Jan 23, 2025
Presence of Antimicrobial Resistance Genes in Organomineral Fertilizer
- Glauco Mariano Teixeira Junior1,
- Justine Condon2,
- Lisa Durso2,
- Eric D. Becraft1
- 1University of North Alabama;
- 2USDA-ARS
Protocol Citation: Glauco Mariano Teixeira Junior, Justine Condon, Lisa Durso, Eric D. Becraft 2025. Presence of Antimicrobial Resistance Genes in Organomineral Fertilizer. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly67eegx9/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 28, 2024
Last Modified: January 23, 2025
Protocol Integer ID: 113747
Keywords: Antimicrobial Resistance Genes, Organomineral Fertilizer, Organomineral fertilizer formulations, PCR
Funders Acknowledgements:
USDA-ARS
Grant ID: NP212
Abstract
This protocol details the steps for detecting various antibiotic resistance genes (ARGs), including tetA, tetX, tetO, ermB, sul1, blaCTX-M-32, and intI1, using PCR and gel electrophoresis. Starting with DNA extraction from organomineral fertilizer samples, the method describes PCR reaction preparation with specific primers and controls, followed by visualization of results on an agarose gel. Ethidium bromide and SYBR Safe are used for staining, with appropriate safety precautions. This technique allows for the identification of target resistance genes, indicated by the presence of corresponding DNA bands under UV analysis.
In addition, the protocol is specifically designed to assess ARGs in organomineral fertilizers (OMF), which are innovative agricultural products that integrate organic matter, such as animal manure or plant waste, with mineral fertilizers. This sustainable approach enhances soil fertility and crop productivity while promoting effective by-product utilization and animal waste management. However, the manure component in OMF can serve as a reservoir for ARGs, raising concerns about the spread of antibiotic resistance in agricultural environments. By identifying specific ARGs in OMF, this protocol offers critical insights into the environmental implications of these fertilizers and supports the development of strategies to mitigate the risks associated with antibiotic resistance.
Guidelines
Appendix B – Result Interpretation
• Positive results will show a DNA band corresponding to the target gene.
• Negative results will show no bands, indicating the absence of resistance genes.
• Figure 13. Example of agarose gel electrophoresis.
The ladder is labeled as "DNA" for identification.
Appendix C – Positive Control (gBlock) Sequences
The gBlocks Gene Fragments, produced by Integrated DNA Technologies (IDT), are double-stranded synthetic DNA fragments that are sequence-verified and ready for use in molecular biology workflows.
Structure and Features
• Sequence Orientation: The gBlock sequence is written in the 5’ to 3’ orientation, as is standard for representing DNA sequences.
• Target and Flanking Sequences: Each gBlock contains the desired target sequence flanked by extra sequences on either end. These additional sequences may include buffer regions, restriction sites, or regions necessary for experimental designs like cloning or PCR.
• Purpose of this gBlock: This specific gBlock serves as a control for multiple targets.
1. Highlighted Target Sequence:
o The target sequences within the gBlock are highlighted in the provided material to indicate their locations.
o Primer-binding sites are color-coded to help identify them visually.
2. DNA Strand Considerations:
o gBlocks are double-stranded DNA sequences that incorporate both forward and reverse primers.
o The reverse primer is provided as the reverse complement, eliminating the need for manual sequence adjustment.
3. Primer Design:
o Do not use the gBlock sequence directly to order primers.
o Instead, refer to Table 1 and Table 2 provided for the experiment, which contains the correctly oriented and validated primer sequences.
gBlock 10 – Tet X (1150 bp) - for Tet assay and primer set P27 – Tet X
gBlock 12 – Tet A (1239 bp) - for Tet assay and primer set P14 – Tet A
gBlock 13 – Tet O (1423 bp) - for Tet assay and primer set P23 – Tet O
gBlock 3 – sul1 (344 bp) - for 4G assay and primer set P2-sul1
Escherichia coli R46 sul1 gene for sulfonamide-resistant dihydropteroate synthase Sul1, complete CDS NCBI Reference Sequence: NG_048081.1
gBlock 17 – ermB (424 bp) – for 4G assay and primer set P3-ermB
gBlock 18 – ctxm-32 (249 bp) – for 4G assay and primer set P4–ctxm32
gBlock 19 – intI1 (535 bp) - for 4G assay and primer set P5-intI1
Materials
• Primers for tetA, tetX, tetO, ermB, sul1, blaCTX-M-32, intI1: IDT, Coralville, IA- See Table 1 and Table 2 [In the PCR Reaction section - Step 20].
