Feb 03, 2025
qPCR assay for detecting Triturus cristatus
- Alexander Eiler1,
- Omneya Osman2
- 1Alex private;
- 2IVL Swedish research Institute
- eDNAsolutionsTech. support phone: +0700264843 email: omneya@ednasolutions.se
Protocol Citation: Alexander Eiler, Omneya Osman 2025. qPCR assay for detecting Triturus cristatus. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ldpbo7l5b/v1
Manuscript citation:
https://doi.org/10.1111/j.1365-294X.2011.05418.x
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 07, 2022
Last Modified: February 03, 2025
Protocol Integer ID: 69683
Disclaimer
Use at own risk!
Abstract
eDNA assay to detect great crested newt Triturus cristatus
Guidelines
Laboratory work space and equipment were sterilized by UV-light and DNase solution and 70% ethanol. Filter pipet tips were used in all steps of the laboratory work.
Negative controls of DNase/RNase free water were used in each qPCR assay.
Materials
UltraPure™ DEPC-treated WaterThermo FisherCatalog #10813012
SsoAdvanced Universal Probes SupermixBio-rad LaboratoriesCatalog #172-5280
Safety warnings
Handling high concentration of positive controls was performed in a post-PCR room which is physically separated from the pre-PCR room to avoid contamination.
Always add your samples first and seal them before adding the serial dilutions of positive control (standard) at the end.
DNA extraction
DNA extraction
DNA extraction was performed using Qiagen DNeasy power water sterivex kit. The quality of the extracted DNA was estimated using Nanodrop. Qiagen DNeasy power water sterivex kit: https://www.qiagen.com/se/resources/resourcedetail?id=c5fe7d5f-070a-4ebe-ac04-4bbf05a13e91&lang=en
Internal control
When performing DNA extraction, it is often advantageous to have an exogenous source of DNA template that is spiked into the lysis buffer. This control DNA is then co-purified with the sample DNA and can be detected as a positive control for the extraction process.
Primers
| A | B | C | D | |
| Primer/probe | Sequence | Fragment | Gene | |
| TCCBL (fwd) | CGTAAACTACGGCTGACTAGTACGAA | 81 | cyt-b | |
| TCCBR (rev) | CCGATGTGTATGTAGATGCAAACA | |||
| TCCB.probe | CATCCACGCTAACGGAGCCTCGC |
Standard dilution
DNA of Triturus cristatus was serially diluted from 1e2-1e-4 for qPCR experiment.
Triturus vulagaris was also tested as related species.
PCR mixture
| A | B | C | D | |
| Stock solution | Working solution | Final concetration (μl) | ||
| TaqMan Environmental Mastermix 2 | 2X | 1X | 10 | |
| Forward primer | 10 μM | 0.4 μM | 0.8 | |
| Reverse primer | 10 μM | 0.4 μM | 0.8 | |
| TaqMan probe | 2.5 μM | 0.1 μM | 0.2 | |
| Internal control (IC) primer/probe mix | 1 | |||
| IC-DNA | 0.5 | |||
| Water | 3.7 | |||
| Template | 3 | |||
| Total | 20 |
3 µl of RNase/DNase free water was used for negative controls
Amplification conditions
| A | B | C | D | |
| Step | Time | Temp (℃) | ||
| Preheat | 5 min | 50 | ||
| Enzyme activation | 10 min | 95 | ||
| 50 cycles | Denaturation | 30 s | 95 | |
| Extention and Data collection | 1 min | 60 |
qPCR was performed in BioRad qPCR machine CFX96.
Expected result
Internal PCR control. The Cq value obtained with the internal control will vary significantly depending on the extraction efficiency, the quantity of DNA added to the PCR reaction, and the individual machine settings.
Cq values of 27±3 are within the normal range.