Oct 24, 2024
Protocol for Detection and Genotyping of Lumpy Skin Disease Virus (LSDV) using Oxford Nanopore Sequencing
- Manali Bajpai1,2,
- Ajinkya Khilari1,2,
- Bhagyashree Likhitkar1,2,
- Dhanasekaran Shanmugam1,2
- 1Biochemical Sciences Division, CSIR- National Chemical Laboratory, Pune - 411008, India;
- 2Academy of Scientific and Innovative Research (AcSIR), Ghaziabad - 201002, India
- Manali Bajpai: Equal contributing author;
- Ajinkya Khilari: Equal contributing author
- Dhanasekaran Shanmugam: Corresponding author
Protocol Citation: Manali Bajpai, Ajinkya Khilari, Bhagyashree Likhitkar, Dhanasekaran Shanmugam 2024. Protocol for Detection and Genotyping of Lumpy Skin Disease Virus (LSDV) using Oxford Nanopore Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvm3drbl3p/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol, and it's working.
Created: March 14, 2024
Last Modified: October 24, 2024
Protocol Integer ID: 96712
Keywords: Lumpy Skin Disease Virus, Multiplex Nested PCR, Multiplex whole genome amplification, Oxford Nanopore Sequencing, detection, genotyping
Funders Acknowledgement:
Bill & Melinda Gates Foundation
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
The protocol relates to nested multiplex PCR-based detection method for disease surveillance. In particular, the present disclosure provides a nested multiplex detection primer panel (NMDPP) to detect Lumpy Skin Disease Virus (LSDV) from the cattle sample. The present invention also provides a rapid, sensitive, and improved nested multiplex polymerase chain reaction employing said primer panel for detecting LSDV and its variants. The present disclosure relates to whole genome multiplex PCR-based genotyping method for viral variant studies. In particular, the present disclosure provides a multiplex primer panel (LSDV_WGSPP_3.5) to PCR amplify and genotype Lumpy Skin Disease Virus (LSDV) from the given cattle sample.
Guidelines
You must have read, understood, and follow the health and safety instructions before performing the protocol.
- Sample Collection: Use sterile swabs and tubes to collect nasal and skin samples. Properly restrain animals during sample collection with assistance from trained personnel. Store collected samples in tubes containing 1X PBS and ensure they are properly submerged. Label sample tubes with cryo-resistant markers or barcoded stickers.
- Transportation and Storage: Transport samples at 4°C using cooler boxes with ice packs. Store samples at -80°C until DNA isolation. Ensure samples are properly sealed to prevent spillage and cross-contamination.
- DNA Isolation: Follow the manufacturer’s protocol for DNA isolation instruments (e.g., MagNA Pure 96). Label samples accurately using the same tracking number for consistency. Store isolated DNA at -20°C until further use.
- DNA Quantification: Use Qubit and Nanodrop methods for DNA quantification to ensure quality.
- PCR Setup: Store primer pools and DNA samples at -20°C after use to maintain stability.
- Bead Purification: Use freshly prepared 80% ethanol for washing beads. Mix beads by pipetting gently to avoid DNA shear. Keep the sample on a magnetic stand during washing and elution steps.
- Oxford Nanopore Sequencing: Use at least 50 ng of high-quality DNA for sequencing. Follow Oxford Nanopore Technologies’ instructions for flow cell priming and sample loading. To preserve sequencing quality, avoid introducing air bubbles during flow cell priming and sample loading. Ensure all software and tools are updated before starting the analysis.
Following these guidelines, you can ensure a reliable and reproducible protocol for detecting and genotyping LSDV using Oxford Nanopore Sequencing.
Materials
- GeneRuler 100 bp Plus DNA Ladder, ready-to-useThermo Fisher ScientificCatalog #SM0323
- Rapid Barcoding Kit 96 V14 (SQK- RBK114.96)Oxford Nanopore TechnologiesCatalog #SQK- RBK114.96
- Qubit FluorometerInvitrogen - Thermo FisherCatalog #Q32866
- AMPure XPBechman CoulterCatalog #A63882
- RepliQa HiFi ToughMix‱ VWR InternationalCatalog #95200-500
- EmeraldAmp‱ GT PCR Master MixTakara Bio Inc.Catalog #RR310A
- 1X TAE Buffer
- Invitrogen‱ UltraPure‱ AgaroseInvitrogen - Thermo FisherCatalog #16500100
- Ethidium bromide 10 mg/mlMerck MilliporeSigma (Sigma-Aldrich)Catalog #E1510
- MagNA Pure 96 DNA and Viral NA LV KitRocheCatalog #06 374 891 001
- Qubit‱ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
- Qubit‱ Assay TubesInvitrogen - Thermo FisherCatalog #Q32856
Protocol materials
Ethidium bromide 10 mg/mlMerck MilliporeSigma (Sigma-Aldrich)Catalog #E1510
In 2 steps
Rapid Barcoding Kit 96 V14 (SQK- RBK114.96)Oxford Nanopore TechnologiesCatalog #SQK- RBK114.96
Step 14.6
Qubit FluorometerInvitrogen - Thermo FisherCatalog #Q32866
Step 5.1
RepliQa HiFi ToughMix® VWR InternationalCatalog #95200-500
Step 11
Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
Step 5.1
Qubit™ Assay TubesInvitrogen - Thermo FisherCatalog #Q32856
Step 5.1
AMPure XPBechman CoulterCatalog #A63882
In 2 steps
EmeraldAmp® GT PCR Master MixTakara Bio Inc.Catalog #RR310A
Step 7
1X TAE Buffer
In 2 steps
Invitrogen™ UltraPure™ AgaroseInvitrogen - Thermo FisherCatalog #16500100
In 2 steps
GeneRuler 100 bp Plus DNA Ladder, ready-to-useThermo Fisher ScientificCatalog #SM0323
In 2 steps
MagNA Pure 96 DNA and Viral NA LV KitRocheCatalog #06 374 891 001
Step 4
Safety warnings
This protocol does not require any hazardous substances or infectious agents. However, it includes DNA extracted from cattle skin swab and nasal swab samples.
You must always wear safety equipment, including lab coats, gloves, and safety goggles, when handling chemicals and biological agents. While the extracted DNA does not include any infectious agents, treat them carefully. Do not remove them from the laboratory. Use a dedicated notebook and pen to make notes during the experiments. Do not put anything into your mouth while in the laboratory. Wash your hands each time you leave the laboratory.
- Biohazard Risk: Handling samples from infected animals can pose biohazard risks. Use appropriate personal protective equipment (PPE) such as gloves, lab coats, and masks to prevent exposure.
