Sep 10, 2024

Public workspaceR2C2 protocol using 10x Single-Cell RNA-seq Assay cDNA

DOI
dx.doi.org/10.17504/protocols.io.81wgbzonygpk/v1
  • 1Broad Institute of MIT and Harvard
xian Adiconis
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.81wgbzonygpk/v1
Protocol Citation: Xian Adiconis, Joshua Z Levin 2024. R2C2 protocol using 10x Single-Cell RNA-seq Assay cDNA. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbzonygpk/v1
Manuscript citation:
Simmons SK, Adiconis X, Haywood N, Parker J, Lin Z, Liao Z, Tuncali I, Al'Khafaji AM, Shin A, Jagadeesh K, Gosik K, Gatzen M, Smith JT, El Kodsi DN, Kuras Y, Baecher-Allan C, Serrano GE, Beach TG, Garimella K, Rozenblatt-Rosen O, Regev A, Dong X, Scherzer CR, Levin JZ. Experimental and Computational Methods for Allelic Imbalance Analysis from Single-Nucleus RNA-seq Data. bioRxiv [Preprint]. 2024 Aug 16:2024.08.13.607784. doi: 10.1101/2024.08.13.607784. PMID: 39185246; PMCID: PMC11343128.
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 31, 2024
Last Modified: September 10, 2024
Protocol Integer ID: 106781
Keywords: R2C2, single cell RNA-seq, ONT, long-read sequencing
Funders Acknowledgement:
Aligning Science Across Parkinson’s
Grant ID: ASAP-000301
Abstract
This protocol is based on the published Rolling Circle to Concatemeric Consensus (R2C2) method (1). The aim is to make elongated cDNA via rolling circle amplification using cDNA generated from the 10x Chromium 3' (or 5') single-cell RNA-seq assay to increase the accuracy of downstream sequencing on an Oxford Nanopore Technologies sequencing platform. The major modification from the original protocol is to add an additional cDNA re-amplification step (see section "10x cDNA re-amplification") to enrich for fragments with the proper sequence (poly(T) at 3' and TSO at 5') at both ends, which is essential in circularization with the 10x Splint fragment.
Image Attribution
Xian Adiconis
Materials
Oligos
ABC
Oligo NameVendorSequence
10X_UMI_Splint_ForwardIDT5'-AGATCGGAAGAGCGTCGTGTAGTGAGGCTGATGAGTTCCATANNNNNTATATNNNNNATCACTACTTAGTTTTTTGATAGCTTCAAGCCAGAGTTGTCTTTTTCTCTTTGCTGGCAGTAAAAG -3'
10X_UMI_Splint_ReverseIDT5'-CTCTGCGTTGATACCACTGCTTAAAGGGATATTTTCGATCGCNNNNNATATANNNNNTTAGTGCATTTGATCCTTTTACTCCTCCTAAAGAACAACCTGACCCAGCAAAAGGTACACAATACTTTTACTGCCAGCAAAGAG -3'
PCR_primer1IDT5'- CTACACGACGCTCTTCCGATCT -3'
PCR_primer2IDT5'- AAGCAGTGGTATCAACGCAGAGT -3'
Reagents
ABC
ReagentsVendorPart Number
KAPA HiFi HotStart ReadyMixKAPA BioscienceKK2602
NEBNext® High-Fidelity 2X PCR Master MixNew England BiolabsM0541S
Select-a-Size DNA Clean & Concentrator KitZymo ResearchD4080
ProNex® Size-Selective Purification System, 10mlPromegaNG2001
NEBuilder® HiFi DNA Assembly Master MixNew England BiolabsE2621S
NEB Buffer 2New England BiolabsB7002S
Exonuclease I (20 U/µl)New England BiolabsM0293S
Exonuclease III (100 U/µl)New England BiolabsM0206S
Lambda Exonuclease (5 U/µl)New England BiolabsM0262S
Agencourt AMPure® XP SPRI beads, 60 mlBeckman Coulter GenomicsA63881
phi29 DNA Polymerase (10 U/µl)New England BiolabsM0269S
Deoxynucleotide (dNTP) Solution Mix (10mM)New England BiolabsN0447L
Exo-Resistant Random Primer (10 µM)Thermo Fisher ScientificSO181
T7 Endonuclease I (10 U/µl)New England BiolabsM0302S
Safety warnings
For hazard information and safety warnings, please refer to the MSDSs (Material Safety Data Sheets).
Splint generation
Splint generation
2h
2h
Prepare the following on ice
AB
1X (µl)
KAPA HiFi HotStart ReadyMix25
H2O23
10x_UMI_Splint_forward (100 µM)1
10x_UMI_Splint_reverse (100 µM)1
Total50
10m
Run the following program
Thermocycler Conditions: (Lid@Temperature105 °C , 50 µl)
Temperature95 °C , Duration00:03:00
followed by 1 cycle of:
Temperature98 °C , Duration00:01:00
Temperature62 °C , Duration00:01:00
Temperature72 °C , Duration00:06:00
then
Temperature4 °C , Duration00:00:00 hold

