Nov 25, 2024
Version 2
Pan-microbial metagenomics protocol v1.2 V.2
- Adela Alcolea-Medina1,2,
- Luke Blagdon Snell1,3,
- Chris Alder4,3,
- Rahul Batra3
- 1King's College London;
- 2Synnovis LLP;
- 3Guy's & St. Thomas' NHS Foundation Trust;
- 4Oxford Nanopore Technologies
Protocol Citation: Adela Alcolea-Medina, Luke Blagdon Snell, Chris Alder, Rahul Batra 2024. Pan-microbial metagenomics protocol v1.2. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2lyw5qpvx9/v2Version created by Adela Alcolea-Medina
Manuscript citation:
Unified metagenomic method for rapid detection of microorganisms in clinical
samples. Commun Med (Lond). 2024 Jul 7;4(1):135. doi:
10.1038/s43856-024-00554-3. PMID: 38972920
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 04, 2024
Last Modified: November 25, 2024
Protocol Integer ID: 107341
Keywords: metagenomics, respiratory metagenomics, clinical metagenomics, human depletion
Funders Acknowledgement:
Medical Research Council
Grant ID: MR/W025140/1
Medical Research Council
Grant ID: MC_PC_19041
Disclaimer
This workflow is not accredited.
This mechanical human DNA depletion method is patent pending (PCT/GB2023/051417)
Abstract
Version 1.2 of the pan-microbial metagenomics protocol enhances the depletion of human DNA in clinical samples and improves the detection of microorganisms and resistance genes. The improvements include the double bead-beating step and the use of a more effective endonuclease enzyme. Magnesium is added to optimise the reaction, which is then halted with EDTA.
Another key modification is the processing of BAL samples, which no longer undergo centrifugation prior to bead-beating.
Please remember to cite the original manuscript: Alcolea-Medina et al. Unified metagenomic method for rapid detection of microorganisms in clinical samples. Commun Med (Lond). 2024 Jul 7;4(1):135. doi: 10.1038/s43856-024-00554-3. PMID: 38972920
Materials
| A | B | |
| Reagent | Company | |
| Lysis Matrix D 2mL Tube | MP Biomedicals | |
| MSAN enzyme | ArcticZymes Technologies | |
| EDTA (0.5M) | Thermo Scientific | |
| MgCl2 (1M) | Serva | |
| LunaScript RT SuperMix Kit (E3010) | New England Biolabs | |
| Sequenase Version 2.0 DNA Polymerase | ThermoFisher Scientific | |
| LongAmp Taq 2X Master Mix | New England Biolabs | |
| Rapid barcoding Kit SQK-RPB004 | Oxford Nanopore Thechnology | |
| AMPure XP Beads | BeckmanCoulter | |
| Qubit 1X dsDNA High Sensitivity (HS) (Q33230) | ThermoFisher Scientific | |
| NATtrol Respiratory Panel 2.1 (RP2.1) Controls | Zeptometrix | |
| Viasure respiratory panel III (PCR for PC) | Pro-labs | |
| Tobacco mosaic virus (PC-0107) | DSMZ | |
| TMV primers: TMV_fwd_aps -Catalog number: 10336022 GGATATGTCTAAGTCTGTTGC 10629186 Nucleotides (25 nmole) 11732013 Desalted574910 W7149 (E12) TMV_fwd_aps 574910 W7149 (F01) 3 TMV_rvr_aps TMV_rvr_aps -Catalog number: 10336022 CAGACAACTCGGGTGCG 10629186 Nucleotides (25 nmole) 11732013 Desalted | Invitrogen | |
| Fast SYBR‱ Green Master Mix | Applied Biosystem | |
| Microbial DNA-Free Water (ID: 338132) Qiagen | ThermoFisher Scientific | |
| RESPIRATORY SWAB MATRIX NEGATIVE CONTROL | Vircell | |
| Ethanol | ||
| Elution buffer | ONT |
| A | B | |
| Equipment | Company | |
| TissueLyser LT | Qiagen | |
| Thermocycler for the lib prep | VeritiPro Thermal Cycler | |
| Sorvall Legend X1 / X1R centrifuge | Thermo Scientific | |
| Real-time Thermocycler | Quantstudio 7 | |
| Eppendorf ThermoMixer | Eppendorf | |
| Qubit 4 Fluorometer | ThermoFisher Scientific |
Preparation of quality controls:
Preparation of quality controls:
Positive control: NATtrol‱ Respiratory Panel 2.1 (RP2.1) Controls (Zeptometrix)
Mix 300μL of control 1 and 300μL of control 2 in an Eppendorf. Label with date and LOT number.
