Sep 03, 2024
Real-time and programmable transcriptome sequencing with PROFIT-seq
- 1Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
Protocol Citation: lingling hou, Jinyang Zhang 2024. Real-time and programmable transcriptome sequencing with PROFIT-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl8p19rg2w/v1
Manuscript citation:
Real-time and programmable transcriptome sequencing with PROFIT-seq
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 17, 2023
Last Modified: September 03, 2024
Protocol Integer ID: 89376
Keywords: non-coding RNA, nanopore adaptive sequencing
Funders Acknowledgement:
National Key R&D Project
Grant ID: 2021YFC2301300
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
PROgrammable Full-length Isoform Transcriptome sequencing (PROFIT-seq) is a method that enriches target transcripts while maintaining unbiased quantification of the whole transcriptome. PROFIT-seq employs combinatorial reverse transcription to capture polyadenylated, non-polyadenylated, and circular RNAs, coupled with nanopore adaptive sampling that selectively enriches target transcripts during sequencing.
Guidelines
- Handle RNA and enzymes on ice whenever possible.
- All reagents must be kept nuclease-free.
- Use only molecular grade nuclease-free water.
- Perform the incubation steps in the thermal cycler.
- When performing multiple reactions, use a master mix containing 10% excess.
- If not mentioned otherwise, use a 1:1 ratio of beads to sample to select nucleic acids >150-200 nt in clean-ups step using magnetic beads.
Materials
General materials:
- RNaseZap (Thermo Fisher Scientific, cat. No. AM9782)
- AMPure XP (Beckman, cat. No. A63882)
- RNAClean XP (Beckman, cat. No. A63987)
- Nuclease-free water (UltraPure DNase/RNase-free water, Thermo Fisher Scientific, cat. No. 10977015)
- Ethanol, pure 200 proof, for molecular biology (Sigma-Aldrich, cat. No. E7023-500mL)
- 25-ml reagent reservoir for eight-channel pipettes (VWR, cat. No. BITXSR-0025-BWM)
- 1.5ml DNA LoBind tubes (Eppendorf, cat. Nos. 0030108051)
- 1.5 mL tubes (Axygen, cat. No. MCT-150-C)
- 0.2 mL PCR tubes (Axygen, cat. No. PCR-02-C)
- 0.2 mL 8-strip PCR Tubes and Domed Cap Strips (Axygen, cat. No. PCR-0208-CP-C)
- 10-, 100-, 200- and 1000μl filter barrier tips pipette tip, filter, sterile (Axygen, cat. nos. TF-300-R-S, TF-100-R-S, TF-200-R-S, TF-1000-L-R-S)
- Eppendorf ThermoMixer C with Thermo top (Eppendorf, mod no. 5382000023)
- Tube Rotator (MACSmix, mod no.130-090-753)
- DynaMag-2 magnet for 1.5-ml microtube (Thermo Fisher Scientific, mod no. 12321D)
- DynaMag-96 Magnets (Thermo Fisher Scientific, mod no. 12331D)
- Refrigerated centrifuge (e.g.: Eppendorf, mod no. 5430R)
- Bench top centrifuge (e.g.: Eppendorf, mod no. minispin)
- Thermocycler (e.g.: Biometra mod no. TRIO 48)
- Minicentrifuge (e.g.: Kelyn-Bell, mod no. LX-200)
- Deoxynucleotide (dNTP) Solution Mix (10mM) (New England Biolabs, cat. No. N0447L)
For ribosomal RNA depletion:
- KAPA RiboErase Kit (HMR) Human/Mouse/Rat (KAPA Biosystems, cat. No. KK8481/2)
For combinatorial reverse transcription:
- SMARTer‱ PCR cDNA Synthesis Kit (Clonetech, cat. No. 634925 & 634926)
- NEBNext Quick Ligation Module (NEB, cat. No. E5056)
For cDNA amplification:
- LongAmp‱ Taq 2X Master Mix (NEB, cat. No. M0287)
For splint-based circularization:
- NEBuilder HiFi DNA Assembly Reaction (NEB, cat. No. E2621S)