- Cross-Contamination: Always change gloves when handling each sample to avoid cross-contamination. Work aseptically to prevent contamination between samples during collection, processing, and PCR setup.
- Sample Degradation: Improper storage or temperature fluctuations during transportation can lead to sample degradation, affecting DNA quality. Maintain a consistent temperature of 4°C during transport and store samples at -80°C until further processing.
- DNA Integrity: Poor quality or degraded DNA (e.g., A260/280 ratio below 1.8) can lead to inaccurate PCR results. Verify DNA integrity before proceeding to PCR or sequencing.
- Primer Handling: Avoid cross-mixing between outer and inner primer pools, which can lead to non-specific amplification. Thaw primer pools on ice and gently vortex them before use to ensure even mixing.
- Bead Purification: Avoid over-drying beads during purification, as this can result in loss of DNA. Handle beads gently with pipetting to avoid DNA shearing, which can compromise sequencing quality.
- Flow Cell Handling: Introducing air bubbles during flow cell priming and loading can result in pore loss, reducing sequencing efficiency. Follow pipetting instructions carefully and avoid using excessive force to prevent damage to the flow cell.
- Chemical Handling: Handle ethidium bromide and other staining agents used in gel electrophoresis cautiously, as they are toxic and mutagenic. Dispose of all hazardous materials following appropriate safety protocols.
- Instrument Usage: Follow the manufacturer’s guidelines strictly for each device.
Adhering to these warnings will help ensure safety and accuracy during the detection and genotyping of LSDV.
Ethics statement
This protocol for the detection and genotyping of Lumpy Skin Disease Virus (LSDV) involves the collection of biological samples from cattle, which requires adherence to ethical guidelines. Prior to commencing this protocol, it is essential to obtain approval from the user's Institutional Animal Care and Use Committee (IACUC) or an equivalent ethics committee(s). This approval ensures that all animal handling, sample collection, and transportation procedures are conducted to minimise stress and discomfort to the animals.
The protocol must be carried out by the principles outlined in the IACUC-approved guidelines, including proper restraint techniques, the use of trained personnel for sample collection, and maintaining sterile conditions to ensure the well-being of the animals. This commitment to ethical standards ensures the research's integrity and the animals' welfare.
Before start
- Personal Protective Equipment (PPE): Gather lab coats, gloves, masks, and eye protection for all personnel handling samples to ensure biosafety and prevent contamination.
- Sample Collection Materials: Prepare sterile flocked swabs and 15 mL collection tubes containing 400 µL of 1X PBS. Label tubes using cryo-resistant permanent markers or cryo-compatible barcoded stickers. Arrange cooler boxes with ice packs for transporting samples at 4°C.
- DNA Isolation Equipment and Reagents: Set up the DNA isolation instrument (e.g., MagNA Pure 96) according to the manufacturer's protocol. Ensure the DNA and Viral NA LV Kit (Roche) or other chosen kits for DNA extraction are available.
- PCR Setup Materials: Prepare and label outer and inner primer pools for nested PCR. Thaw and mix the primers on ice before use. Stock up on EmeraldAmp‱ GT PCR Master Mix and nuclease-free water for PCR reactions. Calibrate thermal cyclers and ensure they are ready for use.
- Reagents for DNA Quantification: Prepare Qubit‱ dsDNA HS Assay Kit, Qubit Fluorometer, and Nanodrop instrument. Calibrate the Qubit Fluorometer and Nanodrop for accurate readings. Ensure all reagents for Qubit and Nanodrop assays are thawed and ready.
- Gel Electrophoresis Setup: Prepare 1% agarose gel, 1X TAE buffer, ethidium bromide or other DNA stains, and a DNA ladder.
- Bead Purification Materials: Prepare AMPure XP beads and freshly prepared 80% ethanol for DNA purification. Set up a magnetic stand for bead separation and have pipettes ready to handle beads.
- Sequencing Kit and Flow Cells: Ensure the availability of the Oxford Nanopore SQK-RBK114.96 kit and flow cells (version 10). Dilute rapid adapters according to the kit instructions. Verify that the MinKNOW software is installed and up to date on the sequencing computer.
- General Laboratory Setup: Clean and disinfect all work surfaces to minimize contamination risk. Arrange all reagents, pipettes, tubes, and equipment in a sterile environment. Verify that all instruments, including the centrifuge, pipettes, and vortex mixers, are calibrated and functioning properly.
Having all these preparations in place ensures a smooth workflow and minimizes the risk of errors during the protocol execution for LSDV detection and genotyping.
1. Sample Collection and Storage
1. Sample Collection and Storage
10m
10m
For nasal swab samples
This method can be used for sample collection from symptomatic as well as asymptomatic cattle.
- Insert flocked swab (HiMedia, India) inside the nostril of the cattle to take the mucus sample
- Remove the swab carefully and insert the swab inside 15 ml sample collection tubes containing400 µL of 1X PBS
- Make sure that the swab head containing the sample is fully submerged in 1X PBS
- The tube can be marked either with cryo-resistant permanent marker or preferably using cryo-compatible barcoded sticker
Precautions
- Use protective clothing and work aseptically avoiding cross-contamination between samples
- Change gloves after each sample collection
- Nasal swabs must be collected using sterile swabs and placed into sterile tubes containing 1X PBS for transportation
# NOTE: Animal has to be properly restrained with help from trained personnel for nasal swab collection
5m
For skin scab samples
This method can be used for sample collection from symptomatic cattle which have open wounds on skin nodules.
- Find the lesion on the cattle and clean the area identified for sample collection by gently spraying sterile water
- Place a swab on the wound and rub gently to remove the top layer including any dirt that may be on the wound
- Take fresh swab and rub to collect the oozing fluid from the lesion
- Place the swab inside 15 ml sample collection tubes containing 400 µL of 1X PBS
- Make sure that the swab head containing the sample is fully submerged in 1X PBS
- The tube can be marked either with cryo-resistant permanent marker or preferably using cryo-compatible barcoded sticker
Precautions
- Use protective clothing and work aseptically avoiding cross-contamination between samples
- Change gloves after each sample collection
- Collected skin swab samples must be placed into sterile tubes containing 1X PBS for transportation
5m
Transportation and storage
The samples must be transported to the laboratory in cooler boxes maintaining 4 °C using ice packs.
Store the samples in -80 °C until the time it is processed for DNA isolation.
Precautions
- Samples must be properly sealed to avoid spillage and cross contamination
- It is must to maintain the temperature at 4 °C while transportation to avoid sample degradation
- Make sure that sample containing tubes are properly marked in a permanent manner
2. DNA Isolation, Quantification and Storage
2. DNA Isolation, Quantification and Storage
3h
3h
DNA isolation
- # NOTE: Multiple protocols and kits are available for viral DNA isolation from samples obtained using swabs. The method and protocol given here have been optimised using the Roche MagNA Pure 96 Instrument and compatible kits. Other DNA isolation instruments and methods can be used as per users' choice.