Vortex for 1 minute and Centrifuge at 1,200xg for 5min immediately prior to each use.
Aliquot the volume specified by the manual or automated extraction method and process in parallel with equivalent clinical sample volumes.
Store the mixed positive controls at 4°C, it can be used for two extractions.
Run a target PCR (Viasure respiratory panel III) anytime a new box is opened and record it on the trend analysis spreadsheet.
Negative control: Respiratory Swab Matrix Negative Control (Vircell)
Negative control: Respiratory Swab Matrix Negative Control (Vircell)
Add 500μL of Microbial DNA-Free Water to a vial and mix until completely reconstituted as per
manufacturer’s instructions. Vortex for 30 sec to dissolve and homogenise completely. Spike with
1μL of TMV.
Internal control (IC): Tobacco Mosaic Virus (TMV) PC-0107 (DSMZ)
Internal control (IC): Tobacco Mosaic Virus (TMV) PC-0107 (DSMZ)
Reconstitute a new vial of TMV every Monday with 3mL of Microbial DNA-Free Water
(Qiagen). Vortex for 1 min.
Aliquot 500μL of IC into six Eppendorf tubes, labelling each tube with the preparation date and lot number. Store at 4°C.
Use one aliquot per day to spike your samples and negative control, vortex for 1 min before spiking
For every new vial reconstituted, TMV target PCR should be performed and Ct values should be recorded for trend analysis.
- 200ul of neat was extracted directly from the vial (no depletion performed).
-In our hands the Ct value was 5-6
Discard any remaining volume from used aliquot each day and any remaining aliquots by
Friday.
Spiking samples with the internal control (IC):
Spike samples with 1μLof TMV in the following samples:
-Broncho-alveolar lavage (BAL)
-Non-directed Broncho-alveolar lavage (NBL)
-Endotracheal tube (ETT) aspirates
-Sputum (SPT)
-Nasal throat swabs (NTS)
Spike with 0.5μL of TMV the following samples:
-Pleural fluids (PF)
Sample preparation:
Sample preparation:
-Respiratory samples validated for this protocol are: BAL, NBL, ETT, NTS, sputum and PF.
-Samples processed should be fresh up to two days old storage in the fridge, older than that it could
not be guarantee the RNA virus detection.
- Samples are processed in a different way depending on the sample type.
Sputum and ETT:
Sputum and ETT:
Mucoid samples such as sputum or ETT should be mucolysed before starting the Human DNA depletion process as follows:
Add approximately 2 mL sputum into a numbered, sterile, plastic universal container or if 2 mL
already in original container then do the following:
Add equal volume (2mL) of mucolytic agent Mucolyse to the sample container and Vortex in the safety cabinet for 30 sec.
Leave until liquefication at room temperature (RT).
Gently agitate for a further 15 sec before to proceed to the human DNA depletion
If after mucolysing the sample it is still mucoid, pipette 500μL of the sample and mix with 500μLof
PBS, vortex well and proceed with the human DNA depletion.
Human DNA depletion:
Human DNA depletion:
The human DNA depletion is three steps: centrifugation, bead-beating and endonuclease treatment.
However, BAL and NBL aspirates are not centrifuged and processed in a different way depending on the appearance of the sample. This is due to the different composition of the sample.
For turbid and mucoid samples: the human DNA depletion is performed by double bead-beating and endonuclease treatment.
For clear samples with watery appearance even those with some debris: the human DNA depletion should be avoided and the sample should just be extracted.
1) Centrifugation:
1) Centrifugation:
Vortex the sample
Centrifuge speed 1,200xg for 10 min.
Aliquot 500μL of the supernatant into an Eppendorf tube
If centrifugation is being removed then vortex sample well and add 500ul of whole sample.
Spike 1μL of TMV to the sample (as indicated above) and 0.5μL for processing a PF and NTS. Make sure to vortex the TMV aliquot before use.
Vortex the sample with the TMV
Procced with double bead beating.
2) Bead beating and depletion of free nucleic acid, followed by extraction:
2) Bead beating and depletion of free nucleic acid, followed by extraction:
Transfer sample from Eppendorf (500ul) to the Matrix
Lysing D tube (MP biomedicalsTM) after vortexing for 1 min.
Place the matrix tube into the TissueLyser LT (Qiagen). Bead-beat at 50 osc for 3min.
Bead-beat again for 3mins at same settings.
Note: sometimes the sample will become foamy after bead-beating, this is ok.
