Sep 08, 2020
OnsiteGene 1 Protocol Nasal Direct
- yliu1
- 1OnsiteGene Inc.
- OnsiteGene 1
- XPRIZE Rapid Covid Testing
Protocol Citation: yliu 2020. OnsiteGene 1 Protocol Nasal Direct. protocols.io https://dx.doi.org/10.17504/protocols.io.bkudkws6
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 04, 2020
Last Modified: September 08, 2020
Protocol Integer ID: 41573
Keywords: XDive, superfast PCR, superfast RT-qPCR, fast PCR,
Abstract
This OnsiteGene protocol is designed for testing the nasal swab samples without nucleic acid extraction. It uses the Star Array® Hi-SenseTM COVID-19 Molecular Testing Kit 1.0 in the one-step real-time RT-qPCR test assay to qualitatively detect RNA from SARS-CoV-2 virus in the human respiratory specimen. It combines the reverse transcription technology and real-time PCR method to provide accurate detection of the SARS-CoV-2 coronavirus. Along with the Star Array® SATM Direct Extract Buffer, the protocol supports direct amplification without the need of specific RNA extraction equipment and kit. It significantly reduces the loss of RNA from the sample extraction and purification process, saves time and workload from sample preparation, and minimized the burdens on supply chain. The triplex fluorescence design of the kit simultaneously detects the N1 and Orf1ab genes of the virus and the human RNase P gene as an internal control to ensure the sample quality. This protocol uses the Star Array® XDiveTM Superfast Real-Time RT-qPCR instrument to perform 40-cycle PCR in 8 minutes, and can test up to 16 samples or controls in each run. The total protocol time from sample collection to data interpretation is less than 11 minutes.
Materials
Instruments and Consumables
| Instrument and Consumable | Supplier | Catalog # | |
| Real-Time PCR | OnsiteGene | XDIVE-16 | |
| Block heater | FOUR E'S SCIENTIFIC | TC0401005-UUSSAA | |
| Mini centrifuge | Heathrow Scientific | HS120395 | |
| Vortex | Four E's Scientific | 4ESS-MI0101002D | |
| Reaction tube and cap | OnsiteGene | CM1010001 | |
| Pipette set | Microlit | RBOKit | |
| Pipette tips | Extragene | TS-10-RS |
Sample Colletion and Extraction Kit
| Reagent or Consumable | Supplier | Catalog # | |
| Swab | Medcomma | MFS-03-01 | |
| 1.5ml microcentrifuge tube | Biologix | 88-915X | |
| 500uL PCR tube | Biologix | 88-902X | |
| Direct RNA release buffer | OnsiteGene | RG2010001 | |
| Storage solution | OnsiteGene | RG0000001 |
PCR Reaction Reagents
| Reagent | Supplier | Catalog # | |
| Hi-Sense COVID detection kit | OnsiteGene | KT1010001 | |
| External positive control | ZeptoMetrix | NATSARS(COV2)-ERC |
Primer and Probe Sequences
| Target Number | Target Gene | Sequence/antibody | |
| 1_F | N1 | GACCCCAAAATCAGCGAAAT | |
| 1_R | N1 | TCTGGTTACTGCCAGTTGAATCTG | |
| 1_P | N1 | ACCCCGCATTACGTTTGGTGGACC | |
| 2_F | ORF1ab | TATGTGGAAAGGTTATGGCTGTAG | |
| 2_R | ORF1ab | GATTGTGCATCAGCTGACTGAAG | |
| 2_P | ORF1ab | TTGTGATCAACTCCGCGAACCCATG | |
| 3_F | Rnase P | AGATTTGGACCTGCGAGCG | |
| 3_R | Rnase P | GAGCGGCTGTCTCCACAAGT | |
| 3_P | Rnase P | TTCTGACCTGAAGGCTCTGCGCG |
Safety warnings
Most institutions will require samples potentially containing full-length SARS-CoV-2 RNA to be handled in a biosafety level 2 cabinet. Please seek guidance from your local biosafety office on specific recommendations for working with samples which could contain live SARS-CoV-2 virus.