- Isolate DNA using MagNA Pure 96 DNA and Viral NA LV KitRocheCatalog #06 374 891 001 as per manufacturer's protocol of MagNA Pure 96 Instrument
Equipment
MagNA Pure 96 Instrument
NAME
Automated nucleic acid purification
TYPE
Roche Molecular Systems, Inc
BRAND
06541089001
SKU
- Take proper precautions as per instrument manual while DNA isolation
- Label the samples properly using the same tracking number/barcode as previously used on the sample collection vials. This is critical for sample tracking and linking to metadata
3h
Qualitative and Quantitative Analysis of DNA
- DNA quantification must be carried out using Qubit method as given in 5.1
- Purity and integrity of DNA samples can be determined using a Nanodrop instrument as given in 5.2
10m
Reagents used for DNA quantification using Qubit method -
- Qubit™ dsDNA HS Assay KitInvitrogen - Thermo FisherCatalog #Q32851
- Qubit FluorometerInvitrogen - Thermo FisherCatalog #Q32866
- Qubit™ Assay TubesInvitrogen - Thermo FisherCatalog #Q32856
DNA quantification steps -
# NOTE: Select the option for DNA quantification in the fluorometer
- Take 190 µL of HS buffer and 10 µL of standards 1 and 2 in separate assay tubes labelled as S1 and S2 respectively
- For each sample, take 199 µL of HS buffer in assay tube and add 1 µL of the sample to be quantified
- The assay tubes must be vortexed to mix the contents and readings are taken using the fluorometer
- # NOTE: DNA concentration of 10ng/µL or above is desirable for further steps
5m
DNA quantification using Nanodrop instrument -
# NOTE: Select the option for DNA quantification in the Nanodrop instrument
- Set the blank twice with 1 µL of blank reagent
- Take the readings using 1 µL of each sample
- Reading must be taken in ng/µL
- A260/280 must be 1.8 and A260/230 must be between 2 to 2.2 for good quality DNA samples
# NOTE: For samples which do not have the required quality and quantity of DNA the extraction can be repeated
5m
Storage
- After isolation and quantification store the samples in-20 °C until further use
24w
3. Nested PCR using Multiplex Diagnostic Primer Panel (LSDV_NMDPP)
3. Nested PCR using Multiplex Diagnostic Primer Panel (LSDV_NMDPP)
6h 30m
6h 30m
For the detection of the Lumpy Skin Disease Virus (LSDV), the following nested multiplex PCR protocol is used.
- Three distinct LSDV genomic loci are targeted by nested PCR. The PCRs are multiplexed in a single reaction.
- The primers for the nested PCRs are designed using the reference genome NC_003027.1 for Lumpy skin disease virus NI-2490 available in NCBI
- The PCR mix EmeraldAmp® GT PCR Master MixTakara Bio Inc.Catalog #RR310A is recommended for the nested PCRs
- Details of nested PCR primer sequences are mentioned below in Table 01
| A | B | C | D | E | F | G | H | I | |
| Genomic Position | |||||||||
| S. No. | Name | Pool | Sequence | Length | Tm (⁰C) | % GC content | Start | End | |
| 1 | LSDV_NMDPP_1 | Outer | TACATACATTTCAAGTACTAAAGAGAAGGAA | 31 | 56.2 | 29 | 14452 | 14482 | |
| 2 | LSDV_NMDPP_2 | Outer | ATGTCAACAACATTTTTGCTATTCAATG | 28 | 55.9 | 29 | 13516 | 13543 | |
| 3 | LSDV_NMDPP_3 | Outer | AACGAGTTGTTAGTCATTTGAGATAC | 26 | 55.0 | 35 | 80177 | 80202 | |
| 4 | LSDV_NMDPP_4 | Outer | ACCATTCCAGAATTAAGTTTGATAATAAAC | 30 | 54.8 | 27 | 79082 | 79111 | |
| 5 | LSDV_NMDPP_5 | Outer | TAAACATAGACTCTTCTTTCGGTAGAC | 27 | 55.8 | 37 | 132962 | 132988 | |
| 6 | LSDV_NMDPP_6 | Outer | GTTCGGTTTCATATTTTTAGCATATTCAC | 29 | 55.5 | 31 | 131714 | 131742 | |
| 7 | LSDV_NMDPP_7 | Inner | CAACATCTAACGAAAAAACATTATCGTC | 28 | 55.3 | 32 | 13863 | 13890 | |
| 8 | LSDV_NMDPP_8 | Inner | AATATTCTTTTCCGGATCATTCGC | 24 | 55.5 | 38 | 14303 | 14326 | |
| 9 | LSDV_NMDPP_9 | Inner | AAGAACATAATCTTGTATCATCGCC | 25 | 55.0 | 36 | 79310 | 79334 | |
| 10 | LSDV_NMDPP_10 | Inner | ACTGTGACCATTGATCCGTTATC | 23 | 56.3 | 43 | 79756 | 79778 | |
| 11 | LSDV_NMDPP_11 | Inner | GGCTATACGCATAGTGATATTAAAGC | 26 | 55.3 | 38 | 132069 | 132094 | |
| 12 | LSDV_NMDPP_12 | Inner | CATAATCTGGAATAGAATCGTATTGTAATG | 30 | 54.2 | 30 | 132475 | 132504 | |
Table 01 - Details of LSDV_NMDPP primer set
- For individual primers, 100µmolar stocks are prepared in Nuclease Free Water and stored in -20 °C
- For multiplexed nested PCR reaction, the outer and inner primer pools are prepared by separately mixing each of the outer primers in one pool and each of the inner primers in the other pool. The primer pools can be stored in -20 °C
- At the time of setting up the PCR reactions, the outer and inner primer pools are diluted 10 times (10µmolar primer mix) with Nuclease Free Water and added to the reactions as given in Table 02 and Table 03