- Exonuclease I (E. coli) (NEB, cat. No. M0293L)
- Exonuclease III (E. coli) (NEB, cat. No. M0206L)
For rolling circle amplification (RCA):
- phi29 DNA Polymerase (NEB, cat. No. M0269L)
For Debranching of the RCA products:
- T7 Endonuclease I (NEB, cat. No. M0302L)
For BluePippin size selection:
- BluePippin reagents and Agarose Cassettes(0.75% (w/v) agarose gel cassette, dye-free, S1 marker, low range, 1-10 kb)，SageScience, cat. No. BLF7510)
For nanopore sequencing library construction
- Nanopore ligation sequencing kit (Nanopore, cat. No. LSK109+NBD104/114)
- Nanopore sequencer (Oxford Nanopore Technologies, MinION / GridION / PromethION)
For quality control:
- Qubit double-stranded DNA HS assay kit (Thermo Fisher Scientific, cat. No. Q32854)
- Qubit RNA HS assay kit (Thermo Fisher Scientific, cat. No. Q32852)
- Qubit assay tubes (Thermo Fisher Scientific, cat. No. Q32856)
- HS NGS Fragment Kit (1-6000bp) (Agilent, cat. No. DNF-474-0500)
- HS Genomic DNA Kit (Agilent, cat. No. Agilent DNF-488-0500)
- HS RNA Kit (15NT) (Agilent, cat.no. DNF-472-0500)
- Qubit 3.0 fluorometer (Thermo Fisher Scientific, mod no. Q33216) with kit or Qubit 4.0 fluorometer, Thermo Fisher Scientific, mod no Q33238)
- 5200 Fragment Analyzer systems (Agilent, mod no. M5310AA), Bioanalyzer 2100 (Agilent, mod no. M5310AA), Tapestation (Agilent, mod no. M5310AA), or other equivalent systems.
- Nanodrop 2000 (Thermo Fisher Scientific, mod no ND2000)
Primer used in this protocol:
| Primer name | Primer sequence | |
| RT.dT | 5'-CTACACGACGCTCTTCCGATCTTTTTTTTTTTTTTTTTTTTTTVN-3' | |
| RT.N6 | 5'-CTACACGACGCTCTTCCGATCTNNNNNN-3' | |
| RT.ds.rv | 5'-AGATCGGAAGAGCGTCGTGTAG-3' | |
| R.P | 5'-CTACACGACGCTCTTCCGATCT-3' | |
| F.P | 5'-AAGCAGTGGTATCAACGCAGAGTAC-3' | |
| TSO (SMARTer kit) | 5'–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3' | |
| RT.linker | 5'-AGATCGGAAGAGCGTCGTGTAGTGAGGCTGATGAGTTCCATANNNNNTATATNNNNNATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTCTTTGCTGGCAGTAAAAG-3' | |
| TSO.linker | 5'-CTCTGCGTTGATACCACTGCTTAAAGGGATATTTTCGATCGCNNNNNATATANNNNNTTAGTGCATTTGATCCTTTTACTCCTCCTAAAGAACAACCTGACCCAGCAAAAGGTACACAATACTTTTACTGCCAGCAAAGAG-3' | |
| Linker.R | 5'-CTCTGCGTTGATACCACTGCTT-3' | |
| N6R 3'-terminal phosphorothioate (PTO) modifications | 5'-NNNN*N*N-3' |
Before start
All experimental procedures including reagent preparation should be performed under RNase- and DNase-free conditions. Bleach the workbench with RNaseZap before starting the experiment. Change gloves frequently to avoid RNase contamination.
Primer:
- Order 100 nmol of DNA oligo, PAGE purification.
- Dissolve the primer powder in nuclease-free water to a final concentration of 50 µM.
- The dissolved primers can be stored at -20°C for months.
- RT.dT.ds(1.4uM) can be obtained by annealing RT.dT (50 µM) and RT.ds.rv (50 µM) 1:1 at 1.4 μM in anealing buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl).
- RT.N6.ds(1.4uM) can be obtained by annealing RT.N6 (50 µM) and RT.ds.rv (50 µM) 1:1 at 1.4 μM in anealing buffer (10 mM Tris-HCl pH 7.5, 50 mM NaCl).
DNA Splint preparation:
- The DNA splint was generated by primer extension of four oligos: RT.linker RT.linker, TSO Linker.R (50 µM), TSO and Linker.R.
Ribosomal RNA depletion
Ribosomal RNA depletion
2h 30m
2h 30m
Remove ribosomal RNA from extracted RNA samples:
Use 1 µg total RNA (RNA Quality Number (RQN) ≥ 7.0) as starting material.
