prime-seq

Aleksandar  Janjic; Lucas Esteban LEW Wange; Johannes JWB Bagnoli; Johanna  Geuder; Phong  Nguyen; Daniel  Richter; Christoph  Ziegenhain; Wolfgang Enard; Beate Vieth

Apr 04, 2022

Version 2

prime-seq V.2

Scientific Reports

DOI

dx.doi.org/10.17504/protocols.io.81wgb1pw3vpk/v2

¹Ludwig-Maximilians-Universität München;
²Karolinska Institute Stockholm

Aleksandar Janjic

Ludwig-Maximilians-Universität München

DOI: dx.doi.org/10.17504/protocols.io.81wgb1pw3vpk/v2

External link: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-022-02660-8

Protocol Citation: Aleksandar Janjic, Lucas Esteban Wange, Johannes JWB Bagnoli, Johanna Geuder, Phong Nguyen, Daniel Richter, Christoph Ziegenhain, Wolfgang Enard, Beate Vieth 2022. prime-seq. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgb1pw3vpk/v2Version created by Aleksandar Janjic

Manuscript citation:

Janjic, A., Wange, L.E., Bagnoli, J.W. et al. Prime-seq, efficient and powerful bulk RNA sequencing. Genome Biol 23, 88 (2022). https://doi.org/10.1186/s13059-022-02660-8

License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited

Protocol status: Working

We use this protocol and it’s working

Created: April 03, 2022

Last Modified: April 04, 2022

Protocol Integer ID: 60237

Keywords: bulk RNA sequencing, RNA-seq, transcriptomics, SCRB-seq

Disclaimer

DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK

The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.

Abstract

Cost-efficient library generation by early barcoding has been central in propelling single-cell RNA sequencing. Here, we optimize and validate prime-seq, an early barcoding bulk RNA-seq method. We show that it performs equivalently to TruSeq, a standard bulk RNA-seq method, but is fourfold more cost-efficient due to almost 50-fold cheaper library costs. We also validate a direct RNA isolation step, show that intronic reads are derived from RNA, and compare cost-efficiencies of available protocols. We conclude that prime-seq is currently one of the best options to set up an early barcoding bulk RNA-seq protocol from which many labs would profit.

Guidelines

All reagents and plastic-ware can be found in the 'Materials' section.

Use only RNase free supplies and clean all surfaces and tools with RNase Away prior to working
 
Make sure all steps involving cell lysate and RNA before reverse transcription are carried out swiftly and on ice.
 
All primer sequences are listed below:
 
ABCDEF
OligoVendorPurificationWorking Conc.SequenceNotes
Barcoded Oligo-dT (E3V7NEXT)SigmaCartridge10 µMACACTCTTTCCCTACACGACGCTCTTCCGATCT[12 bp BC]NNNNNNNNNNNNNNNVTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
Template Switching Oligo (TSO) (E5V7NEXT)SigmaRNase-Free HPLC100 µMBiotin-ACACTCTTTCCCTACACGACGCrGrGrG
Preamp Primer (SINGV6)SigmaStandard Desalting10 µMBiotin-ACACTCTTTCCCTACACGACGC 
3' enrichment primer (P5NEXTPT5)SigmaStandard Desalting5 µMAATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
i7 Index Primer (Nextera)
IDTTrugrade5 µMCAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
i5 Index Primer (TruSeq)IDTTrugrade5µMAATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
prime-seq Adapter AntiSenseIDTStandard Desalting1.5 µM/5Phos/CTGTCTCTTATACACATCTDuplexed DNA
prime-seq Adapter SenseIDTStandard Desalting1.5 µMGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTDuplexed DNA


Specific barcoded oligodT (E3V7NEXT) sequences:
 