# NOTE: Primer pools can be ordered directly from the manufacturer as ready-to-use 10µmolar primer mix.
Precautions
- Make sure to avoid cross-mixing of primers between the outer and inner primer pools
- Primer mix and DNA samples must be thawed on ice
- Gently mix primer pools (vortexing) and DNA samples (flicking) and spin down before use
- After every use, store primer mix and DNA samples in -20 °C to prevent degradation
Nested PCR setup using LSDV_NMDPP outer primer mix
# NOTE: For nested PCR, the first PCR reaction is carried out using outer primer pool and the second PCR reaction is carried out using inner primer pool
- The composition of the PCR reaction mix using outer primer pool is given in Table 02
| A | B | |
| EmeraldAmp® GT PCR Master Mix | 12.5 μL | |
| LSDV_NMDPP outer primer mix | 3.75 μL | |
| Template DNA | 50ng | |
| Nuclease Free Water | Makeup volume to 25 μL |
Table 02 – PCR reaction mix composition using LSDV_NMDPP outer primers
- PCR amplification conditions for outer primer pool reaction is given in Table 03
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial Denaturation | 94 ⁰C | 5 min | X 1 cycle | |
| Denaturation | 94 ⁰C | 30 sec | X 25 cycles | |
| Annealing | 50 ⁰C | 30 sec | ||
| Extension | 72 ⁰C | 2 min | ||
| Final Extension | 72 ⁰C | 4 min | X 1 cycle | |
| Hold | 4 ⁰C | ∞ |
Table 03 – PCR conditions for reaction using LSDV_NMDPP outer primers
- The product of the first PCR using outer primer pool will amplify ~1kb region from LSDV genome
3h
Nested PCR setup using LSDV_NMDPP inner primers
- The composition of the PCR reaction mix using inner primer pool is given in Table 04
| A | B | |
| EmeraldAmp® GT PCR Master Mix | 12.5 μL | |
| LSDV_NMDPP inner primer mix | 3.75 μL | |
| Template DNA | 5 μL of outer primer PCR product | |
| Nuclease Free Water | Makeup volume to 25 μL |
Table 04 – PCR reaction mix composition using LSDV_NMDPP inner primers
- PCR amplification conditions for inner primer pool reaction is given in Table 05
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial Denaturation | 94 ⁰C | 5 min | X 1 cycle | |
| Denaturation | 94 ⁰C | 30 sec | X 30 cycles | |
| Annealing | 55 ⁰C | 30 sec | ||
| Extension | 72 ⁰C | 1 min 15 sec | ||
| Final Extension | 72 ⁰C | 3 min | X 1 cycle | |
| Hold | 4 ⁰C | ∞ |
Table 05 – PCR conditions for reaction using LSDV_NMDPP inner primers
- The product of the second PCR using inner primer pool will amplify ~0.5kb region from the target region of LSDV genome
2h 30m
Analysis of PCR products by agarose gel electrophoresis
The second PCR product is analyzed using 1% agarose gel as followed -
- Reagents required are -
Invitrogen™ UltraPure™ AgaroseInvitrogen - Thermo FisherCatalog #16500100
GeneRuler 100 bp Plus DNA Ladder, ready-to-useThermo Fisher ScientificCatalog #SM0323
Ethidium bromide 10 mg/mlMerck MilliporeSigma (Sigma-Aldrich)Catalog #E1510
1X TAE BufferContributed by users
- 5 µL of PCR product is loaded on the agarose gel and electrophoresis is carried out at 120mV for 00:30:00
- Samples are considered positive for LSDV presence if 0.5kb band is detected
- Positive samples are processed for whole genome amplification of LSDV using LSDV_WGSPP_3.5 primer panel
30m
4. Multiplexed PCR Amplification using LSDV Whole Genome Sequencing Primer Panel 3.5 (LSDV_WGSPP_3.5)
4. Multiplexed PCR Amplification using LSDV Whole Genome Sequencing Primer Panel 3.5 (LSDV_WGSPP_3.5)
5h
5h
PCR amplification of whole genome of LSDV from field samples is carried out for genotyping. The PCR amplification of overlapping ~3.5kb fragments is done in multiplexed manner.
- The PCR primers for the whole genome amplication of LSDV were designed using the reference genome NC_003027.1 for Lumpy skin disease virus NI-2490 available in NCBI using PrimalScheme
- A total of 48 primer pairs were designed to cover the entire LSDV genome and each PCR product is ~3.5kb in size with ~0.5kb overlap between adjacent PCR fragments
- The LSDV_WGSPP_3.5 primer set is divided into pool A and pool B such that adjacent amplicons are in different pools. The details of the entire primer set is given in Table 06
| A | B | C | D | E | F | G | H | I | |
| Genomic Position | |||||||||
| S. No. | Primer Name | Pool | Primer Sequence | Size | % GC Content | Tm | Start | End | |
| 1 | LSDV_WGSPP_1_F | A | AGTGCTGATTTCACTAGCGAAATATC | 26 | 38.46 | 60.23 | 286 | 311 | |
| 2 | LSDV_WGSPP_1_R | A | ACGTAGTTCGATGCTATTTTTCCATTT | 27 | 33.33 | 60.64 | 3688 | 3714 | |
| 3 | LSDV_WGSPP_2_F | B | GTTGTACCCTTGACGCGTTTTC | 22 | 50 | 60.78 | 3370 | 3391 | |
| 4 | LSDV_WGSPP_2_R | B | TGGAAGGGAGTGATAATACCAACAC | 25 | 44 | 60.73 | 6904 | 6928 | |
