 | |
| TOTAL | 25 |
Incubate the reaction as follows:
| STEP | TEMP (°C) | TIME (mm:ss) | CYCLES | |
| Hot start | 72 | 03:00 | 1X | |
| Initial denature | 95 | 00:30 | 1X | |
| Denaturation | 95 | 00:10 | 12X | |
| Annealing | 55 | 00:30 | ||
| Extension | 72 | 00:30 | ||
| Final extension | 72 | 05:00 | 1X | |
| Hold | 10 | ∞ |
Add 15 µL room temperature AMPure XP beads (0.6X bead ratio) to the 25 μl of amplified libraries. Gently pipette the entire volume up and down 15 times to mix thoroughly.
Incubate at Room temperature for 00:10:00 .
Place the plate/tubes onto the magnetic stand for at least 00:02:00 , until the solution appears clear. Do not remove from magnetic stand during washing steps, and take care to not disturb beads.
Remove and discard the supernatant from each well by pipetting.
Add 200 µL freshly prepared 80% EtOH to each well without disturbing the beads.
Incubate at Room temperature for 00:00:30 .
Remove and discard the supernatant from each well by pipetting.
Repeat steps 64 to 66 for a total of two EtOH washes:
Add 200 µL freshly prepared 80% EtOH to each well without disturbing the beads.
Incubate at Room temperature for 00:00:30 .
Remove and discard the supernatant from each well by pipetting.
Allow the beads to air dry for 00:05:00 to 00:15:00 . Visually inspect wells to ensure any small droplets are completely removed by pipetting or evaporation.
Remove the plate/tubes from the magnetic stand.
Resuspend the dried bead pellet with 22.5 µL EB buffer .
Gently pipette the entire volume up and down 15 times to mix thoroughly.
Place the plate/tubes onto the magnetic stand at room temperature for at least 00:02:00 , until the solution appears clear.
Transfer 20 µL cleared supernatant (containing the purified DNA) into a suitable plate, strip or tube. Use immediately or store frozen at -20 °C .
Quantify all purified DNA using the Qubit dsDNA high sensitivity assay.
Pool the individual libraries equally in DNA amount based on the Qubit values. Here, we assume the libraries will have similar fragment lengths and distributions.
Quantify the final pool of libraries using the Qubit dsDNA high sensitivity assay.
Analyse 2 µL final pool of libraries with Agilent High Sensitivity D5000 Screen Tape ensuring the whole fragment peak is captured.
Scale the calculated molarity from the Tapestation to the Qubit DNA concentration using the following formula:
Final molarity = (Tapestation DNA molarity) x (Qubit DNA conc / Tapestation DNA conc)
Dilute the final pooled libraries down to 1 nanomolar (nM) (at least 50μl) using EB buffer, and add PhiX sequencing control if required (we normally don't).
Combine 20 µL of 1nM library pool and 80 µL of EB buffer to dilute the final pool of libraries to 0.2 nanomolar (nM) for loading.
Load 20 µL of 0.2nM library pool into a defrosted Illumina iSeq cartridge with flow cell, and sequence with at least 75 nt paired end sequencing.
Note
Assuming even pooling, each run can comfortably include 12-18 SARS-CoV-2 genome libraries with >1000x coverage for consensus calling.
Finally, assemble your viruses and upload them onto www.gisaid.org. Some more details on basic bioinformatic workflow will be provided soon.
Addendum: Sequencing pooled amplicons with Oxford Nanopore Rapid Barcoding kit (SQK-RBK004)
Addendum: Sequencing pooled amplicons with Oxford Nanopore Rapid Barcoding kit (SQK-RBK004)
Note
Due to the larger amplicon size generated from this protocol, the application of Nanopore sequencing using the Rapid Barcoding kit was tested. The input for this workflow are four individual pooled samples that have been cleaned and quantified. The output of this process is a “pseudomolecule” with the variant bases of sequenced sample relative to the genome of MN908947.3
Perform Flow cell QC as per Oxford Nanopore’s instructions prior to starting library preparation.
For each sample, combine between 100-200 fmol of pooled amplicons with 2.5 µL fragmentation mix .
Adjust the final volume for each tube to 10 µL using Nuclease free water. Gently flick to mix and spin down.
Incubate tubes at 30 °C for 00:01:00 and then at 80 °C for 00:01:00 in a thermocycler. Place tubes On ice to cool.
Pool all samples into a 1.5 ml LoBind tube. Gently flick to mix and spin down.
Aspirate and dispense 10 µL of pooled RBK004 libraries into a different 1.5 ml LoBind tube and add 1 µL RAP . Gently flick to mix and spin down.
Incubate the tube at Room temperature for 00:05:00 .
Store the prepared library On ice until required.
Perform priming and loading the Spot ON Flow Cell as per Oxford Nanopore’s instructions.
Perform sequencing for up to 02:00:00 or until enough data is obtained.
Once sequencing run is completed, perform base calling, demultiplexing and adaptor trimming using Guppy.
Filter each demultiplexed read set using NanoFilt (https://github.com/wdecoster/nanofilt) to keep reads with a minimum quality of 10 and a maximum length of 2,700 bases.
Map each filtered read set to onto the reference genome (accession: MN908947.3) separately using Minimap2 (https://github.com/lh3/minimap2) and convert the resulting mapping file into a sorted .bam file using SAMtools (https://github.com/samtools/samtools).
Visualise and inspect the mapping profile over the reference genome.
Note
N.B. Expect no/low coverage (< 10 x coverage) in some bases in 5’ and 3’ ends of the reference genome (approximately the first 40 bases and the last 50 bases of the reference genome).
Note
Ensure that you select the correct medaka model based on your Nanopore sequencing platform. In addition, variants with a QUAL score of less than 30 should be interrogated before generating a consensus pseudomolecule.
Generate consensus sequence from the resulting .vcf file using BCFtools (https://samtools.github.io/bcftools/).