E3V7_Set1.txt  
E3V7_Set2.txt  

Materials

MATERIALS
ReagentDNase I Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0303S 
ReagentDNase I (RNase-free) - 1,000 unitsNew England BiolabsCatalog #M0303S 
ReagentDeoxynucleotide Solution Mix - 40 umol of eachNew England BiolabsCatalog #N0447L 
ReagentExonuclease I (E.coli) - 3,000 unitsNew England BiolabsCatalog #M0293S 
ReagentQuant-it™ PicoGreen® dsDNA Assay KitLife TechnologiesCatalog #P7589 
Reagentß -mercaptoethanol Sigma AldrichCatalog #M3148 
ReagentQuantiFluor(R) RNA SystemPromegaCatalog #E3310 
ReagentProteinase K solution, 20 mg ml − 1AmbionCatalog #AM2546 
Reagent5 M Sodium chloride (NaCl)Sigma AldrichCatalog #S5150-1L 
ReagentAgilent High Sensitivity DNA KitAgilent TechnologiesCatalog #5067-4626 
ReagentBuffer RLT PlusQiagenCatalog #1053393 
ReagentMaxima H Minus Reverse Transcriptase (200 U/uL)Thermo Fisher ScientificCatalog #EP0752 
ReagentNEBNext Ultra II FS DNA Library Prep with Sample Purification Beads - 24 rxnsNew England BiolabsCatalog #E6177S 
ReagentEDTASigma AldrichCatalog #E7889 
ReagentEthanol absoluteCarl RothCatalog #9065.4 
ReagentIgepalSigma AldrichCatalog #I8896 
ReagentKAPA HiFi 2x RMKapa BiosystemsCatalog #KR0370 
ReagentPoly(ethylene glycol)Sigma AldrichCatalog #89510 
ReagentUltraPure DNase/RNase Free Distilled WaterCatalog #10977-049 
ReagentTrizma hydrochloride solutionSigma AldrichCatalog #T2694 
ReagentAluminium seals for cold storageCatalog #391-1275 
ReagentFilter tips 96 low retention 10 uLCatalog #771265 
ReagentPCR SealsThermo ScientificCatalog #AB0558 
Reagenttwin.tec 96-well DNA LoBind PlatesEppendorfCatalog #0030129504 
ReagentSera-Mag Speed BeadsGe HealthcareCatalog #65152105050250 
ReagentSodium AzideSigma AldrichCatalog #S2002-100G 

Safety warnings

Please follow all Manufacturer safety warnings and recommendations. 

Before start

Wipe bench surfaces with RNAse Away and keep working environment clean.

Preparation

12m

Clean all surfaces and pipettes with RNase Away

Thaw frozen buffers and primers on ice

10m

Prepare 80% EtOH (approximately 45 mL for 96 samples)

When running the protocol for the first time prepare Cleanup Beads (see end of the protocol)!

45m

prime-seq can be used on lysate or extracted RNA. It is essential, however, that the samples either have the same input or that they are normalized after the RNA is extracted, otherwise sequencing depth per sample will be impacted. Based on your starting material, please follow one of the following cases:

Step case

Lysate (similar input), Direct Lysis
106 steps

Follow this case if you are testing samples that have similar input (i.e. the expected RNA amount is the same between samples). The steps here will guide you in digesting residual proteins in your samples, extracting the RNA, digesting DNA, preparing RNA-seq libraries, and finally sequencing. 

Example: investigating the genotype effect on transcription in 5,000 neurons

First Time Setup

When running the direct lysis protocol for the first time, prepare Bead Binding Buffer (see end of the protocol)!

Sample Collection

Prepare Lysis Buffer according to the number of samples.

ReagentWellPlate
RLT Plus Buffer99 µL10.89 mL
β-mercaptoethanol1 µL110 µL
Total
100 µL11 mL

Note
If sample volume exceeds 25 % of total lysate, use 2x TCL buffer 
(Qiagen, #1070498) + 1 % β-mercaptoethanol

AddAmount100 µL   of Lysis Buffer to each well of a semi-skirted 96-well PCR plate

Add cells or tissue to wells

Note
Cells

Minimum: 100 cells, Optimum: 10,000 cells 

Make sure that the same number of cells are used for each sample. Large differences between cells will impact distribution of sequencing reads and can potentially affect normalization. 