| 5 | LSDV_WGSPP_3_F | A | GAAGGGAATATGCAATCGCGGA | 22 | 50 | 61.31 | 6551 | 6572 | |
| 6 | LSDV_WGSPP_3_R | A | CAACTATGGTTTGGAAGCACTTGT | 24 | 41.67 | 60.28 | 10123 | 10146 | |
| 7 | LSDV_WGSPP_4_F | B | CACGGATTGTAGACAACCAAAGC | 23 | 47.83 | 60.61 | 9829 | 9851 | |
| 8 | LSDV_WGSPP_4_R | B | ACGATGTGTACGATGTTGCAGA | 22 | 45.45 | 60.53 | 13369 | 13390 | |
| 9 | LSDV_WGSPP_5_F | A | TCGTAAGTATTTATCCACACCACCT | 25 | 40 | 59.96 | 12732 | 12756 | |
| 10 | LSDV_WGSPP_5_R | A | GGCCGCCGTAACTAATGTGATT | 22 | 50 | 61.5 | 16323 | 16344 | |
| 11 | LSDV_WGSPP_6_F | B | TCGTCTTTAGATGGGGTAGAGTTACT | 26 | 42.31 | 61.03 | 15858 | 15883 | |
| 12 | LSDV_WGSPP_6_R | B | TTTTTACGCCATTGACCTCAATAGAT | 26 | 34.62 | 59.84 | 19340 | 19365 | |
| 13 | LSDV_WGSPP_7_F | A | AACCCCATTAAGAAAGCCACTCA | 23 | 43.48 | 60.44 | 18471 | 18493 | |
| 14 | LSDV_WGSPP_7_R | A | TGGAGCAGGATGTAGACTCGTT | 22 | 50 | 61.07 | 21932 | 21953 | |
| 15 | LSDV_WGSPP_8_F | B | TCCACCAGTTAAAGAGGCGTTG | 22 | 50 | 60.99 | 21566 | 21587 | |
| 16 | LSDV_WGSPP_8_R | B | CCGAGTTTCACATGTTGAAGTCAC | 24 | 45.83 | 60.86 | 25092 | 25115 | |
| 17 | LSDV_WGSPP_9_F | A | CGTCATCTGTGCAACGTTCATG | 22 | 50 | 60.9 | 24748 | 24769 | |
| 18 | LSDV_WGSPP_9_R | A | TGTGATCTTATACGTACGACAAATGGA | 27 | 37.04 | 60.9 | 28265 | 28291 | |
| 19 | LSDV_WGSPP_10_F | B | CACAAGTTCATACGAATCTACTTCATCAC | 29 | 37.93 | 61.25 | 27887 | 27915 | |
| 20 | LSDV_WGSPP_10_R | B | CGTCCTCTACACATTTCAAATGCG | 24 | 45.83 | 61.03 | 31263 | 31286 | |
| 21 | LSDV_WGSPP_11_F | A | TCCTGAGTACTTTGACCCAGACA | 23 | 47.83 | 60.95 | 30859 | 30881 | |
| 22 | LSDV_WGSPP_11_R | A | CTAGTCATAAAGGCGTTGGTGGT | 23 | 47.83 | 60.87 | 34408 | 34430 | |
| 23 | LSDV_WGSPP_12_F | B | TCCCAGTAGATAAAACTTCAGAAAACGA | 28 | 35.71 | 61.23 | 34167 | 34194 | |
| 24 | LSDV_WGSPP_12_R | B | ACCCAATGTTAGTATCCAACGCA | 23 | 43.48 | 60.56 | 37645 | 37667 | |
| 25 | LSDV_WGSPP_13_F | A | TGAGCATCCTAGGGAAATTGTCG | 23 | 47.83 | 60.69 | 37341 | 37363 | |
| 26 | LSDV_WGSPP_13_R | A | TCAGTTATTCAGACGAACATAACGACT | 27 | 37.04 | 61.06 | 40845 | 40871 | |
| 27 | LSDV_WGSPP_14_F | B | AGGCACATCAAACGTCGATTCT | 22 | 45.45 | 60.79 | 40602 | 40623 | |
| 28 | LSDV_WGSPP_14_R | B | TATCGTCCTCTAGTGTCGCTGT | 22 | 50 | 60.6 | 43968 | 43989 | |
| 29 | LSDV_WGSPP_15_F | A | CACTAAACGAATCACCAATTTCACTGA | 27 | 37.04 | 61.01 | 43735 | 43761 | |
| 30 | LSDV_WGSPP_15_R | A | GGTGGAATAATATCAAATCCCTAAATGGC | 29 | 37.93 | 61.38 | 47126 | 47154 | |
| 31 | LSDV_WGSPP_16_F | B | CTGTTACTGTTCCAGACAAAGAATCG | 26 | 42.31 | 60.78 | 46887 | 46912 | |
| 32 | LSDV_WGSPP_16_R | B | TCGAGCCCGATAACAGAAAACG | 22 | 50 | 61.16 | 50382 | 50403 | |
| 33 | LSDV_WGSPP_17_F | A | TTTTAGGCGTTACTCTTCCCACTT | 24 | 41.67 | 60.53 | 50050 | 50073 | |
| 34 | LSDV_WGSPP_17_R | A | CTCGCCTTTGTGGTTACATCCA | 22 | 50 | 61.05 | 53643 | 53664 | |
| 35 | LSDV_WGSPP_18_F | B | GAACAAACTGCTGAAGCCACTG | 22 | 50 | 60.72 | 53219 | 53240 | |
| 36 | LSDV_WGSPP_18_R | B | GGGTCTATATATGTTATCGGCTCTGG | 26 | 46.15 | 60.68 | 56692 | 56717 | |
| 37 | LSDV_WGSPP_19_F | A | TGATGAAACAGCTATGTCTGATATCGA | 27 | 37.04 | 60.75 | 56403 | 56429 | |
| 38 | LSDV_WGSPP_19_R | A | GCCATGTAAAAGATCAGATGCGC | 23 | 47.83 | 61.1 | 59783 | 59805 | |
| 39 | LSDV_WGSPP_20_F | B | CACTGGTATTGAAATATCTGATAGAGCAG | 29 | 37.93 | 60.52 | 59481 | 59509 | |
| 40 | LSDV_WGSPP_20_R | B | CTGGATTCAATTCTCCTAAACATACAAACT | 30 | 33.33 | 60.98 | 63002 | 63031 | |
| 41 | LSDV_WGSPP_21_F | A | GGCGGGACCCCTATAGGTATTAT | 23 | 52.17 | 60.89 | 62779 | 62801 | |
| 42 | LSDV_WGSPP_21_R | A | TTCCGTTACCACTTGCTTCCAG | 22 | 50 | 60.99 | 66143 | 66164 | |
| 43 | LSDV_WGSPP_22_F | B | GTGTTTCGCAATAGAACTTTTTGCC | 25 | 40 | 60.7 | 65656 | 65680 | |
| 44 | LSDV_WGSPP_22_R | B | CTTGAGATTTGCCACATTCCGC | 22 | 50 | 60.91 | 69137 | 69158 | |
| 45 | LSDV_WGSPP_23_F | A | CGAAGATCACGATGACGAAAACG | 23 | 47.83 | 60.78 | 68758 | 68780 | |
| 46 | LSDV_WGSPP_23_R | A | AAAATTCCCAACGGGCCTCTAG | 22 | 50 | 60.8 | 72357 | 72378 | |
| 47 | LSDV_WGSPP_24_F | B | ACGGGGATTTCCTAAAGAGCATG | 23 | 47.83 | 60.94 | 71977 | 71999 | |
| 48 | LSDV_WGSPP_24_R | B | TCGCGTCCCAACTATTCTTAGTG | 23 | 47.83 | 60.68 | 75609 | 75631 | |
| 49 | LSDV_WGSPP_25_F | A | TCTTCTCGGGAATGTGGTACGA | 22 | 50 | 61.06 | 75374 | 75395 | |
| 50 | LSDV_WGSPP_25_R | A | ACTGAGAAAAGGTATCCGGAATTGT | 25 | 40 | 60.67 | 78745 | 78769 | |
| 51 | LSDV_WGSPP_26_F | B | CAGAATATAATGGGTCACAAGGGACA | 26 | 42.31 | 61.08 | 78524 | 78549 | |
| 52 | LSDV_WGSPP_26_R | B | CTCGTGTGCAGATGGTATCCAA | 22 | 50 | 60.6 | 81934 | 81955 | |
| 53 | LSDV_WGSPP_27_F | A | TCATCATCAACTGTAGATTCGCCA | 24 | 41.67 | 60.46 | 81673 | 81696 | |
| 54 | LSDV_WGSPP_27_R | A | CGAACTCAGCTTTATCGGGTACA | 23 | 47.83 | 60.68 | 85138 | 85160 | |