Sample Collection Procedure
Sample Collection Procedure
1m
1m
Anterior nasal swab should be collected with the assistance of a healthcare worker or technician.
Before collection, clean hands using alcohol-based sanitizer or soap and water (no fragrances) and wear appropriate PPE (at minimum, gloves and a mask).
Back away as far as possible from the sample donor during the whole process. While preparing collection materials, direct the sample donor to begin blowing nose softly.
Ensure all collection materials are labelled with the correct identifying information.
Remove the lid of the collection tube containing 200 µL OnsiteGene sample storage solution.
5s
Take the swab out from the package. Insert swab into each nasal passage and rotate it against the inner nasal lining in a circle three times. The swab does not need to be inserted far – just enough so the tip is no longer visible.
1m
Place the swab into the storage solution in the tube. Remove the stick through the opening point and leave swab pad in the tube. Discard stick and secure the lid.
10s
Sterilize the tube surface with 70% ethanol or a disinfecting wipe, and place the sample in a secondary container or an appropriately labeled biohazard bag.
Dispose of gloves, and register the sample collection information (including date and time).
Transfer the sample at room temperature for sample processing. The virus RNA remains stable at room temperature for 3-5 days.
Real-Time PCR Procedure
Real-Time PCR Procedure
9m 45s
9m 45s
Vortex each sample collection tube for 5 seconds at 3000-5000 RPM.
5s
This step can be substituted by tapping or shaking each sample collection tube to mix the sample.
Spin down the tube for 15 seconds using centrifuge.
15s
The purpose is to: 1) Remove liquid from the cap to avoid the contamination when cap is removed; 2) Spin down solid particles to the bottom of the tube and allow supernatant to be acquired.
Transfer 20 µL supernatant of the sample storage solution to a tube containing 20 µL SATM direct RNA release buffer. Secure the lid of the tube.
5s
Heat the tube with the sample for 1 minute at 95°C on a heating block.
1m
Transfer 7.5 µL viral RNA sample solution (this sample can be stored at -20°C for 14 days) and 7.5 µL OnsiteGene Hi-SenseTM COVID-19 detection kit OnsiteGene Hi-SenseTM COVID-19 detection kit reaction mix (with primers and probes) into a superfast RT-qPCR reaction tube. Secure the lid of the tube.
5s
Spin down the tube for 15 seconds using centrifuge or spinner.
15s
Load up to 16 superfast RT-qPCR reaction tubes onto the OnsiteGene XDive Superfast Real-Time PCT instrument and run the following conditions:
| Step | Temperature | Time | |
| 1 | 50°C | 30 sec | |
| 2 | 95°C | 0 sec | |
| 3 | 60°C | 2 sec | |
| 4 | Read Fluorescence intensity and overhead | (10 sec) | |
| 5 | Repeat steps 2-4 for 40 cycles. |
a) XDive takes 8 minutes to complete 40 thermal cycles with fluorescence imaging.
b) Run external positive control and external negative control twice per day using 5 µL of positive control and no-template control (NTC - water). The control tests are recommended to be performed at the beginning and the end of the work/day.
8m
15.Report results per the following interpretation criteria:
| Results | IC CT | SARS-Cov-2 Targets | Interpretation | ||
| ORF1ab CT | N1 CT | ||||
| Negative | < 35 | ≥ 40 | ≥ 40 | Indicate the absence of SARS-Cov-2 RNA | |
| Positive | any value | < 40 | any value * | Indicate the presence of SARS-Cov-2 RNA | |
| any value * | ≤ 40 | ||||
| Invalid | ≥ 35 | ≥ 40 | ≥ 40 | Inability to conclusively determine presence or absence of SARS-Cov-2 RNA. This may be due to 1) Internal Control failure; or 2) failure to detect sufficient specimen volume. The sample needs to be retested. | |
* In the case of one SARS-Cov-2 target positive (CT < 40) and one SARS-Cov-2 target negative (CT ≥ 40 40), the result is suggestive of: 1) a sample at concentrations near or below the limit of detection of the test, 2) a mutation in one of the target regions, or 3) other factors