Note
Tissue

If samples are difficult to lyse they should be homogenized using a tissue homogenizer. 

Tissue should be a relatively small and not exceed more than 1000 ng of RNA. Tissue samples should be normalized by weight and be the same type of tissue. 

Large differences between tissue samples will impact distribution of sequencing reads and can potentially affect normalization. 

If you are unsure if the samples will contain the same amount of RNA, it is best to switch to the "Lysate (variable)" case in Step 13.

Transfer Amount50 µL   of lysate to a new plate, return one plate immediately to -80 C freezer to save as a backup

Note
Conversely, one can prepare two plates during sorting with 50 µL of lysis buffer.

Proteinase K Digest

30m

Add Amount1 µL   Proteinase K (20 mg/mL) and Amount1 µL   EDTA (25 mM) to each well

Incubate for Duration00:15:00   at Temperature50 °C   and then heat inactivate the Proteinase K for Duration00:10:00   at Temperature75 °C  

25m

Bead Clean Up

20m

Mix each bulk sample (50 µL per well) with Amount100 µL   of Cleanup Beads (22% PEG)

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 
Note
While binding, prepare DNase I Mix (Step 28)

Place on magnet stand until clear (~3 min) and then discard supernatant

Wash with Amount100 µL   of 80% EtOH while the plate is on the magnet. Discard the supernatant


Note
After adding EtOH, incubate for 30 s so that all beads are bound to magnet. 

Repeat wash step once more

Air dry beads for Duration00:03:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

DNAse I Digest

Add Amount5 µL   H2O and resuspend beads by vortexing vigorously

Note
If you encounter bead clumping at this step, try to resuspend the beads by vigorously pipetting the samples. We have generated high quality prime-seq libraries despite heavy clumping. 

Prepare DNase I Mix 

ReagentWellPlate
DNase I1 µL110 µL
DNase I Buffer (10x)2 µL220 µL
Bead Binding Buffer (2x)10 µL1.1 mL
H2O2 µL220 µL
Total15 µL1.65 mL

 
 

Add  Amount15 µL   of DNase I Mix and mix by pipetting

Incubate DNase I Mix and beads for Duration00:10:00   at Temperature20 °C (Room Temp) 

10m

Heat inactivate the DNase I by adding Amount1 µL   of EDTA (100 mM) and incubating for Duration00:05:00   at Temperature65 °C  

Place plate on magnet stand until clear (~3 min) and discard the supernatant.

Wash with Amount100 µL   of 80% EtOH while the plate is on the magnet. Discard the supernatant

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Note
While drying, prepare Reverse Transcription Mix. 

Reverse Transcription

Prepare Reverse Transcription Mix

ReagentWellPlate
Maxima H Minus RT0.15 µL16.5 µL
Maxima RT Buffer (5x)2 µL220 µL
dNTPs (25 mM)0.4 µL44 µL
TSO (E5V7NEXT) (100 uM)0.1 µL11 µL
UltraPure Water2.35 µL258.5 µL
Total5 µL550 µL
 

 

Add Amount4 µL   H2O to the beads
Note
The 4 µL of  water can be combined with the Reverse Transcription Mix by increasing the water in Row 6 from 2.35 µL to 6.35 µL. 

If working with many samples, or if using a stepper pipette or robot, we find that it is better to add some water separately to prevent the beads from drying too much. 

Add Amount5 µL   Reverse Transcription Mix

Add Amount1 µL   of Barcoded oligodT (E3V7NEXT) (10 µM) per well

Incubate for Duration01:30:00   at Temperature42 °C  

1h 30m

cDNA Pooling & Purification

Place the plate on a magnet

Pool the supernatant of all wells into a 2 mL tube

10m

Add Amount10 µL   of Cleanup Beads (22% PEG) per sample for a 1:1 ratio (e.g. 240 µL for 24 samples)

Note
The EDTA in the Cleanup Beads (22% PEG) will inactivate the RT.

