Jul 10, 2024
PiggyBac plasmids
- 1Duke University
Document Citation: Shiyi Wang 2024. PiggyBac plasmids. protocols.io https://dx.doi.org/10.17504/protocols.io.dm6gpj771gzp/v1
License: This is an open access document distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Created: May 23, 2023
Last Modified: July 10, 2024
Document Integer ID: 82337
Keywords: ASAPCRN
Funders Acknowledgement:
Aligning Science Across Parkinson’s (ASAP) initiative
Grant ID: ASAP-020607
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
How to make PiggyBac plasmids
1. pPB-CAG-EGFP and pGLAST-PBase were a gift from Dr. Joseph Loturco.
2. To generate pPB-CAG-mCherry-CAAX, mCherry-CAAX was inserted between XmaI and NotI restrictions sites to replace EGFP.
3. To insert the hU6 promoter and shRNA in pPB-CAG-mCherry-CAAX, a DNA fragment containing hU6 and shRNA was amplified from pLKO.1-shRNA using Phusion High-Fidelity DNA Polymerase (NEB) with primers that introduced SpeI restriction sites (Forward Primer: GGACTAGTCAGGCCCGAAGGAATAGAAG; Reverse Primer: GGACTAGTGCCAAAGTGGATCTCTGCTG).
4. PCR products were purified, digested with SpeI, and ligated into pPBCAG-mCherry-CAAX at the SpeI restriction site.
5. An analytical digest with EcoRI followed by sequencing was used to confirm the orientation of the inserted DNA fragment.