• Positive Control (gblock) for resistance genes (106 dilution for all): IDT, Coralville, IA- See Appendix C [In the Guidelines & Warnings section]
• PCR Water
• Master Mix JumpStart Red Taq (P0982-800rxn, Sigma, St. Louis, MO)JumpStart™ REDTaq® ReadyMix™ Reaction MixMerck MilliporeSigma (Sigma-Aldrich)Catalog #P0982-800RXN
• 0.2 ml PCR strip tubes (T320-2N, Simport, Quebec, Canada)
• AgaroseMerck MilliporeSigma (Sigma-Aldrich)Catalog #A9539
• TAE Buffer (1x and 0.25x)
• Ethidium bromide
• SYBR SAFE DNA stainInvitrogen - Thermo FisherCatalog #S33102
• DirectLoad™ PCR 100 bp Low LadderMerck MilliporeSigma (Sigma-Aldrich)Catalog #D3687-1VL
Equipment
• DNeasy PowerSoil Pro Kit (250)QiagenCatalog #Cat No./ID: 47014
• Scale
• Weighing Supplies
• Thermocycler
• Gel Electrophoresis Apparatus
• UV light analyzer
• Bead Beater, Centrifuge, Vortex
• Pipettors for various volumes from 1-1000µl
• Erlenmeyer Flasks
• Gel casting tray (40 µl), and gel combs
Safety warnings
Appendix A – Ethidium Bromide Safety Precautions:
• Properties and Risks:
o Ethidium bromide is a powerful nucleic acid stain, highly fluorescent under UV light.
o It is potentially mutagenic, carcinogenic, or teratogenic, and may cause eye, skin, and respiratory irritation.
• Handling:
o Always wear gloves, safety glasses, long pants, and closed-toe shoes when handling ethidium bromide.
o Minimize exposure and ensure the workspace is well-ventilated.
• Waste Disposal:
o Dispose of ethidium bromide as hazardous waste.
o Place all contaminated materials (e.g., gels, gloves, pipette tips) in a properly labeled chemical waste container marked “Et Br Decontamination”.
o Seal the waste box securely before collection by appropriate disposal services.
Figure 12. Example of a properly labeled and marked chemical waste container.
Procedure - DNA Extraction (Using QIAGEN® DNeasy® PowerSoil® Pro )
Procedure - DNA Extraction (Using QIAGEN® DNeasy® PowerSoil® Pro )
8m 55s
8m 55s
Turn on the scale, place the tube on it, and tare to zero before carefully weighing the sample.
Begin by measuring 250 mg of organomineral fertilizer.
Figure 2. Organomineral fertilizer formulations.
Then, add the measured organomineral fertilizer and 800 µL of Solution CD1 to the PowerBead Pro tubes.
Figure 3. DNeasy PowerSoil Pro Kit Solutions.
Vortex the sample in the Bead Beater for 00:00:45 at max speed.
45s
Ensuring tubes are balanced, secured, and the bead beater’s lid is closed for safety.
Figure 4. Bead Beater used to Vortex the sample.
Centrifuge tubes at 15000 x g, 00:01:00 .
1m
Ensuring tubes are balanced symmetrically in the rotor to prevent damage. Use balancing weights or dummy tubes if processing fewer samples.
Figure 5. Example of tubes in Centrifuge.
Transfer 500 µL -600 µL of supernatant to a new 2 mL Microcentrifuge Tube.
Add 200 µL Solution CD2 and vortex for 00:00:05 .
5s
Centrifuge at 15000 x g, 00:01:00 . Transfer 700 µL supernatant to a new tube.
1m
Add 600 µL Solution CD3, vortex for 00:00:05 .
5s
Transfer 650 µL lysate to MB Spin Column. Centrifuge at 15000 x g, 00:01:00 . Discard flow-through.
1m
Repeat go to step #11 for remaining lysate.
Add 500 µL Solution EA, centrifuge at 15000 x g, 00:01:00 , and discard flow-through.