11m
Cleanup with Select-a-Size columns (Zymo) and a size cut-off of ~125 bp. Follow the Select-a-Size cleanup protocol for single-size selection, but in the buffer preparation add Amount85 µL of 100% ethanol to Amount500 µL of Select-a-Size DNA binding buffer. Elute in Amount15 µL DNA elution buffer (from the kit). QC with 1/5x dilution for Quant-it (Thermo Fisher Scientific) and 1/50x dilution for BioAnalyzer DNA HS assay (Agilent).
Label this product as "10x Splint", store at Temperature-20 °C for later use.

1h 30m
10x cDNA re-amplification
10x cDNA re-amplification
2h
2h
Enrichment PCR
Prepare the follow reaction mix on ice
AB
1X (µl)
NEBNext® High-Fidelity 2X PCR Master Mix50
12 μM PCR Primer 12
12 μM PCR Primer 22
20 ng 10x cDNA in H2O46
Total100
10m
Run the following program
Thermocycler Conditions: (Lid@Temperature105 °C , 100 µl)
Temperature98 °C , Duration00:00:45
followed by 10 cycle of:
Temperature98 °C , Duration00:00:10
Temperature62 °C , Duration00:00:15
Temperature72 °C , Duration00:03:00
then
Temperature72 °C , Duration00:05:00
Temperature4 °C , Duration00:00:00 hold
9m 10s
cDNA purification
1h 30m
Add Amount95 µL of resuspended, room-temperature ProNex beads to the PCR mix. Pipette mix 10 times. Perform a quick spin to collect all liquid from the sides of the tube.
Incubate sample on bench top for Duration00:05:00 at TemperatureRoom temperature .
5m
Place the tube on a magnetic stand to separate the beads from the supernatant. Use a P200 pipettor to remove the supernatant.
Wash 2 times with Amount200 µL of freshly prepared 80% ethanol. After removal of the second wash of Amount200 µL of ethanol, spin the tube strip briefly, return to magnetic stand and remove residual ethanol with a P20 pipettor. Do not let the beads dry out.
  • Remove the tube from the magnetic stand. Immediately add Amount15 µL of buffer EB (10 mM Tris-HCl, pH 8.5) and pipette mix to resuspend. Perform a quick spin to collect all liquid from the sides of the tube. Place at TemperatureRoom temperature for Duration00:05:00 to elute the DNA from the beads.
5m
Place the tube on a magnetic stand to separate the beads from the supernatant. Transfer the eluted cDNA samples to a new tube.
QC with 1/5x dilution for Quant-it and BioAnalyzer DNA HS assay. Store the remaining product at Temperature-20 °C for later use.
cDNA circularization
cDNA circularization
8h
8h
Circularization