| 55 | LSDV_WGSPP_28_F | B | CGTTTGGAGGCACCTCGATAAA | 22 | 50 | 61.11 | 84835 | 84856 | |
| 56 | LSDV_WGSPP_28_R | B | ACTTACTGAGGAAGCACCAATTGT | 24 | 41.67 | 60.77 | 88322 | 88345 | |
| 57 | LSDV_WGSPP_29_F | A | CCAGGTTTAGGAATCGAAACAAGTG | 25 | 44 | 60.71 | 88070 | 88094 | |
| 58 | LSDV_WGSPP_29_R | A | CGAATAACGGTAAGTCGATGACAAATT | 27 | 37.04 | 60.94 | 91524 | 91550 | |
| 59 | LSDV_WGSPP_30_F | B | ACTACAGCGTCAGATTTTAAAAACCAA | 27 | 33.33 | 60.69 | 91245 | 91271 | |
| 60 | LSDV_WGSPP_30_R | B | GCGCAGTTGATATCTTTAGGCATG | 24 | 45.83 | 60.92 | 94768 | 94791 | |
| 61 | LSDV_WGSPP_31_F | A | GCAAATGAGACAAAATTTCCATCTGTC | 27 | 37.04 | 60.63 | 94455 | 94481 | |
| 62 | LSDV_WGSPP_31_R | A | TCGCATGTGCTCCTCTATAGGT | 22 | 50 | 60.94 | 97950 | 97971 | |
| 63 | LSDV_WGSPP_32_F | B | GGCAAAAACGAAATCGCCATCA | 22 | 45.45 | 61.1 | 97725 | 97746 | |
| 64 | LSDV_WGSPP_32_R | B | GTGGCAACTTTGTCTCTGACGA | 22 | 50 | 61.24 | 101090 | 101111 | |
| 65 | LSDV_WGSPP_33_F | A | GGTCTTACAACCCTAATAAACTCAGAAC | 28 | 39.29 | 60.45 | 100652 | 100679 | |
| 66 | LSDV_WGSPP_33_R | A | TCCAGATCCGAGTTCCATCATAGT | 24 | 45.83 | 61.02 | 104207 | 104230 | |
| 67 | LSDV_WGSPP_34_F | B | GGCTTATCATGACTACAGAAAGCGA | 25 | 44 | 61.34 | 103923 | 103947 | |
| 68 | LSDV_WGSPP_34_R | B | AGTCGGTAGTATATGTGCCGGT | 22 | 50 | 60.93 | 107474 | 107495 | |
| 69 | LSDV_WGSPP_35_F | A | ACGCCACCAGAGTATTCACCTA | 22 | 50 | 61.07 | 107112 | 107133 | |
| 70 | LSDV_WGSPP_35_R | A | AGTGGCGAATACGGGCATTATG | 22 | 50 | 61.31 | 110742 | 110763 | |
| 71 | LSDV_WGSPP_36_F | B | ATGAATGCAAGGGGTGTGAAGG | 22 | 50 | 61.33 | 110280 | 110301 | |
| 72 | LSDV_WGSPP_36_R | B | AACTCAGATTCAGTATCGTCGTCAC | 25 | 44 | 61.05 | 113730 | 113754 | |
| 73 | LSDV_WGSPP_37_F | A | CAGCATTCGCAGGTTCCACTAT | 22 | 50 | 61.18 | 113502 | 113523 | |
| 74 | LSDV_WGSPP_37_R | A | GCTTTATTAAAAATAACCATTACCCCACC | 29 | 34.48 | 60.37 | 116973 | 117001 | |
| 75 | LSDV_WGSPP_38_F | B | TGCACAAAAATAATTCCGAGTCAAACT | 27 | 33.33 | 61.17 | 116643 | 116669 | |
| 76 | LSDV_WGSPP_38_R | B | AAGGTGGACAACAACACTTTTTCC | 24 | 41.67 | 60.64 | 120229 | 120252 | |
| 77 | LSDV_WGSPP_39_F | A | AACTGAACTTGTTACATTGTGTGATGT | 27 | 33.33 | 60.64 | 120007 | 120033 | |
| 78 | LSDV_WGSPP_39_R | A | CGCAATTCCCTCCATCGTCAAT | 22 | 50 | 61.5 | 123403 | 123424 | |
| 79 | LSDV_WGSPP_40_F | B | CACCACGACTGAACCATTCACT | 22 | 50 | 60.99 | 123066 | 123087 | |
| 80 | LSDV_WGSPP_40_R | B | TCGGATAGAGTACTAGCATCTACAGAA | 27 | 40.74 | 60.75 | 126666 | 126692 | |
| 81 | LSDV_WGSPP_41_F | A | ATGAACACAAGAAGGACGTCGG | 22 | 50 | 61.05 | 126259 | 126280 | |
| 82 | LSDV_WGSPP_41_R | A | GCCCCCAGCAATCCTAATAACA | 22 | 50 | 60.61 | 129784 | 129805 | |
| 83 | LSDV_WGSPP_42_F | B | GAAGTAGGATCACGTTTTAAAGGCG | 25 | 44 | 60.82 | 129346 | 129370 | |
| 84 | LSDV_WGSPP_42_R | B | ACCTCTTTAGTTTCTTGTCCTTTCCA | 26 | 38.46 | 60.8 | 132781 | 132806 | |
| 85 | LSDV_WGSPP_43_F | A | GACTGACTCGCTAGGATCTAATTATCC | 27 | 44.44 | 60.9 | 132413 | 132439 | |
| 86 | LSDV_WGSPP_43_R | A | ACACGCATCGAGACAATTATTAAAATCT | 28 | 32.14 | 60.75 | 135883 | 135910 | |
| 87 | LSDV_WGSPP_44_F | B | CGAATTACGTAAATACTGCGATGTATCA | 28 | 35.71 | 60.69 | 135547 | 135574 | |
| 88 | LSDV_WGSPP_44_R | B | CTCTAATATCCCTCAACGACATACAGTT | 28 | 39.29 | 61.02 | 139064 | 139091 | |
| 89 | LSDV_WGSPP_45_F | A | GTTCAAAAGTGTCGTCAATGAATGTC | 26 | 38.46 | 60.28 | 138760 | 138785 | |
| 90 | LSDV_WGSPP_45_R | A | TGTGTTTAAATCAGCGCCATTATCTAC | 27 | 37.04 | 60.95 | 142308 | 142334 | |
| 91 | LSDV_WGSPP_46_F | B | CATAAGACACCATGGAATACATTAGCG | 27 | 40.74 | 60.84 | 142090 | 142116 | |
| 92 | LSDV_WGSPP_46_R | B | ACAACACTATTTTCCGATGCAACG | 24 | 41.67 | 60.93 | 145566 | 145589 | |
| 93 | LSDV_WGSPP_47_F | A | TGGATTCTTGGCAATTTTATCAGAAGAA | 28 | 32.14 | 60.61 | 144858 | 144885 | |
| 94 | LSDV_WGSPP_47_R | A | GGATTCATTAACCCTATCATTGCCC | 25 | 44 | 60.2 | 148375 | 148399 | |
| 95 | LSDV_WGSPP_48_F | B | GGTGCCGAAACAACATTGCTATC | 23 | 47.83 | 61.22 | 147157 | 147179 | |
| 96 | LSDV_WGSPP_48_R | B | GTGGAAGCCAATTAAGTAGAAGCC | 24 | 45.83 | 60.22 | 150708 | 150731 | |
Table 06 - Details of LSDV_WGSPP_3.5 primer set
- For individual primers 100µmolar stocks are prepared in Nuclease Free Water and stored in -20 °C
- For multiplexed genomic PCR reaction the pool A and pool B are prepared by separately mixing 10 µL of each of the pool A primers in one pool and 10 µL of each of the pool B primers in the other pool. The primer pools can be stored in -20 °C
- At the time of setting up the PCR reactions the pool A and pool B primer pools are diluted 10 times (10µmolar primer mix) with Nuclease Free Water and added to the reactions as given in Table 07