Equilibrate the RNAClean XP beads for at least 00:30:00 at Room temperature , and vortex thoroughly to resuspend the beads.
30m
Remove ribosomal RNA (rRNA) using an RNase H-based commercial kit – RiboErase kit (human/mouse/rat) (KAPA Biosystems, KK8481) according to the manufacturer’s user guide, and elute RNA in15 µL nuclease-free water.
Aspirate 2 µL RNA for quantification with a Qubit fluorometer to assess the recovery after rRNA
depletion.
Aspirate another1 µL RNA for detecting whether mRNA is degraded or not with 5200 Fragment
Analyzer systems (Agilent).
Reverse transcription
Reverse transcription
Combinatorial reverse transcription using RT.dT.ds / RT.N6.ds / RT.N6.ss primers:
Capture polyadenylated / non-polyadenylated and circular transcriptome using combinatorial RT primers
3h 30m
Adjust the volume of1 µg RNA to 10 µL with nuclease-free water.
Mix by pipetting and spin down briefly in a microcentrifuge.
Incubate in a hot-lid thermal cycler at 65 °C for 00:05:00 , then place on ice immediately.
5m
Prepare the following reagents in a 0.2 mL RNase/DNase-free PCR tube:
| Reagent | Volume (ul) | |
| rRNA depleted RNA | 10 | |
| 10X NEBNext Quick Ligation Reaction Buffer | 3 | |
| RT.dT.ds oligods (1.4uM) | 0.5 | |
| T4 DNA Ligase | 1.5 | |
| Total volume | 15 |
Mix by pipetting and spin down briefly in a microcentrifuge.
Incubate at 25 °C for 00:10:00 .
10m
Add 0.5 µL of 1.4 micromolar (µM) RT.N6.ds oligos to the mixture.
10m
Mix by pipetting, and spin the tubes briefly in a microcentrifuge.
Incubated at 25 °C for 00:10:00 .
10m
Prepare the following mix containing the components listed below in a 0.2 mL RNase/DNase-free PCR tube:
| Reagent | Volume (ul) | |
| Nuclease-free water | 10 | |
| 5x first-strand buffer | 8 | |
| DTT (100mM) | 2 | |
| dNTP (10mM) | 2 | |
| RNase inhibitor | 1 | |
| TSO | 1 | |
| SMARTer reverse transcriptase (100U) | 1 | |
| Total volume | 25 |
Total volume: 25uM
Mix by pipetting, and spin the tubes briefly in a microcentrifuge.
Place the tube in a thermal cycler and Incubate at42 °C for 01:00:00 .
1h
Add 0.5 µL of RT.N6.ss (50 micromolar (µM) ) to the reaction
Mix by pipetting, and spin the tubes briefly in a microcentrifuge.
Place the tube in the thermal cycler and incubate at 25 °C for 00:10:00 , 42 °C for 01:00:00 , and then70 °C for 00:10:00 , and bring the sample to 4 °C before proceeding to the next step.
1h 20m
Clean-up:
30m
Vortex thoroughly to resuspend the AMPure XP beads before use.
Add 40 µL AMPure XP (Beckman, A63880) beads to the 40 µL RNA sample from step 2.15 and mix the sample well by pipetting up and down and spinning down briefly.
Incubate at Room temperature for 00:05:00 to bind RNA to the beads.
5m
Place the 0.2 mL tube on the magnetic stand until the solution is clear (~00:02:00 ). Keep the tube on the magnetic stand. Remove supernatant carefully, taking care not to disturb the beads.
2m
Add 200 µL of freshly prepared 75 % (v/v) ethanol to the tube. Wait for 00:00:30 , then discard the entire supernatant.
▲ CRITICAL STEP Beads should always be kept on the magnetic stand while washing with ethanol, and should not be resuspended.
30s
Wash beads once more with 75 % (v/v) ethanol by repeating step 3.5go to step #2.5 .
Quickly spin the tubes in a minicentrifuge and remove all residual liquid.
Air-dry the beads on the magnetic rack for 00:00:30 .
▲CRITICAL STEP Beads should not be overdried during the process, because cracked beads will decrease the RNA recovery.
30s
Resuspend beads with 10 µL nuclease-free water.
Incubate at room temperature for 00:02:00 to elute RNA from the beads.
2m
Put the tube back on the magnetic rack for00:01:00 to pellet the beads.