Incubate for Duration00:05:00   at TemperatureRoom temperature   to allow binding of the cDNA onto beads

Place the tube on the magnet stand until clear (~3 min) and discard supernatant

Wash with Amount1 mL   of 80% EtOH while the tube is on the magnet, discard the supernatant

Note
Volume of EtOH should be adjusted depending on the number of samples. More samples will require more EtOH to cover the beads completely. 

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Elute the beads in Amount17 µL   of UltraPure Water 

Incubate for Duration00:05:00    at RT and transfer to a new PCR tube or plate

Exonuclease I Treatment

35m

Add Amount2 µL   of ExoI Buffer (10x) and Amount1 µL   of Exonuclease I. Incubate as follows:

StepTemperatureTime
Incubation37 C20 min
Heat Inactivation80 C10 min
Storage4 C∞

35m

Mix each sample (20 µL per well) with Amount16 µL   of Cleanup Beads (22% PEG) for a 1:0.8 ratio

Incubate for Duration00:05:00   at TemperatureRoom temperature   to allow binding of the cDNA onto beads

Place the tube on the magnet stand until clear (~3 min) and discard supernatant

Wash with Amount50 µL   of 80% EtOH while the tube is on the magnet, discard the supernatant

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Elute the beads in Amount20 µL   of UltraPure Water 

Incubate for Duration00:05:00    at RT and transfer to a new PCR tube or plate

Full length cDNA Amplification

Prepare Pre Amplification Mix

Reagent1x
KAPA HiFi 2x RM25 µL
Pre-amp Primer (SINGV6) (10 uM)3 µL
UltraPure Water2 µL
Total30 µL

Add Amount30 µL   Pre Amplification Mix to sample

Incubate the Pre Amplification PCR as follows:


StepTemperatureTimeCycles
Initial Denaturation98 C3 min1 cycle
Denaturation98 C15 sec10 cycles*
Annealing65 C30 sec
Elongation72 C4 min
Final Elongation72 C10 min1 cycle
Storage4 C∞

Note
Adjust the number of cycles based on input (sample number, cell number, or concentration). 

As a rule of thumb we assume big cells like embryonic stem cells to contain 10 pg of total RNA and small cells like T-cells ~ 1-2 pg

As a general guide we recommend:

Total RNA InputCycles
10 ng16
50 ng14
100 ng12
500 ng10
1000 ng9

1h 30m

cDNA Bead Purification

Mix sample with Amount40 µL   Clean Up Beads (22% PEG) for a ratio of 1:0.8

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 

Place the tube on the magnet stand until clear (~3 min) and discard supernatant

Wash with Amount100 µL   of 80% EtOH while the tube is on the magnet, discard the supernatant

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Elute cDNA in Amount10 µL   UltraPure Water

Incubate for Duration00:05:00    at RT and transfer to a new PCR tube or plate
Note
Stopping Point. Samples can be safely stored at Temperature-20 °C   and protocol can be continued at a later date. 

cDNA Quantification and Quality Check

45m

Quantify the cDNA using the Quant-iT PicoGreen dsDNA assay kit or equivalent Qubit following the manufacturer's protocol. Use 1 μl of clean cDNA for quantification.

10m

Quality check the cDNA using the Agilent 2100 Bioanalyzer with High Sensitivity DNA Analysis Kits. 

Note
Passing the cDNA quality check does not guarantee that the data will be of high quality, however,  if the cDNA fails the quality check it will usually not yield good libraries and will therefore generate lower quality data. 

Expected result

45m

Library Preparation

Note
Before starting, read the library preparation section carefully as there are a few steps that are very time sensitive.