# NOTE: Primer pools can be ordered directly from the manufacturer as ready-to-use 10µmolar primer mix.
- Pool A and Pool B PCR reactions are set up separately using RepliQa HiFi ToughMix® VWR InternationalCatalog #95200-500 master mix
| A | B | |
| repliQa HiFi ToughMix® | 12.5 μL | |
| Primer Mix of Pool A or Pool B | 3.75 μL | |
| Template DNA | 50 ng | |
| Nuclease Free Water | Makeup volume to 25 μL |
Table 07 - PCR reaction mix composition using LSDV_WGSPP_3.5
- PCR amplification conditions for genomic PCR reaction is given in Table 08
| A | B | C | D | |
| Step | Temperature | Time | Cycles | |
| Initial Denaturation | 98 ⁰C | 30 sec | X 1 cycle | |
| Denaturation | 98 ⁰C | 15 sec | X 35 cycles | |
| Annealing and Extension | 65 ⁰C | 6 min | ||
| Hold | 4 ⁰C | ∞ |
Table 08 – PCR conditions for multiplex whole genome amplification using LSDV_WGSPP_3.5 panel
Precautions
- Make sure to avoid cross-mixing of primers between the pool A and pool B sets
- Primer mix and DNA samples must be thawed on ice
- Gently mix primer pools (vortexing) and DNA samples (flicking) and spin down before use
- After every use store primer mix and DNA samples in -20 °C to prevent degradation
4h
Analysis of PCR products by agarose gel electrophoresis
# NOTE: This is an optional step and the PCR products can be directly sequenced without analysis by agarose gel electrophoresis. However, this step is recommended for two reasons- 1) to confirm that the pool A and pool B PCRs have worked for each sample before sequencing; 2) to ensure that the PCR product is devoid of primer dimers (this can affect sequence data quality).
- Reagents required are -
Invitrogen™ UltraPure™ AgaroseInvitrogen - Thermo FisherCatalog #16500100
GeneRuler 100 bp Plus DNA Ladder, ready-to-useThermo Fisher ScientificCatalog #SM0323
Ethidium bromide 10 mg/mlMerck MilliporeSigma (Sigma-Aldrich)Catalog #E1510
1X TAE BufferContributed by users
- 5 µL of PCR product is loaded on the agarose gel and electrophoresis is carried out at 120mV for 00:30:00
- A 3.5kb band should be seen in pool A and pool B reactions of each sample. Only samples for which both pool A and pool B reactions have worked can be taken forward for sequencing
30m
5. Sample Purification for PCR Products (optional)
5. Sample Purification for PCR Products (optional)
40m
40m
# NOTE: This is an optional step but is highly recommended if primer dimers are detected in the PCR product
- Add AMPure XPBechman CoulterCatalog #A63882 bead slurry to each sample in 1:1 volumetric ratio
- Incubate at Room temperature for 00:15:00 to allow DNA binding to beads
- Keep the sample tubes on magnetic stand for separation of beads bound to DNA
- Carefully remove supernatant without disturbing the beads
- Wash twice with 150 µL freshly prepared 80% Ethanol without disturbing the beads
- Keep for drying in Room temperature for 00:00:30 to 00:01:00 to remove excess ethanol. NOTE: Ensure that the beads do not dry completely.
- Remove tube from magnetic stand and add 25 µL of Nuclease Free Water (NFW). Mix the beads properly by pipetting
- Incubate for 00:15:00 at Room temperature to separate DNA from the beads
- Keep the tube on magnetic stand and wait for beads to separate out
- Recover the eluate (~20µl) containing DNA into a fresh tube
Precautions
- Always mix the beads only by pipetting or flicking to avoid DNA shear
- Always use freshly prepared 80% ethanol for washing
- Avoid carryover of beads while recovering the eluate in the last step
31m 30s
6. Oxford Nanopore Sequencing Steps Using SQK- RBK114.96 Kit
6. Oxford Nanopore Sequencing Steps Using SQK- RBK114.96 Kit
1h 30m
1h 30m
# NOTE: In the publication citing this protocol older reagents and R9.4 .1 flowcells were used. But since these reagents are discontinued by ONT, protocol mentioned below is updated with respect to new reagents compatible with R10.4.1 flowcells.
- If bead purification (Step No. 13) was omitted, go directly to barcoding step go to step #14.1
- If bead purification of PCR product done, do QC using nanodrop go to step #5.2 and check ratios i.e. A260/280 and A260/230
- For the samples with good quality of DNA (as given in Step No. 5.2), Qubit readings are taken to determine DNA concentration go to step #5.1 .