1m
Transfer 8 µL supernatant to a new0.2 mL tube. Take care not to disturb the bead pellet. The purified cDNA can be stored at -20 °C for several weeks.
Pre-circularization amplification:
1h
Add the following components to a 0.2 mL PCR tube on ice:
| Reagent | Volume (ul) | Final concentration | |
| LongAmp Taq 2x Master Mix (NEB: M0287) | 25 | 1X | |
| 10 uM TSO.F | 2 | 0.4 uM | |
| 10 uM 10x.R | 2 | 0.4 uM | |
| Template cDNA | 5 | ||
| Nuclease-free water | 16 | ||
| Total volume: | 50 |
Mix by pipetting, and spin the tubes briefly in a microcentrifuge.
Transfer the PCR tubes to a thermocycler and begin the program below:
| Number of cycles | Denature | Anneal | Extend | |
| 1 | 95 °C, 3 mins | - | - | |
| 14-15 | 95 °C, 10 s | 60 °C, 20 s | 65 °C, 60 s | |
| 1 | - | - | 65 °C, 1 min | |
| Hold | 4-10 °C | |||
Clean-up
30m
Purification the amplified cDNA with AMPure XP beads as described before using a 0.8:1 ratio (40 µL beads). Elute cDNA in 10 µL .
The cDNA can be stored at -20 °C for several weeks.
Circularization & rolling circle amplification
Circularization & rolling circle amplification
Splint-based circularization:
CITATION
1h
Set up the following reaction mix on ice:
| Reagent | Volume (ul) | |
| Amplified cDNA (100ng) | 10 | |
| DNA splint (100ng) | ||
| Deionized H2O | ||
| 2X NEBuilder HIFI DNA Assembly Master Mix (NEB: E2621S) | 10 | |
| Total volume | 20 |
Incubate at 50 °C for 01:00:00 .
1h
Digestion of non-circularized products:
1h
Add 1 µL Exonuclease I (20 U / μl) and 0.3 µL Exonuclease III (100 U / μl) to digest non-circular DNA.
Mix by pipetting, and spin the tubes briefly in a microcentrifuge.
Incubate at 37 °C for 01:00:00 .
1h
Clean-up:
30m
Purification cDNA with AMPure XP beads as described before.
Elute in 10 µL of elution buffer (10 millimolar (mM) Tris, 8.0 ).
The cDNA library can be stored at -20 °C for several weeks.
Rolling circle amplification (RCA):
13h
Set up the following reaction mix on ice:
| Reagent | Volume (ul) | |
| 10X Phi29 Buffer | 20 | |
| 10 mM dNTP | 10 | |
| exonuclease-resistant random hexamers NNNN*N*N (100 μM) with two 3'-terminal phosphorothioate (PTO) modifications | 4 | |
| BSA | 2 | |
| DNA | 8 | |
| H2O | 152 | |
| Phi29 DNA polymerase (NEB: M0269L) | 4 | |
| Total volume | 200 |
Divide the mixture into 4 tubes of 50 µL reaction.
Incubated at 30 °C Overnight , then 65 °C for 00:20:00 .
13h 20m
Clean-up:
30m
Mix each two tubes of sample into one tube.
Purification cDNA with AMPure XP beads as described before using a 0.5:1 ratio (50 µl beads).
Elute in T7 Endonuclease I reaction mix below.
Debranching of the RCA products:
30m
Add the T7 Endonuclease I (NEB: M0302L) reaction mix to the beads above to debranch and elute the RCA product:
| Reagent | Volume (ul) | |
| ultrapure water | 52 | |
| NEB buffer 2 | 6 | |
| T7 Endonuclease I (10 units/μL) | 2 | |
| Total volume | 60 |
Incubate on a thermal shaker at 37 °C for 00:30:00 under constant agitation at 1800 rpm.
30m
Place the tubes on a magnet, and aspirate the supernatant into a new tube.
Clean-up
30m
Purification the DNA in supernatant with AMPure XP beads as described before using a 0.5:1 ratio (30 µL beads).
Elute in 15 µL of elution buffer (10 millimolar (mM) Tris, 8.0 ).
The debranched RCA products can be stored at -20 °C for several weeks.
Size selection of the RCA products
Warm the agarose gel cassettes and reagents to room temperature, vortex and spin the
loading solution briefly, and flick and briefly spin the S1 marker.