Prepare Fragmentation Mix

Reagent1x
Ultra II FS Reaction Buffer1.4 µL
Ultra II FS Enzyme Mix0.4 µL
cDNA (4-8 ng/µL)2.5 µL
TE1.7 µL
Total6 µL

Note
Ensure that the Ultra II FS Reaction Buffer is completely thawed. If a precipitate is seen in the buffer, pipette up and down several times to break it up, and quickly vortex to mix. Place on ice until use.

Note
Vortex the Ultra II FS Enzyme Mix for 5-8 seconds prior to use for optimal performance. 

Vortex the Fragmentation Mix forDuration00:00:05   and immediately proceed to step 67

10s

Incubate the Fragmentation reaction as follows:

StepTemperatureTime
Pre-Cool4 C∞
Fragmentation37 C5 min
A Tailing and Phosphorylation65 C30 min
Storage4 C∞



Note
Set heated lid to 75° C. Make sure the lid is at the correct temperature before you start the reaction.
Skip the first incubation step once you have added your samples.

40m

Adapter Ligation

20m

Prepare Adapter Ligation Mix


Reagent1x
NEBNext Ultra II Ligation Master Mix6 µL
NEBNext Ligation Enhancer0.2 µL
prime-seq Adapter (1.5 µM)0.5 µL
Total6.7 µL

Add Amount6.7 µL    Adapter Ligation Mix to each replicate

Incubate for Duration00:15:00   at Temperature20 °C  

Note
Turn off heated lid

15m

Add Amount37.3 µL   Buffer EB to Samples

Mix Sample with Amount26 µL   SPRI select beads
Note
We use SPRI Select Beads here instead of our home made 22% Clean Up beads for their guaranteed QCed size selection properties.

Note
The volume of SPRI select beads used during library size selection can be adjusted based on desired library size. Optimization for your samples may be required. 

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 

Place the plate on the magnet stand until clear and transferAmount76 µL   supernatant to clean well.  
Note
Be careful not to discard! This is your sample! 

Mix supernatant with Amount10 µL   SPRI select beads
Note
The volume of SPRI select beads used during library size selection can be adjusted based on desired library size. Optimization for your samples may be required. 

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 

Place the plate on the magnet stand until clear and discard supernatant

Wash with Amount150 µL   of 80% EtOH while the plate is on the magnet, discard the supernatant

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Elute samples in Amount11 µL   0.1X TE (dilute 1X TE Buffer 1:10 in water) for Duration00:05:00  

Library PCR

45m

Transfer Amount10.5 µL   of samples to clean wells

Add Amount1 µL   of Index Primer (Nextera i7, 5 uM) to each well

Note
This is the unique index that will be used for demultiplexing libraries. 

Add Amount1 µL   of Index Primer (TruSeq i5, 5 uM) to each well

Note
Alternatively the universal primer P5NEXTPT5 can be used in case the second index will not be sequenced.

Prepare Library PCR Mix by adding Amount12.5 µL   

Note
Although scaled down, there will not be sufficient Q5 Master Mix (M0544L) in the kit. This item will have to be ordered separately.

Incubate the Library PCR reaction as follows:

StepTemperatureTimeCycles
Initial Denaturation98 C30 sec1 cycle
Denaturation98 C10 sec10 cycles*
Annealing/Elongation65 C1 min 15 sec
Final Elongation65 C5 min1 cycle
Storage4 C∞


Note
Adjust the number of cycles based on cDNA input.

As a general guide we recommend:

cDNA InputCycles
20 ng10
10 ng11
5 ng12

Double Size Selection

25m

Add Amount25 µL   Buffer EB to Index PCR

Mix Index PCR with Amount26 µL   SPRI select beads
Note
We use SPRI Select Beads here instead of our home made 22% Clean Up beads for their guaranteed QCed size selection properties.

Note
The volume of SPRI select beads used during library size selection can be adjusted based on desired library size. Optimization for your samples may be required. 

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 

Place the plate on the magnet stand until clear and transfer Amount76 µL   supernatant to clean well.  
Note
Be careful not to discard! This is your library. 