- Atleast 50ng of DNA per sample is required for sequencing
10m
Barcoding
- Between 50 ng to 100 ng of each purified PCR product is taken in maximum volume of 9 µL (make up volume with NFW if needed) and 1 µL sequencing rapid barcode (RB01-96) provided in the kit is added
# NOTE: If bead purification was not done, 9 µL of PCR product can be used directly in this step
- Mix properly by pipetting atleast 10 times
- Incubate at following conditions-
30 °C for 00:02:00 , then at 80 °C for 00:02:00 and then at 4 °C or On ice for 00:05:00
- Pool all the barcoded samples together in a single 1.5 mL microfuge tube
- All further steps are carried out on this pooled barcoded sample
9m
Purification of pooled barcoded sample
- Add AMPure XPBechman CoulterCatalog #A63882 bead slurry to each sample in 1:1 volumetric ratio
- Incubate at Room temperature for 00:15:00 to allow DNA binding to beads
- Keep the sample tubes on magnetic stand for separation of beads bound to DNA
- Carefully remove supernatant without disturbing the beads
- Wash twice with 1 mL freshly prepared 70% Ethanol without disturbing the beads
- Keep for drying in Room temperature for 00:00:30 to 00:01:00 to remove excess ethanol. NOTE: Ensure that the beads do not dry completely.
- Remove tube from magnetic stand and add 20 µL of Elution Buffer (EB) provided in the kit. Mix the beads properly by pipetting
- Incubate for 00:15:00 at Room temperature to separate DNA from the beads
- Keep the tube on magnetic stand and wait for beads to separate out
- Recover the eluate (~15µl) containing barcoded library into a fresh tube
Precautions
- Always mix the beads only by pipetting or flicking to avoid DNA shear
- Always use freshly prepared 70% ethanol for washing
- Avoid carryover of beads while recovering the eluate in the last step
# NOTE: At this stage the barcoded library can be stored at 4 °C for 1 day and at -20 °C for longer duration (upto 1 month)
31m 30s
Adapter ligation of barcoded library
- Take 11 µL of barcoded library and add 1 µL of diluted rapid adapter (1.5 µL Rapid Adapter (RA) + 3.5 µL Adapted Buffer (ADB))
- Incubate at 37 °C for 00:10:00 and immediately proceed with loading the library on the flowcell and sequencing
#NOTE: The sequencing library prepared is compatible with version 10 flowcells (FLOMIN_114) from Oxford Nanopore Technology (refer to manufacturer's website for latest update on flowcells and compatible kits).
10m
Flow cell priming
# NOTE: This step can be performed during incubation period for adapter ligation (Step No. 14.3)
- Make priming mix by adding 30 µL Flow Cell Tether (FCT) in 1170 µL Flow Cell Flush (FCF) and mix by vortexing
- Remove waste from waste port if required (# NOTE: Make sure that the spot-on port and priming port are CLOSED during this step)
- Set 200 µL reading in 1000 µL pipette then OPEN priming port and suck air out by bringing pipette volume to 220 µL - 230 µL to avoid entry of air bubble while loading (# NOTE: Make sure that the spot-on port is CLOSED during this step)
- Add 800 µL of priming mix via the priming port. It is important to follow the method given here for this step. (# NOTE: Make sure that the spot-on port is CLOSED during this step)
- Incubate at room temperature for 00:05:00 to 00:10:00
- Do second priming of flow cell by adding 200 µL priming mix. It is important to follow the method given here for this step. (# NOTE: Make sure that the spot-on port is OPENED during this step)
Precautions
- While following priming steps, strictly avoid air bubble entry in the flowcell as this will result in pore loss
- Follow pipetting steps with care and check when to open or close spot-on port and priming port as per recommendation
15m
Sample preparation for loading
- Add 37.5 µL Sequencing Buffer (SB) and 25.5 µL Library Beads (LIB) to adapter ligated sequencing library
- OPEN spot-on port and add the prepared sample to spot-on port using 100 µL pipette. NOTE: Strictly avoid air bubble entry into spot-on port
- CLOSE both spot-on and priming port and remove any solution from waste port
Precautions
- While loading the sample, strictly avoid air bubble entry in the flowcell as it will result in pore loss
- Avoid leaving any liquid in the waste port after loading as this might block the ports and prevent reuse of flowcell if needed
2m
Starting the sequencing
- Open MinKNOW software
- Click on the left panel and select Start
- Then select start sequencing from the menu
- Select the flow cell position and enter your experiment name and sample ID
- Then click on kit selection and select-Rapid Barcoding Kit 96 V14 (SQK- RBK114.96)Oxford Nanopore TechnologiesCatalog #SQK- RBK114.96
- Move forward to select parameters as required and start the sequencing
2m
Data Analysis
- In-house bash script named as virAssem_2.sh was developed for automated data analysis, accessible from github via virAssem_2.git link
Protocol references
1. Al Salihi K. Lumpy Skin disease: Review of literature. Mirror res.vet.e-ISSN 2307-8073. 2014 Dec 1; 3:6–23.
2. Tulman ER, Afonso CL, Lu Z, Zsak L, Kutish GF, Rock DL. Genome of Lumpy Skin Disease Virus. J Virol. 2001 Aug;75(15):7122–7130.
3. Mulatu E, Feyisa A. Review: Lumpy Skin Disease. J Vet Sci Technol. 2018; 09(03):1-8.
4. Tuppurainen E, Alexandrov T, Beltrán-Alcrudo D. Lumpy skin disease field manual. A manual for veterinarians. FAO Animal Production and Health Manual No. 20. Food and Agriculture Organization of the United Nations (FAO). 2017; 20:1-60.
5. Bhatt L, Bhoyar RC, Jolly B, et al. The genome sequence of the lumpy skin disease virus from an outbreak in India suggests a distinct virus lineage. Arch Virol. 2023 Feb 5;168(3):1-8.
6. Manjunatha Reddy, Awadhesh Prajapati., Sanjeevakumar Lalasangi. Epidemiology of Lumpy
Skin Disease in India | Pashudhan praharee. 2022; 1-11.
7. Mathivanan E, Raju K, Murugan R. Outbreak of Lumpy skin disease in India 2022- an emerging
threat to livestock & livelihoods. 2023 Feb 9;5(1):1-9.
8. Putty K, Rao PL, Ganji VK, et al. First complete genome sequence of lumpy skin disease virus directly from a clinical sample in South India. Virus Genes. 2023 Apr 1;59(2):317–322.
9. Mathijs E, Haegeman A, De Clercq K, Van Borm S, Vandenbussche F. A robust, cost-effective and widely applicable whole-genome sequencing protocol for capripoxviruses. J Virol Methods. 2022 Mar; 301(114464):1-9.
10. Quick J, Grubaugh ND, Pullan ST, et al. Multiplex PCR method for MinION and Illumina
sequencing of Zika and other virus genomes directly from clinical samples. Nat
Protoc. 2017 Jun;12(6):1261–1276.