Add 40 µL running buffer to the elution wells following the general guidelines for preparing samples and cassettes as described in the BluePippin User Guide. Samples can be vortexed briefly to properly mix them with the loading solution.
Set the program to recover DNA fragments larger than 7 kb using the BluePippin (Sage Science)
and BLF7510 cassette with the ‘0.75DF 1-10 kb Marker S1-Improved Recovery’ cassette definition.
Nanopore sequencing library construction
Prepare the cDNA libraries following the Oxford Nanopore protocol “Ligation sequencing amplicons - native barcoding (SQK-LSK109 with EXP-NBD104 and EXP-NBD114)”. The specific steps include end-prep, native barcode ligation and nanopore adapter ligation, and flow cell priming and loading. The updated barcoding kit (SQK-LSK114) can replace SQK-LSK109 for this experiment.
Note
Make sure the DNA meets the quantity and quality requirements specified by the manufacturers. Using too little or too much DNA will affect your library preparation. 100–200 fmol input DNA is required for each sample when using R9.4.1 flow cells. The online tool NEBioCalculator (https://nebiocalculator.neb.com/#!/dsdnaamt) is recommended to convert dsDNA mass to moles.
Using different barcodes for different samples is critical for demultiplexing pooled sequencing reads.
A 0.5:1 AMPure beads-to-sample ratio is recommended to select against short fragments after sequencing adapter ligation.
The wash buffer SFB, not LFB which is designed to enrich DNA fragments >3 kb, must be used to purify all fragments equally.
Load 30-50 fmol DNA library for R9.4.1 flow cells.
4. Nanopore sequencing
4. Nanopore sequencing
Install and configuration MinKNOW
Install MinKNOW following the instructions from nanopore community
Backup the original sequencing configuration file:
cd /opt/ont/minknow/conf/package/sequencing
cp sequencing_MIN106_DNA.toml sequencing_MIN106_DNA.toml.bak
Edit the following line to change reads break intervals:
[analysis_configuration.read_detection]
mode = "transition"
minimum_delta_mean = 80.0
look_back = 2
break_reads_after_events = 250
break_reads_after_seconds = 0.4 # Change it from 1.0 to 0.4
break_reads_on_mux_changes = true
open_pore_min = 150.0
open_pore_max = 250.0
Install PROFIT-seq
Install anaconda3
# Install system libraries
sudo apt install zlib1g-dev libncurses5-dev libbz2-dev liblzma-dev
# Install Mambaforge3
wget https://github.com/conda-forge/miniforge/releases/latest/download/Mambaforge-pypy3-Linux-x86_64.sh
bash Mambaforge-pypy3-Linux-x86_64.sh
Create virtual environment for PROFIT-seq
mamba create -p /home/biols/envs/python3.8.10 python==3.8.10
mamba activate /home/biols/envs/python3.8.10
Install PROFIT-seq
pip install --recursive https://github.com/bioinfo-biols/PROFIT-seq.git
cd PROFIT-seq
# Install python dependencies
pip install -r requirements.txt
PROFIT-seq is based on ReadUntil API
CITATION
CITATION
Install other dependencies:
mamba install bioconda::porechop
mamba install bioconda::minimap2
mamba install bioconda::samtools
mamba install bioconda::stringtie
mamba install bioconda::gffread
mamba install bioconda::salmon
CITATION
CITATION
CITATION
CITATION
CITATION
Prepare reference genome and annotation:
Prepare the minimap2 index of reference genome
# For example, for human samples:
wget https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_37/GRCh38.p13.genome.fa.gz
gunzip GRCh38.p13.genome.fa.gz
minimap2 -t 6 -x splice -d GRCh38.p13.genome.fa.mmi GRCh38.primary_assembly.genome.fa
Connect MinION Mk1B and insert the FLO-MIN106D flow cell correctly:
Open the MinKNOW software to make sure flow cell have been successfully recognized.
Run PROFIT-seq
Switch to minknow user to start PROFIT-seq process:
# Switch to minknow user
sudo su - minknow
bash && source /home/biols/.bashrc
# Activate PROFIT-seq environment
mamba activate /home/biols/envs/python3.8.10
# Run PROFIT-seq
python3 PROFIT-seq.py \
--mm_idx /home/biols/data/hg38/GRCh38.primary_assembly.genome.fa.mmi \
--gtf /home/biols/data/hg38/gencode.v37.annotation.gtf
Note
Always use the fast basecalling config when running PROFIT-seq to avoid performance issues.
