Dec 31, 2019
Version 2
Plasmid Modification by Annealed Oligo Cloning V.2
- 1Addgene
External link: https://www.addgene.org/protocols/annealed-oligo-cloning/
Protocol Citation: Addgene The Nonprofit Plasmid Repository 2019. Plasmid Modification by Annealed Oligo Cloning. protocols.io https://dx.doi.org/10.17504/protocols.io.bawkifcw
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 31, 2019
Last Modified: December 31, 2019
Protocol Integer ID: 31404
Abstract
This protocol describes plasmid modification by annealed oligo cloning. To see the full abstract and additional resources, please visit the Addgene protocol page.
Designing overlapping oligos
Designing overlapping oligos
Briefly, we will design overlapping oligos that once annealed can be cloned directly into the overhangs generated by restriction digest of existing sites in the original vector.
To add NdeI, PacI, AscI and MfeI sites between the EcoRI and SalI sites of the vector, we design a top oligo with each of the additional sites in tandem (NdeI - CATATG, PacI - TTAATTAA, AscI - GGCGCGCC, MfeI - CAATTG). The bottom oligo will be the reverse compliment so that they can anneal.
We also need to include additional bases to complement the overhangs generated when digesting the vector with EcoRI and SalI (see diagram). To do this, we add 5' - AATTC and G - 3' to the top oligo and 3' - G and CAGCT - 5' to the bottom oligo, making our final oligos 34 bp each:
Note
Note, we could leave off the 3’ G on each oligo (and the complementary C of the other oligo), but this would destroy the EcoRI and SalI sites in the final vector.
Order the following oligos from your favorite oligo synthesis company:
| Top oligo: | 5' - AATTCCATATGTTAATTAAGGCGCGCCCAATTGG - 3' | |
| Bottom oligo: | 5' - TCGACCAATTGGGCGCGCCTTAATTAACATATGG - 3' |
Note
Note, if you plan to phosphatase treat your cut vector it is necessary to use 5'-phosphorylated oligos. This is an option that can be added when ordering them or can be performed enzymatically later.
Digest and Purify Vector
Digest and Purify Vector
While waiting for your oligos to arrive, conduct a restriction digest of 1 µg of vector with EcoRI and SalI
Run an agarose gel and cut out the band containing your vector DNA
Gel purify your DNA away from the agarose using a commercially available kit or standard protocol.
Anneal Oligos
Anneal Oligos
Anneal oligos
The oligos should be resuspended in annealing buffer (10mM Tris, pH7.5-8.0, 50mM NaCL, 1mM EDTA) and mixed in equimolar concentrations. We recommend mixing 2 µg each in a total volume of 50 µL - add additional annealing buffer if necessary to get to 50μL. Efficient annealing can be achieved by one of two methods:
Method 1
- Place the mixed oligos in a 1.5mL microfuge tube.
- Place tube in 90 °C -95 °C hot block and leave for 00:03:00 -00:05:00 .
- Remove the hot block from the heat source (turn off or move block to bench top) allowing for slow cooling to Room temperature (~00:45:00 ).
Method 2
- Place mixed oligos in a PCR tube.
- Place tube in a thermocycler programmed to start at 95 °C for 00:02:00 .
- Then, gradually cool to 25 °C over 00:45:00 .
Ligitation
Ligitation
Dilute 5 µL of annealed oligos with 45 µL nuclease-free water and quantify the concentration (should be about 8ng/μl).
Mix the annealed oligos with cut vector in molar ratios (vector:insert) between 4:3 and 1:6 in a standard ligation reaction (ex. to ligate an annealed oligo insert of 50bp in length into a 5kb vector, mix 100ng of the vector with 750 µg -6 ng of annealed oligos).