1m
Add 500 µL Solution C5, centrifuge at 15000 x g, 00:01:00 , discard flow-through, and centrifuge again for 00:02:00 .
3m
Elute DNA by adding 100 µL Solution C6 to the filter and centrifuging at 15000 x g, 00:01:00 .
1m
Store DNA at -30 °C .
Figure 6. The DNA is stored in the freezer at -30 °C and labeled with a unique recognizable identifier.
Procedure - PCR Reaction
Procedure - PCR Reaction
Prepare PCR reactions in 0.2 mL strip tubes:
Figure 7. Materials used to evaluate the presence of antibiotic resistance genes in organomineral fertilizers.
o Master Mix JumpStart Red Taq (P0982-800rxn): 12.5 µL
o PCR Water: 5.5 µL
o Forward Primer (10 µM): 1 µL
o Reverse Primer (10 µM): 1 µL
o DNA Sample: 5 µL
(Negative control: PCR Water in place of DNA sample)
(Positive control: gBlock variety in place of DNA sample)
Add gBlock variety listed in Appendix A (Guidelines & Warnings Section), for Tet and antibiotic-resistant genes as follows:
o tetA: 1 µL gBlock 12 + 4 µL PCR water
o tetX: 2 µL gBlock 10 + 3 µL PCR water
o tetO (gBlock 13), ermB ( gBlock 17), intI1( gBlock 19), blaCTX-M-32 (gBlock 18), sul1 (gBlock 3): 3 µL gBlock + 2 µL PCR water
Gently mix the contents of the tubes by stirring, then place the reaction tubes in the thermocycler, following specific settings for Tet and antibiotic-resistant genes listed in Table 1 and Table 2.
Figure 8. 0.2 mL strip tubes with PCR reaction being placed in the thermocycler.
| A | B | C | D | E | F | G | H | |
| Gene Sets | Primers | Type | Sequence | TM (°C) | TC Conditions | Amplicon Size (bp) | Sequence Reference | |
| Tet A | A -LDP14 | Forward | GCT ACA TCC TGC TTG CCT TC | 58 | 1 cycle at 94°C for 2 min; 30 cycles at 94 °C for 30 s, 58°C for 30 s, 72°C for 1 min; 1 cycle at 72°C for 5 min | A - 210 | Ng et al. 2001 | |
| Reverse | CAT AGA TCG CCG TGA AGA GG | |||||||
| Tet O | O - LDP23 | Forward | AAC TTA GGC ATT CTG GCT CAC | 57 | 1 cycle at 94°C for 2 min; 30 cycles at 94 °C for 30 s, 57°C for 30 s, 72°C for 1 min; 1 cycle at 72°C for 5 min | O - 406 | Ng et al. 2001 | |
| Reverse | TCC CAC TGT TCC ATA TCG TCA | |||||||
| Tet X | X - LDP27 | Forward | CAA TAA TTG GTG GTG GAC CC | 58 | 1 cycle at 94°C for 2 min; 30 cycles at 94 °C for 30 s, 58°C for 30 s, 72°C for 1 min; 1 cycle at 72°C for 5 min | X - 468 | Ng et al. 2001 | |
| Reverse | TTC TTA CCT TGG ACA TCC CG |
Table 1. Tetracycline uniplex groups including its primer sequences, thermal cycler conditions, amplicon size.
| A | B | C | D | E | F | G | |
| Gene | Type | Sequence 5' to 3' | TM (°C) | TC Conditions | Amplicon Size (bp) | Sequence Reference | |
| sul1 | Forward | GACGAGATTGTGCGGTTCTT | 64 | 1 cycle at 94 °C for 2 min; 35 cycles at 94 °C for 30s, 64oC for 30 s, 72oC for 2 min; 1 cycle at 72oC for 5 min. | 185 | Szczepanowski et al., 2009 | |
| Reverse | GAGACCAATAGCGGAAGCC | ||||||
| erm(B) | Forward | GATACCGTTTACGAAATTGG | 58 | 1 cycle at 94 °C for 2 min, 35 cycles at 94 °C for 30 s, 58oC for 30 s, 72oC for 2 min; 1 cycle at 72oC for 5 min. | 364 | Chen et al, 2007 | |
| Reverse | GAATCGAGACTTGAGTGTGC | ||||||
| ctx-m-32 | Forward | CGTCACGCTGTTGTTAGGAA | 63 | 1 cycle at 94 °C for 2 min; 35 cycles at 94 °C for 30 s, 63oC for 30 s, 72oC for 2 min; 1 cycle at 72oC for 5 min. | 156 | Szczepanowski et al., 2009 | |
| Reverse | CGCTCATCAGCACGATAAAG | ||||||
| intI1 | Forward | ACATGCGTGTAAATCATCGTCG | 60 | 1 cycle at 94 °C for 2 min; 35 cycles at 94 °C for 30 s, 60oC for 30 s, 72oC for 2 min; 1 cycle at 72oC for 5 min | 473 | Hardwick et al., 2008; Castleberry 2018 | |
| Reverse | CTGGATTTCGATCACGGCACG |
Table 2. Primer sequences, melting temperature, and thermal cycling conditions for ermB, intI1, blaCTX-M32 , sul1.