Note
The PROFIT-seq need to run with minknow user to grant the right permission.
Note
Usage: PROFIT-seq.py [OPTIONS]
Options:
--minknow_host TEXT ip address for MinKNOW host. Defaults to to 127.0.0.1.
--minknow_port TEXT port for MinKNOW service. Defaults to 8000.
--guppy_address TEXT address for guppy server. Defaults to ipc::///tmp/.guppy/5555.
--guppy_config TEXT guppy basecalling config. Defaults to dna_r9.4.1_450bps_fast.
--dashboard_port TEXT guppy basecalling config. Defaults to 55280.
--mm_idx TEXT Minimap2 index of reference sequences [required]
--version Show the version and exit.
--help Show this message and exit.
If everything works fine, the prompt of url for dashboard will appear on your screen. For example:
(python3.8.10) minknow@biols-Precision-5820-Tower:/home/biols/git/PROFIT-seq$ python3 PROFIT-seq.py --mm_idx /home/biols/data/hg38/GRCh38.primary_assembly.genome.fa.mmi --gtf /home/biols/data/hg38/gencode.v37.annotation.gtf
[Mon 2024-09-02 19:57:16] [INFO ] Connected to MinKNOW server
[Mon 2024-09-02 19:57:16] [INFO ] Connected to Guppy server
[Mon 2024-09-02 19:57:47] [INFO ] Loaded reference index
[Mon 2024-09-02 19:57:54] [INFO ] Loaded annotation gtf
[Mon 2024-09-02 19:57:54] [INFO ] Starting PROFIT-seq dashboard
* Serving Flask app 'app.server'
* Debug mode: off
WARNING: This is a development server. Do not use it in a production deployment. Use a production WSGI server instead.
* Running on all addresses (0.0.0.0)
* Running on http://127.0.0.1:55280
* Running on http://10.4.0.44:55280
Press CTRL+C to quit
Configure the adaptive sampling jobs using the "Adaptive Sampling Jobs" panel or upload jobs with the TOML format.
Note
Example of a valid TOML config:
[[jobs]]
name = "Unblock_mt"time = [0, 240]
ch = [129, 256]
bc = "all"target = [
{region = ["chrM", "0", "16569"], action="enrich"},
{region = "multi", action="unblock"},
{region = "miss", action="unblock"},
{region = "unmapped", action="wait"},
]
Basic options:
- name: User-specified name for each target job.
- time: range of start and end time (minutes) for the job.
- ch: range of start and end channel for the job. (0-512 for MinION).
- bc: barcode for the job.
- target: specify what actions should be performed when aligning to specific region.
Available barcode options:
- barcode01,barcode02 (comma-seperated list of barcode names, only reads with these barcodes will be processed)
- classified (all reads with classified barcodes will be processed)
- unclassified (all reads with unclassified barcodes will be processed)
- all (all reads will be processed)
Available target options:
# Priority: all > unmapped > mapped > multi > region
- chrom:start-end (reads that mapped to spefici region will be processed)
- multi (reads that are multi-mapped will be processed)
- mapped (all reads mapped to the reference index will be processed)
- miss (reads mapped to the reference index, but missed any target regions will be processed)
- unmapped (all reads that could not be aligned to the reference index will be processed)
- all (all reads with be processed)
Available action options:
# action
- stop_receiving (finish sequencing this read)
- unblock (reject this read)
- wait (wait for decision in the next chunk)
- balance (balance coverage for all target regions with action `balance`)
At lease one of the following combination of actions are required for a valid job
1. unmapped + mapped
2. unmapped + regions + miss
Start sequencing protocol in MinKNOW.
Click 'Run unblock' in PROFIT-seq control panel to start pore manipulation.
