Feb 10, 2023

Public workspacePCR-NGS for RNA viruses

DOI
dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
  • Masayasu Misu1,2,
  • Tomoki Yoshikawa1,
  • Satoko Sugimoto1,
  • Yuki Takamatsu1,
  • Takeshi Kurosu1,
  • Yukiteru Ouji2,
  • Masahide Yoshikawa2,
  • Masayuki Shimojima1,
  • Hideki Ebihara1,
  • Masayuki Saijo1
  • 1Department of Virology I, National Institute of Infectious Diseases;
  • 2Department of Pathogen, Infection and Immunity, Nara Medical University
Masayasu Misu
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
Protocol Citation: Masayasu Misu, Tomoki Yoshikawa, Satoko Sugimoto, Yuki Takamatsu, Takeshi Kurosu, Yukiteru Ouji, Masahide Yoshikawa, Masayuki Shimojima, Hideki Ebihara, Masayuki Saijo 2023. PCR-NGS for RNA viruses. protocols.io https://dx.doi.org/10.17504/protocols.io.x54v9d361g3e/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 27, 2023
Last Modified: February 10, 2023
Protocol Integer ID: 75970
Keywords: Oxford Nanopore Technology, RNA virus, Sequence method, MinION, Nanopore sequencing, cDNA-PCRseq, PCR-NGS
Abstract
This PCR-NGS were optimized for an NGS machine, MinION. These methods do not require nucleic acid amplification with virus-specific PCR primers, physical viral particle enrichment, and RACE.

These methods enable whole RNA viral genome sequencing by combining the following techniques:
1) Removal of unwanted DNA and RNA other than the RNA viral genome by nuclease treatment.
2) The terminal of viral genome sequence determination by barcoded linkers ligation.
3) Amplification of the viral genomic cDNA using ligated linker sequences-specific PCR.

This method can be exploited to determine any whole RNA viral genomes (i.e., single-stranded, double-stranded, positive-stranded, negative-stranded, non-segmented or multi-segmented genomes).


Materials
  • ReagentMicrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S
  • ReagentHigh Pure Viral RNA KitRocheCatalog #11858882001
  • ReagentTurbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907
  • NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10
  • ReagentT4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S
  • The barcode-polyA linker DNA (e.g., The cSP6-polyA linker DNA)
  • PCR barcoding kit - Oxford Nanopore Technologies Catalog #SQK-PBK004
  • cDNA-PCR Sequencing kit - Oxford Nanopore Technologies Catalog #SQK-PCS109
  • ReagentDeoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S
  • ReagentSuperase-In RNase InhibitorThermofisherCatalog #AM2694
  • Maxima H Minus Reverse Transcriptase - Life Technologies, Catalog #EP0752
  • ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880
  • KOD One PCR Master Mix - TOYOBO Catlog #KMM-101
  • ReagentQ5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S
  • ReagentExonuclease I Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0293S
  • ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
  • ReagentQubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
  • ReagentDNA LoBind Tube 1.5ml EppendorfCatalog #022431021
  • Reagent0.2 ml PCR Tube stripsEppendorfCatalog #0030124359
  • 70 % ethanol
  • TE(pH8.0)
  • nuclease-free H2O




Protocol materials
ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880
Materials, Step 12
ReagentExonuclease I Reaction Buffer - 6.0 mlNew England BiolabsCatalog #B0293S
Materials
ReagentTurbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907
Materials, Step 5
ReagentSuperase-In RNase InhibitorThermofisherCatalog #AM2694
Materials, Step 9.2
ReagentQubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
Materials, Step 13
Reagent0.2 ml PCR Tube stripsEppendorfCatalog #0030124359
Materials, Step 6.5
ReagentT4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S
Materials, Step 7
ReagentDeoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S
Materials, Step 9.1
ReagentDNA LoBind Tube 1.5ml EppendorfCatalog #022431021
Materials, Step 4.5
ReagentQ5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S
Materials, Step 10
ReagentMicrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S
Materials, Step 3
ReagentHigh Pure Viral RNA KitRocheCatalog #11858882001
Materials, Step 4
ReagentQubit 4 FluorometerThermo Fisher ScientificCatalog #Q33238
Materials
ReagentExonuclease I (E.coli) - 3,000 unitsNew England BiolabsCatalog #M0293S
Step 11
Safety warnings
Follow your facility's regulations and biosafety practices.
Before start
This method was only confirmed to work with the working stocks that contain isolated RNA viruses at least 3.0 × 105 TCID50 per ml.
It is recommended to check no bacterial contamination(e.g., Mycoplasma spp.).
Preparation for virus supernatant
Preparation for virus supernatant
Centrifuge the working stock virus to remove debris.
Centrifigation6000 x g, Room temperature, 00:10:00

10m
Transfer Amount180 µL virus supernatant to a 1.5ml screw cap tube.
Unwanted DNA and RNA mainly originating from the virus-infected cells are digested usingReagentMicrococcal Nuclease - 320,000 gel unitsNew England BiolabsCatalog #M0247S .
Total 201 μl reaction

  • Amount180 µL virus supernatant
  • Amount20 µL 10X Micrococcal Nuclease Reaction Buffer
  • Amount1 µL Micrococcal nuclease

Mix by pipetting and spin down.
Temperature37 °C water bath Duration01:00:00


1h
The viral RNA extraction
The viral RNA extraction
The viral genomic RNA extraction is performed using ReagentHigh Pure Viral RNA KitRocheCatalog #11858882001 .
Add Amount400 µL of binding buffer (with Amount4 µL PolyA carrier RNA).