Mix supernatant with Amount10 µL   SPRI select beads
Note
The volume of SPRI select beads used during library size selection can be adjusted based on desired library size. Optimization for your samples may be required. 

Incubate for Duration00:05:00   at Temperature20 °C (Room Temp) 

Place the plate on the magnet stand until clear and discard supernatant.   

Wash with Amount150 µL   of 80% EtOH while the plate is on the magnet, discard the supernatant

Repeat wash step once more

Air dry beads for Duration00:05:00  

Note
Depending on temperature and humidity, the beads may dry faster. Therefore it is important to regularly check the beads and avoid over-drying. 

Elute in Amount15 µL   UltraPure Water. 

 Incubate for Duration00:05:00   and then place on magnet until clear. Transfer eluted library to new well. 
Note
Stopping point. The libraries can be safely stored at Temperature-20 °C   until they will be QCed and sequenced. 

QC and quantification

45m

Quantify and quality control the library using the Agilent 2100 Bioanalyzer with High Sensitivity DNA Analysis Kits.

Note
Bulk libraries often yield high concentrations, which should be diluted to get accurate molarity measurements on the Bioanalyzer. Ideally, do not load more than 2 ng onto the chip.


Expected result
Libraries will typically exceed 1-5 ng/μl concentration

Sequencing

Samples should be submitted according to your Sequencing Facility specifications. prime-seq is compatible with Illumina Sequencing.


At least 8 cycles are required for the Index Read (i7) and 28 cycles for the Read 1 (BC+UMI). Dual index sequencing can be done when using patterned flowcells. Read 2 (DNA) should be adjusted based on the quality of the genome being mapped to, but for human and mouse 50 cycles is sufficient.


Some potential sequencing options:

ABCDEF
SequencerRead 1Read 2Index Read (i7)Index Read (i5)Kit
NovaSeq289488NovaSeq SP v1.5 100 cycle
NextSeq 500/550285680NextSeq 500/550 HiOut v3 75 cycle
NextSeq 1000/2000289488NextSeq 1000/2000 P2 100 cycle
NextSeq 2000285280NextSeq 2000 P3 50 cycles
HiSeq2811480HiSeq 3000/4000 150 cycles

Prepare Cleanup Beads (22% PEG)

10m

Prepare PEG Solution (22%) by adding all ingredients to a 50 mL falcon tube

 ReagentAmount
PEG 800011 g
NaCl (5M)10 mL
Tris-HCl (1M, pH 8.0)500 μL
EDTA (0.5M)100 μL
IGEPAL (10% solution)50 μL
Sodium Azide (10% solution)250 μL
UltraPure Waterup to 49 mL
Total 49 mL

Note
Do not add the total amount of water until after PEG is completely solubilized

10m

Incubate at Temperature40 °C   and vortex regularly until PEG is completely dissolved

10m

Resuspend Sera-Mag Speed Beads carefully and pipette Amount1000 µL   of bead suspension into a 1.5 mL tube

Place on magnet stand and remove storage buffer

Add Amount1000 µL   of TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads

30s

Place on magnet stand and remove supernatant 

30s

Repeat wash step one more time 

Add Amount900 µL   TE Buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) and resuspend beads

30s

Add the washed Sera-Mag Speed Beads to the PEG Solution (22%) and mix well
Note
The final Cleanup Beads (22% PEG) can be aliquoted and stored at Temperature4 °C   for up to six months

1m 30s

Prepare Bead Binding Buffer

10m

Prepare Bead Binding Buffer (2x)

Reagent
PEG 80001.1 g
NaCl (5 M)1 mL
Tris-HCl (1 M, pH 8.0)50 µL
Igepal (10% solution)5 µL
Sodium Azide (10% solution)25 µL
H2Oto 5 mL
Total5 ml

Note
The Bead Binding Buffer (2x) can be stored at TemperatureRoom temperature   for up to six months.