Meanwhile add 10μL of M-SAN enzyme (ArticZymes Technology) with 1μL of MgCl2 (1M) in new Eppendorf tube (1.5 ml) for each sample.
Transfer 200μL of the bead-beaten sample to Eppendorf tubes containing M-SAN, placing the tip at the
bottom of the tube to take-up the liquid instead of the foam.
Incubate for 10’ at 37⁰C at 1000rpm in the Eppendorf ThermoMixer (EppendorfTM).
Add 4ul of EDTA (0.5M) to stop the MSAN reaction.
Transfer 200μL to Magnapure 24 (RocheTM) for extraction or proceed using alternative
extraction methods validated in your own laboratory
1. Microbial nucleic acid processing and PCR amplification
1. Microbial nucleic acid processing and PCR amplification
RT-dsDNA:
Transfer 16μL of the 50μL extract (from Magnapure) to a PCR tube and add 4μL of
LunaScript‱ RT SuperMix.
Mix by flicking the tube and briefly spinning down in a small bench
top Eppendorf centrifuge.
Place the tube in the thermocycler and incubate at 25⁰C for 2 min, 55⁰C for 10
min, 95⁰C for 1 min.
Prepare the master mix for the double strand synthesis using the Sequenase Version 2.0
DNA Polymerase using the following volumes:
Table 1: Reagents required for DsDNA master mix.
Add 11.2μL of the master mix to the 20μL of product post RT step. Mix by flicking the
tube and briefly spin down.
Place the tube in the thermocycler. Incubation at 37⁰C for 8 min.
Prepare stock of 70% (700μL absolute ethanol+ 300μL of Microbial DNA-free water for
1mL) ethanol in Microbial DNA-Free Water.
Add 45μL of resuspended AMPure XP Beads (AXP) into a new Eppendorf tube for each
sample.
Add all of the product post dsDNA synthesis (31.2μL) into the Eppendorf tube containing
the beads, mix well by flicking the tube and incubate at RT for 5 min.
Briefly spin down the samples and pellet the beads on a magnet until the eluate is clear
and colourless. Keep the tubes on the magnet and discard the supernatant.
Keep the tubes on the magnet and wash the beads with 200μL of freshly prepared 70%
ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step.
Briefly spin down and place the tubes back on the magnet. Pipette off any residual
ethanol with the 10p pipette. Allow to dry for 30 sec, but do not dry the pellet to the
point of cracking.
Remove the tubes from the magnetic rack and resuspend the pellet in 12μL of Microbial
DNA free water. Spin down and incubate for 2 min at RT.
Pellet the beads on a magnet until the eluate is clear and colourless.
Remove and retain 10μL of eluate for each sample into clean 1.5 mL Eppendorf DNA
LoBind tubes, individually.
NOTE: the sample can be store at -80°C after the RT or dsDNA step
2. Library preparation Rapid PCR Barcoding Kit (SQK-RPB004) Oxford Nanopore:
2. Library preparation Rapid PCR Barcoding Kit (SQK-RPB004) Oxford Nanopore:
Add 3μL of the previous product (dsDNA) to a new PCR tube with 1μL of FRM (from ONT Rapid PCR barcoding kit SQK -RPB004). Mix by flicking the tube and briefly spin down.
Place the tube in the thermocycler and incubate at 30⁰C for 1 min and then 80⁰C for 1
min.
Mix by gently flicking the tube and briefly spin down.
Prepare the master mix for the PCR, adding 20μL of water and 25μL of LongAmp Taq 2X
Master Mix per sample and 1μL of the barcode primers to 4μL of the product obtained after
FRM step.
Mix by gently flicking the tube and briefly spin down.
Place in the thermocycler. Incubate @ 95⁰ 3’, (95⁰ 15’’, 56⁰ 15’’, 65⁰ 4’) x30, 65⁰ 4’
Post PCR:
Post PCR:
Perform Qubit‱ 1X dsDNA High Sensitivity (HS) on the PCR products as the
manufacturer’s instructions.
Table 2: Data collection for qubit concentrations and volume (μL) per sample being added to the pool.
Pool samples as follows:
Based on the qubit readings, prioritise samples with a qubit reading below 1 ng/µL. For
these samples, normalise the qubit concentration of your PCR products to 100 ng/µL.
n=sample
e.g. 100/(n)0.6= 166.67 add the total volume of PCR product.
Clean up 1:1 by adding the same volume of resuspended AMPure XP Beads (AXP) to the same volume of the pooled samples. for example, 50μLof pool = 50μL of beads
Mix well by flicking the tube, incubate for 5 min in the Hula mixer (rotor mixer) at
RT.