Prepare the following mix
AB
1X (µl)
10x Splint (200 ng)2
Re-amplified cDNA (200 ng)8
NEBuilder® HiFi DNA Assembly Master Mix10
Total20
Incubate @Temperature50 °C for Duration01:00:00
Then add the following mix
AB
1X (µl)
NEB Buffer 25
H2O16
Exonuclease I (20 U/µl)3
Exonuclease III (100 U/µl)3
Lambda Exonuclease (5 U/µl)3
Total30
Incubate @Temperature37 °C for Duration06:00:00 , then @Temperature80 °C for Duration00:20:00
Cleanup the reaction with Amount40 µL SPRI beads (0.8x)

7h 20m
Circularization product purification
30m
Add Amount40 µL (0.8x) of resuspended, room-temperature AMPure XP SPRI beads to the reaction mix. Pipette mix 10 times. Perform a quick spin to collect all liquid from the sides of the tube.

Incubate sample on bench top for Duration00:05:00 at TemperatureRoom temperature .
5m
Place the tube on a magnetic stand to separate the beads from the supernatant. Use a P200 pipettor to remove the supernatant.
Wash 2 times with Amount200 µL of freshly prepared 80% ethanol. After removal of the second wash of Amount200 µL of ethanol, spin the tube strip briefly, return to magnetic stand and remove residual ethanol with a P20 pipettor. Do not let the beads dry out.

Remove the tube from the magnetic stand. Immediately add Amount30 µL of H2O and pipette mix to resuspend. Perform a quick spin to collect all liquid from the sides of the tube. Place at TemperatureRoom temperature for Duration00:05:00 to elute the cDNA from the beads.
5m
Place the tube on a magnetic stand to separate the beads from the supernatant. Transfer the eluted cDNA samples to a new tube.
Rolling circle amplification
Rolling circle amplification
16h
16h
Prepare the following mix, then split into 3 reaction wells of Amount50 µL each.
AB
1X (µl)
phi29 Buffer (10x)15
phi29 DNA Polymerase (10 U/µl)3
dNTP (10 mM)7.5
Exo-Resistant Random Primer (10 µM)7.5
Circularized cDNA30
H2O87
Total150

Incubate in a thermocycler @Temperature30 °C for DurationOvernight

From this point on, be really careful with the DNA since it will shear pretty easily. Do not pipet up and down and try not to vortex.
Critical
SPRI clean and T7 endonuclease treatment
Pool all reactions and adjust volume to Amount300 µL with H2O. AddAmount150 µL Amount150 µL SPRI beads (0.5x) to your DNA and leave on a rotator for 5 minutes to mix. If not homogeneous, flick the tube to mix.
Notes: After adding the AMPure XP SPRI beads and mixing by inverting the tubes, there's uneven distribution of the beads, mostly the sign of longer cDNA strand.
Place on a magnet stand until a complete pellet forms, wash twice with Amount500 µL 70% ethanol. After the ethanol removal, add the following mix to re-suspend the beads.
AB
1X (µl)
NEB Buffer 210
T7 Endonuclease I (10 U/µl)5
H2O90
Total105
Incubate on a thermal shaker at Temperature37 °C at 1000 RPM for Duration02:00:00 . Agitate the tube occasionally to help the solution homogenize.
Place on a magnet stand to pellet the beads. Recover the supernatant that contains the DNA to a new tube. Purify the DNA with 0.5x volume of AMPure XP SPRI beads, wash twice with Amount500 µL 70% ethanol. Elute in Amount20 µL H2O.
QC with Quant-it for concentration, run BioAnalyzer DNA 12000 assay (Agilent) or 1% agarose gel to visualize the size distribution. The majority of the fragments should be > 10kb.


Rolling circle amplified DNA trace with BioAnalyzer DNA 12000 assay

Rolling circle amplified DNA on a 1% agarose gel; the top band of the ladder is 10kb.
The elongated cDNA is now ready for downstream Oxford Nanopore Technologies (ONT) library prep.
2h
Protocol references
1. Volden R, Vollmers C. Single-cell isoform analysis in human immune cells. Genome Biol. 2022;23(1):47.