Mix gently by ~5 times pipetting and flicking thoroughly the tube, and spin down.
TemperatureRoom temperature Duration00:10:00
10m
Transfer the sample to a High Pure Filter Tube.
Centrifigation8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add Amount500 µL of inhibitor removal bo transfer the sample to a High Pure Filter Tube.
Centrifigation8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add Amount450 µL of wash buffer.
Centrifigation8000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.
1m
Add Amount450 µL of wash buffer.
Centrifigation13000 x g, Room temperature, 00:01:00 and discard the flow-through liquid.

Discard the Collection Tube and insert the Filter Tube into a 1.5 ml tube(ReagentDNA LoBind Tube 1.5ml EppendorfCatalog #022431021 ).
1m
Add Amount50 µL Elution Buffer.
Centrifigation13000 x g, Room temperature, 00:01:00

Note
The eluted RNA can be stored at -80℃.

1m
Remove unwanted DNA
Remove unwanted DNA
Unwanted DNA mainly from the virus-infected cells in the RNA sample is digested using a ReagentTurbo DNA-free KitInvitrogen - Thermo FisherCatalog #AM1907 .
Total 56 μl reaction

  • Amount50 µL the eluted RNA
  • Amount5 µL 10X reaction buffer
  • Amount1 µL DNase I

Mix gently by pipetting and spin down.
Temperature37 °C Duration00:30:00
30m
The viral RNA is purified using NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.
Add equal volume Amount56 µL of Buffer RCU and mix gently.
Transfer the sample to a NucleoSpin RNA XS Column.
Centrifigation11000 x g, Room temperature, 00:01:00
1m
Wash the column by Amount400 µL Buffer RA3.
Centrifigation11000 x g, Room temperature, 00:01:00

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a new Collection Tube.
1m
Wash the column by Amount200 µL Buffer RA3.
Centrifigation11000 x g, Room temperature, 00:02:00

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a Nuclease-free Collection Tube(1.5 ml).
2m
Add Amount10 µL RNase-free H2O.
Centrifigation11000 x g, Room temperature, 00:01:00
Transfer the sample to a 0.2 ml PCR tube -Reagent0.2 ml PCR Tube stripsEppendorfCatalog #0030124359 .
1m
cSP6-polyA Linker DNA ligation
cSP6-polyA Linker DNA ligation

The viral RNA is ligated with cSP6-polyA Linker DNA usingReagentT4 RNA Ligase 2, truncated KQ - 2,000 unitsNew England BiolabsCatalog #M0373S .
  • The RNA is ligated to the 3' end with the barcoded(complementary sequence of SP6 (cSP6)) polyA linker DNA. It is able to identify the 3’ terminal viral genome sequence. The PolyA sequence is required for reverse transcription for ONT kit (SQK-SQK-PBK004/PCS109).
Note
The cSP6-polyA linker DNA (5'-5rApp-CTATAGTGTCACCTAAATCAAAAAAAAAAAAAAAAAAAA-3ddC-3'), which is pre-adenylated at the 5' terminal (5rApp), and consists of the complementary sequence of SP6 (CTATAGTGTCACCTAAATC), oligo (dA) 20, and dideoxycytidine (3ddC) at the 3' terminal, was synthesised for 3' linker ligation by Integrated DNA Technologies (Coralville, IA).




Total 20 μl reaction

  • Amount10 µL Purified RNA
  • Amount1 µL 10 μM the cSP6-polyA linker DNA
  • Amount2 µL 10X T4 RNA Ligase Reaction Buffer
  • Amount6 µL 50% PEG8000 solution
  • Amount1 µL T4 RNA Ligase 2, truncated KQ

Mix gently by pipetting and spin down.
Incubation Temperature25 °C Duration00:15:00

15m
The viral RNA purification by NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.
Go togo to step #6

Fill the sample to 100 μl with 80 μl TE (pH 8.0) and add 100 μl (equal volume) of Buffer RCU.

Eluted by 10 μl of RNase-free H2O and transfer the sample to a 0.2 ml PCR tube.
Reverse transcription with strand-switching, SQK-PBK004/ PCS109
Reverse transcription with strand-switching, SQK-PBK004/ PCS109
The viral RNA is reverse transcribed using Maxima H Minus Reverse Transcriptase - Life Technologies, Catalog #EP0752, PCR barcoding kit - Oxford Nanopore Technologies Catalog #SQK-PBK004, cDNA-PCR Sequencing kit - Oxford Nanopore Technologies Catalog #SQK-PCS109.

The following protocol is modified based on the cDNA-PCR Sequencing protocol (PCSB_9086_v109_revK_14Aug2019) provided by Oxford Nanopore Technologies website.