Briefly spin down the samples and pellet the beads on a magnet until the eluate is clear
and colourless. Keep the tubes on the magnet and discard the supernatant.
Keep the tubes on the magnet and wash the beads with 200μL of freshly prepared 70%
ethanol without disturbing the pellet. Remove the ethanol using a pipette and discard.
Repeat the previous step.
Briefly spin down and place the tubes back on the magnet. Pipette off any residual
ethanol with the 10p pipette. Allow to dry for 30 sec, but do not dry the pellet to the
point of cracking.
Remove the tubes from the magnetic rack and resuspend the pellet in 15μL Microbial
DNA-Free Trish buffer. Spin down and incubate for 2 min at RT.
Pellet the beads on a magnet until the eluate is clear and colourless.
Remove and retain 10μL of eluate into clean 1.5 mL Eppendorf DNA LoBind tubes,
individually. Make sure no beads are remaining.
-Add RAP 1μLto 10μL of template, mix gently by flicking the tube, spin down and incubate
at RT for 5 min.
- Add 25.5μL of LB
- Add 34μL of SQB
- Add 4.5μL of water
- Mix gently pipetting up and down
Flowcell loading:
Flowcell loading:
Thaw FLB and FLT at RT if not thawed from before.
Add 30μL of FLT (vortex and spin before by pipetting) to a FLB (vortex before by pipetting). Mix by vortex.
Open the GridION device lid and slide the flow cell under the clip. Press down firmly on
the flow cell to ensure correct thermal and electrical contact.
Slide the flow cell priming port cover clockwise to open the priming port.
After opening the priming port, check for a small air bubble under the cover. Draw back
a small volume to remove any bubbles.
Set a P1000 pipette to 200μL and insert the tip into the priming port.
Turn the wheel until the dial shows 220-230μL , to draw back 20-30μL , or until you can
see a small volume of buffer entering the pipette tip
Note: Visually check that there is continuous buffer from the priming port across the sensor array.
Load 800μL of the priming mix into the flow cell via the priming port, avoiding the
introduction of air bubbles. Wait for five min.
Gently lift the SpotON sample port cover to make the SpotON sample port accessible.
Load 200μL of the priming mix into the flow cell priming port (not the SpotON sample
port), avoiding the introduction of air bubbles.
Mix the prepared library gently by pipetting up and down just prior to loading.
Add 75μL of the prepared library to the flow cell via the SpotON sample port in a
dropwise fashion. Ensure each drop flows into the port before adding the next.
Gently replace the SpotON sample port cover, making sure the bung enters the SpotON
port, close the priming port and replace the MinION or GridION device lid.
GridION settings:
GridION settings:
Select the position of your flow cell on MinKNOW.
Type your experiment name and sample ID.
Continue to kit selection and select Rapid PCR barcoding kit SQK -RPB004.
Continue to run options and change to 24hr.
Continue to analysis and edit options and select barcode both ends and mid read barcode filtering.
Continue to output and unselect fast 5 and edit FastQ to 100 reads per file.
Bioinformatic pipeline and reporting:
Bioinformatic pipeline and reporting:
Curated bioinformatic pipeline will generate automatic reports at 30 min (for organism
identification) and 2 hr (for AMR determinants). 16-24 hr reports can be generated
manually for SNP typing and genomic alignment.
NOTE: A new version will be available soon.
qPCR for the TMV
qPCR for the TMV
The RT step is performed using the LunaScript master mix explained previously in the step 39.
Master-mix calculations as followed:
Table 3: Reagents required for TMV qPCR
1094/PHYTO-06-19-0201-FI. Epub 2019 Nov 18. PMID: 31502520.
Primer sequence for TMV:
-TMV_fwd_aps:
Catalog number: 10336022
GGATATGTCTAAGTCTGTTGC
10629186 Nucleotides (25 nmole) 11732013 Desalted.
-TMV_rvr_aps:
Catalog number: 10336022
CAGACAACTCGGGTGCG
10629186 Nucleotides (25 nmole) 11732013 Desalted.
1 cycle at 95°C for 20 s, 40 cycles at 95°C for 1 s, 40 cycles at 60°C for 20 s, 1 cycle at 95°C for 15 s, 1
cycle at 60°C for 1 min, and 1 cycle at 95°C for 15 s
The validation of this method is available on Unified metagenomic method for rapid detection of microorganisms in clinical samples | Communications Medicine (nature.com).