5. Data analysis
5. Data analysis
Raw data basecalling:
Re-basecall the sequenced reads with hac model
# Switch to minknow user
sudo su - minknow
# User guppy for basecalling
/opt/ont/guppy/bin/guppy_basecall_client \
-r --input_path path_to_input --save_path path_to_output \
-c dna_r9.4.1_450bps_hac.cfg \
--port ///tmp/.guppy/5555 \
--barcode_kits "EXP-NBD114" \
--compress_fastq
# Demultiplex different barcodes
/opt/ont/guppy/bin/guppy_barcoder \
-i path_to_output/pass \
-s path_to_output/barcoded \
--compress_fastq \
--disable_pings
Channel demultiplex (optional):
If various adaptive sampling jobs are assigned to different channels, use scripts/step1_demultiplex.py to demultiplex reads from different sequencing channels.
python3 scripts/step1_demultiplex.py -i input.fastq.gz -o sample1.fastq.gz --start 1 --end 256
Note
Usage: step1_demultiplex.py [OPTIONS]
Options:
-i, --infile TEXT input gzipped fastq file. [required]
-o, --outfile TEXT output gzipped fastq file. [required]
-st, --start INTEGER start channel number. [required]
-en, --end INTEGER end channel number. [required]
-t, --threads INTEGER number of threads.
Adapter trimming & consensus calling:
Trim sequencing barcodes using porechop:
porechop -i sample1.fastq.gz -o sample1.trimmed.fastq.gz --threads 32 --check_reads 1000
Get consensus reads using scripts/step2_consensus.py
python3 scripts/step2_consensus.py \
-i sample1.trimmed.fastq.gz \
-s sequencing_summary_FAQ85160_399ee876.txt \
-o ./output_sample1 \
-p sample1 \
-t 16 \
--trimA
Note
Usage: step2_consensus.py [OPTIONS]
Options:
-i, --input PATH input trimmed fastq. [required]
-s, --summary PATH input sequencing summary generate by MinKNOW. [required]
-o, --outdir PATH output directory. [required]
-p, --prefix TEXT output prefix name. [required]
-r, --adapter PATH Adapter sequences file. Defaults to embedded splint adapter sequences.
-t, --threads INTEGER number of threads. Defaults to number of cpu cores.
--trimA trim 3' poly(A) sequences
Isoform assembly & quantification:
Perform downstream analysis using scripts/step3_analysis.py:
python step3_analysis.py \
-i ./output_sample1 \
-p sample1 \
-r GRCh38.primary_assembly.genome.fa \
-a gencode.v37.annotation.gtf \
-t 16 \
--assemble \
--bed ../cancer_panel.bed
Note
Usage: step3_analysis.py [OPTIONS]
Options:
-i, --workspace PATH directory of step2_consensus.py output [required]
-p, --prefix TEXT sample prefix for step2_consensus.py [required]
-r, --genome PATH reference genome fasta. [required]
-a, --gtf PATH gene annotation gtf. [required]
-b, --bed PATH bed file for target regions. [required]
-t, --threads INTEGER number of threads. Defaults to number of cpu cores.
--assemble perform transcript isoform assemble.
--help Show this message and exit.
Output files:
| Filename | Description | |
| workspace/prefix.fl.fa | Full-length consensus reads | |
| workspace/prefix_isoforms.genes.sf | Gene-level quantification results | |
| workspace/prefix_isoforms.gtf | Isoform annotations | |
| workspace/prefix_isoforms.transcripts.sf | Transcript-level quantification results | |
| workspace/prefix.recovered.fa | Non-full-length sequence |
Citations
Step 15.3
Payne A, Holmes N, Clarke T, Munro R, Debebe BJ, Loose M. Readfish enables targeted nanopore sequencing of gigabase-sized genomes.
https://doi.org/10.1038/s41587-020-00746-xStep 15.3
Loose, M., Malla, S., & Stout, M. . Real-time selective sequencing using nanopore technology
https://doi.org/10.1038/nmeth.3930Step 15.4
Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression.
https://doi.org/10.1038/nmeth.4197Step 15.4
Li H. Minimap2: pairwise alignment for nucleotide sequences.
https://doi.org/10.1093/bioinformatics/bty191Step 15.4
Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H. Twelve years of SAMtools and BCFtools.
https://doi.org/10.1093/gigascience/giab008Step 15.4
Kovaka S, Zimin AV, Pertea GM, Razaghi R, Salzberg SL, Pertea M. Transcriptome assembly from long-read RNA-seq alignments with StringTie2.
https://doi.org/10.1186/s13059-019-1910-1Step 15.4
Pertea G, Pertea M. GFF Utilities: GffRead and GffCompare.
https://doi.org/pii:ISCBCommJ-304.10.12688/f1000research.23297.2Step 5
Volden R, Vollmers C. Single-cell isoform analysis in human immune cells.
https://doi.org/10.1186/s13059-022-02615-z