Mar 07, 2024
Reconditioning PCR for removal of PCR bubbles in Illumina librarys
- 1University of Duisburg-Essen, Aquatic Ecosystem Research
Protocol Citation: Dominik Buchner 2024. Reconditioning PCR for removal of PCR bubbles in Illumina librarys. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9p9ypg3e/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 07, 2024
Last Modified: March 07, 2024
Protocol Integer ID: 96294
Abstract
This protocol describes how to remove partly single-stranded PCR products ("PCR bubbles") from Illumina libraries. For more information about this phenomenon please see this explanation from Illumina. For metabarcoding libraries, it can be hard to estimate the optimal input template or the perfect amount of PCR cycles and therefore overamplification happens frequently. PCR bubbles cannot be quantified reliably with fluorometric-based methods and may look different on different capillary electrophoresis devices.
PCR bubbles can lead to failed sequencing runs due to over- or underloading the flowcell.
Guidelines
Follow general lab etiquette. Wear gloves to prevent contamination of samples. Clean the workspace before starting and after finishing with 80% EtOH.
Materials
Materials required:
Below all materials needed for the protocol are listed. Vendors and part numbers are listed but interchangeable depending on the supply situation.
Chemicals:
QIAGEN Multiplex PCR Plus KitQiagenCatalog #206152
Primers:
Illumina P5 5' - AATGATACGGCGACCACCGAGATCT - 3'
Illumina P7 5' - CAAGCAGAAGACGGCATACGAGAT - 3'
Safety warnings
Buffers containing guanidine produce highly reactive compounds when mixed with bleach. Don't mix the extraction waste with bleach or solutions that contain bleach.
Reagents are potentially damaging to the environment. Dispose waste as mandated.
Quality control
Quality control
Perform a quality control of your library. PCR bubbles may look different depending on the method used for quality control. See below and example of the Fragment Analyzer, Bioanalyzer and an agarose gel.
Example result of the Agielnt fragment analyzer for a library that contains PCR bubbles. The desired peak is at 443 bp, the shoulder to the right of it is the PCR bubble.
The same library on the Agilent bioanalyzer. The shoulder is moved further to the right, also the relationship of library to PCR bubble changed significantly.
PCR reactions of the same library visualized on 1% agarose. Notice the faint band above the actual amplicon.
Library concentration (optional)
Library concentration (optional)
Concentrate your library by reducing the volume down to 100 µL . We usually do this with a spin-column based protocol, although this can be performed with magnetic beads as well.
Note
Please see:
Protocol
NAME
PCR cleanup and size selection with magnetic beadsCREATED BY
Dominik Buchner
or
Protocol
NAME
Guanidine-based DNA extraction with silica-coated beads or silica spin columnsCREATED BY
Dominik Buchner
Reconditioning PCR
Reconditioning PCR
Fill the concentration of your library and the project name into the Excel spreadsheet. The suggested master mix for the reconditioning PCR will be calculated accordingly. We usually go for 1250 ng of template input, however, this can be adjusted if necessary. master mix
Note
You can download the Excel spreadsheet here:
Mastermix calculator reconditioning PCR.xlsx Perform the PCR with 4 reactions of 50 µL .
PCR clean-up
PCR clean-up
Pool the 4 PCR reactions.
Perform a column-based PCR clean-up to exchange the buffer. This can also be done with magnetic beads. Elute the DNA in 100 µL .
Protocol
NAME
Guanidine-based DNA extraction with silica-coated beads or silica spin columnsCREATED BY
Dominik Buchner
Size-selection
Size-selection
Perform a size selection with a ratio of 0.7x to remove residual primer dimers. Elute the final library in 50 µL .
Protocol
NAME
PCR cleanup and size selection with magnetic beadsCREATED BY
Dominik Buchner
Perform final quality control
Perform final quality control
Perform a final quality control. Quantify the library concentration with a fluorometric-based method and perform quality control via electrophoresis. The shoulder should be gone and the library should be good for sequencing.
Example result of the Agielnt fragment analyzer for a library after the removal of PCR bubbles.
The same library on the Agilent bioanalyzer after the removal of PCR bubbles.
Expected result
The quality of the sequencing run should be high after the reconditioning PCR.