10m

A	B	C	D	E	F
Oligo	Vendor	Purification	Working Conc.	Sequence	Notes
Barcoded Oligo-dT (E3V7NEXT)	Sigma	Cartridge	10 µM	ACACTCTTTCCCTACACGACGCTCTTCCGATCT[12 bp BC]NNNNNNNNNNNNNNNVTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN
Template Switching Oligo (TSO) (E5V7NEXT)	Sigma	RNase-Free HPLC	100 µM	Biotin-ACACTCTTTCCCTACACGACGCrGrGrG
Preamp Primer (SINGV6)	Sigma	Standard Desalting	10 µM	Biotin-ACACTCTTTCCCTACACGACGC
3' enrichment primer (P5NEXTPT5)	Sigma	Standard Desalting	5 µM	AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
i7 Index Primer (Nextera)	IDT	Trugrade	5 µM	CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
i5 Index Primer (TruSeq)	IDT	Trugrade	5µM	AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT
prime-seq Adapter AntiSense	IDT	Standard Desalting	1.5 µM	/5Phos/CTGTCTCTTATACACATCT	Duplexed DNA
prime-seq Adapter Sense	IDT	Standard Desalting	1.5 µM	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGT	Duplexed DNA

Reagent	Well	Plate
RLT Plus Buffer	99 µL	10.89 mL
β-mercaptoethanol	1 µL	110 µL
Total	100 µL	11 mL

Reagent	Well	Plate
DNase I	1 µL	110 µL
DNase I Buffer (10x)	2 µL	220 µL
Bead Binding Buffer (2x)	10 µL	1.1 mL
H2O	2 µL	220 µL
Total	15 µL	1.65 mL

Step	Temperature	Time
Incubation	37 C	20 min
Heat Inactivation	80 C	10 min
Storage	4 C	∞

	Reagent	1x
	KAPA HiFi 2x RM	25 µL
	Pre-amp Primer (SINGV6) (10 uM)	3 µL
	UltraPure Water	2 µL
	Total	30 µL

	Reagent	1x
	Ultra II FS Reaction Buffer	1.4 µL
	Ultra II FS Enzyme Mix	0.4 µL
	cDNA (4-8 ng/µL)	2.5 µL
	TE	1.7 µL
	Total	6 µL

	Reagent	1x
	NEBNext Ultra II Ligation Master Mix	6 µL
	NEBNext Ligation Enhancer	0.2 µL
	prime-seq Adapter (1.5 µM)	0.5 µL
	Total	6.7 µL

A	B	C	D	E	F
Sequencer	Read 1	Read 2	Index Read (i7)	Index Read (i5)	Kit
NovaSeq	28	94	8	8	NovaSeq SP v1.5 100 cycle
NextSeq 500/550	28	56	8	0	NextSeq 500/550 HiOut v3 75 cycle
NextSeq 1000/2000	28	94	8	8	NextSeq 1000/2000 P2 100 cycle
NextSeq 2000	28	52	8	0	NextSeq 2000 P3 50 cycles
HiSeq	28	114	8	0	HiSeq 3000/4000 150 cycles

	Reagent	Amount
	PEG 8000	11 g
	NaCl (5M)	10 mL
	Tris-HCl (1M, pH 8.0)	500 μL
	EDTA (0.5M)	100 μL
	IGEPAL (10% solution)	50 μL
	Sodium Azide (10% solution)	250 μL
	UltraPure Water	up to 49 mL
	Total	49 mL

	Reagent
	PEG 8000	1.1 g
	NaCl (5 M)	1 mL
	Tris-HCl (1 M, pH 8.0)	50 µL
	Igepal (10% solution)	5 µL
	Sodium Azide (10% solution)	25 µL
	H2O	to 5 mL
	Total	5 ml

	cDNA Input	Cycles
	20 ng	10
	10 ng	11
	5 ng	12

Public workspaceprime-seq V.2

Lysate (similar input), Direct Lysis106 steps

prime-seq V.2

Lysate (similar input), Direct Lysis
106 steps