Procedure - Agarose Gel Electrophoresis
Procedure - Agarose Gel Electrophoresis
30m 30s
30m 30s
Figure 9. Gel casting tray, and gel comb.
Prepare the agarose gel by dissolving 0.4 g of agarose and 50 mL of 1x TAE buffer in an Erlenmeyer Flask and mix gently to combine.
Cover the opening of the Erlenmeyer flask with a paper towel.
Place the mixture in the microwave for 00:00:30 , until the solution begins to bubble.
30s
Check for clarity, and if necessary, repeat until the solution is clear.
Be sure to use thermal gloves when handling the bottle to prevent burns.
Add 2 µL ethidium bromide (for tetA, tetX, tetO), or 4 µL SYBR safe (for ermB, intI1, blaCTX-M-32, sul1).
Refer to the safety information for using ethidium bromide provided in Appendix A (In 'Warnings' section) for detailed guidance.
After heating, carefully pour the mixture from the bottle into the gel casting tray, ensuring the gel comb is already in place.
Allow the mixture to cool to Room temperature until it solidifies and develops a gelatinous texture.
Figure 10. SYBR safe containers.
Place the gel, along with the casting tray, into the Gel Electrophoresis Apparatus.
Add 0.25x TAE buffer to the tank, ensuring the gel is fully submerged and completely covered by the buffer.
Load 10 µL of the PCR amplicon into the gel wells (40 µl).
Run gel at 130 V for 00:30:00 .
30m
Analyze gel under UV light to detect DNA bands for positive results.
Safety information
CAUTION: UV light can damage your eyes. Eye protection is required.
Figure 11. UV light analyzer and protective glasses used to analyze the gel.
See Appendix B (in 'Guidelines' section) for the results interpretations.
Protocol references
1. Ng, L.-K., et al. “Multiplex PCR for the Detection of Tetracycline Resistant Genes.” Molecular and Cellular Probes, vol. 15, no. 4, 15 Jan. 2001, pp. 209–215, https://doi.org/10.1006/mcpr.2001.0363.
2. Chen et al, 2007. Chen, J., Y. Zhongtang, F. C. Michel, Jr., T. Wittum, and M. Morrison. 2007. Development and Application of Real-Time PCR Assays for Quantification of erm Genes Conferring Resistance in Macrolides-Lincosamides-Streptogramin B in Livestock Manure and Manure Management Systems. Appl and Environ Micro. 73(14):4407-4416.
3. Hardwick et al., 2008 Hardwick, S.A., H.W. Stokes, S. Findlay, M. Taylor, and M.R. Gillings. 2008. Quantification of class 1 integron abundance in natural environments using real-time quantitative PCR. FEMS Microbiol. Lett. 278:207-212.
4. Szczepanowski et al., 2009. Szczepanowski, R., B. Linke, I. Krahn, K-H. Gartemann, T. Guetzkow, W. Eicher, A. Pühler, A. Schlueter. 2009. Detection of 140clinically relevant antibiotic-resistance genes in the plasmid metagenome of wastewater treatment plant bacteria showing reduced susceptibility to selected antibiotics. Microbiology. 155(7):2306-2319.
5. Thames et al., 2012 Thames, C.H., Pruden, A., James, R.E., Ray, P.P., Knowlton, K.F. Excretion of antibiotic resistance genes by dairy calves fed milk replacers with varying doses of antibiotics. Frontiers in Microbiology. (2012) 3:139 1-12.