Note
<cDNA-PCR Sequencing kit (SQK-PCS109)>
RT primer and strand-switching primer
  • VN primer (VNP): 5' - 5phos/ ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN - 3'
Where V = A, C, or G, and N = A, C, G, or T

  • Strand-Switching Primer(SSP): 5' - TTTCTGTTGGTGCTGATATTGCT mGmGmG - 3'


Set up pre-mixture 1

  • Amount9 µL RNA (~ 50ng)
  • Amount1 µL VN primer (VNP)
  • Amount1 µL 10mM dNTP - ReagentDeoxynucleotide (dNTP) Solution MixNew England BiolabsCatalog #N0447S

Mix gently by flicking the tube, and spin down.
Temperature65 °C Duration00:05:00 and Temperature4 °C on ice Duration00:01:00


6m
Set up pre-mixture 2

  • Amount11 µL pre-mixture 1
  • Amount4 µL 5X RT buffer
  • Amount1 µL nuclease-free H2O
  • Amount1 µL RNase OUT - ReagentSuperase-In RNase InhibitorThermofisherCatalog #AM2694
  • Amount2 µL Strand-Switching Primer(SSP)

Mix gently by flicking the tube, and spin down.
Temperature42 °C Duration00:02:00


2m
Add Amount1 µL Maxima H Minus Reverse Transcriptase and mix gently by flicking the tube, and spin down. (Total 20 μl reaction).

Temperature42 °C Duration01:30:00
Temperature85 °C Duration00:05:00


1h 35m
PCR with barcoding
PCR with barcoding
33m 20s
33m 20s
PCR enzyme;
KOD One PCR Master Mix - TOYOBO Catlog #KMM-101
or
ReagentQ5 Hot Start High-Fidelity 2X Master Mix - 100 rxnsNew England BiolabsCatalog #M0494S


PCR reaction is as follows:

  • Amount5 µL cDNA
  • Amount3 µL LWB (barcoding primer)
  • Amount42 µL nuclease-free water
  • Amount50 µL PCR enzyme (KOD One / Q5)
The reaction mix should be aliquoted in appropriate portions in accordance with the PCR machine used.

<KOD One PCR Master Mix>
Step Temperature Time
Heat Activation Temperature98 °C Duration00:00:15

30 cycles of 3 steps
Denaturation Temperature98 °C Duration00:00:10
Annealing Temperature62 °C Duration00:00:05
Extension Temperature68 °C 35sec or 5 sec/kb
Temperature68 °C Duration00:02:00

Note
A 35 sec extension is used for viruses with a genome size of less than 7 kb/segment, whereas a 5 sec/kb is employed in other cases.


<Q5 Hot Start High-Fidelity 2X Master Mix>
Step Temperature Time
Heat Activation Temperature98 °C Duration00:00:30

30 cycles of 3 steps
Denaturation Temperature98 °C Duration00:00:10
Annealing Temperature72 °C Duration00:00:10
Extension Temperature72 °C 40 sec/kb
Temperature72 °C Duration00:02:00


5m 20s
Add Amount1 µL X 2 tube ReagentExonuclease I (E.coli) - 3,000 unitsNew England BiolabsCatalog #M0293S .

Temperature37 °C Duration00:15:00
Temperature80 °C Duration00:15:00
30m
The PCR product is purified using ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880 .
Prepare AMpure XP reagent for use; resuspend by vortexing.
Transfer amplified DNA sample to 1.5ml low binding tube.

Add Amount80 µL (X 0.8 volume) AMPure XP reagent and mix by pipetting.
Incubate on rotor mixer.
Duration00:05:00 TemperatureRoom temperature

5m
Spin down and pellet on a magnet. Wait for Duration00:01:00 and pipette off the supernatant.
1m
Wash three times by Amount200 µL 70 % ethanol and remove the ethanol using a pipette and discard.
Spin down and pipette off any residual ethanol.
  • Resuspend pellet in Amount12 µL Elution Buffer (EB).
Temperature37 °C Duration00:03:00 and tapping occasionally.
Incubate on rotor mixer.
Duration00:07:00
10m
Spin down and pellet the beads on the magnet until the elute is clear and colourless.
Remove retain Amount12 µL elute into a new tube.

DNA concentration is measured using a Qubit 4 Fluorometer with ReagentQubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230 .

  • Amount199 µL 1X working solution
  • Amount1 µL DNA

Mix by vortexing.

Incubate Duration00:02:00 TemperatureRoom temperature and measure.

Note
The molar quantity of cDNA in the sample can be converted from the concentration through the utilization of the viral genome length or the mean viral genome length if the viral genome is segmented.

2m
Adaptor Ligation
Adaptor Ligation
  • Add Amount1 µL of Rapid Adaptor (RAP)(SQK-PBK004, SQK-PCS109) to Amount11 µL library DNA(total approximately 100 fmol).

Mix gently and incubate TemperatureRoom temperature Duration00:05:00 .

5m
Sequencing by MinION
Sequencing by MinION
Sequencing according to the manufacturer's instructions.