Apr 15, 2024
Nova-ST Chip Preparation Protocol
- Suresh Poovathingal1,2,
- Kristofer Davie1,2,
- Stein Aerts1,2
- 1VIB KU Leuven Center for Brain & Disease Research, Leuven, Belgium;
- 2VIB Center for AI & Computational Biology (VIB.AI), Leuven, Belgium.
External link: https://www.biorxiv.org/content/10.1101/2024.02.22.581576v1
Protocol Citation: Suresh Poovathingal, Kristofer Davie, Stein Aerts 2024. Nova-ST Chip Preparation Protocol. protocols.io https://dx.doi.org/10.17504/protocols.io.n92ld835ov5b/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: March 31, 2024
Last Modified: April 15, 2024
Protocol Integer ID: 97583
Keywords: RNA seq, Spatial Transcriptomics, Next Generation Sequencing
Funders Acknowledgement:
ERC Advanced Grant
Grant ID: 101054387_Genome2Cells
Michael J. Fox Foundation for Parkinson’s Research (Michael J. Fox Foundation)
Grant ID: ASAP-000430
Abstract
Nova-ST is a an open-source, high-resolution sequencing based spatial transcriptomics workflow. This method gives comparable resolution to BGI Stereoseq, SeqScope & PIXEL seq. Nova-ST is derived from dense nano-patterned randomly barcoded Illumina NovaSeq 6000 S4 sequencing flow cells. More details in the Nova-ST pre-print (https://www.biorxiv.org/content/10.1101/2024.02.22.581576v1). Nova-ST enables customized, low cost, flexible, and high-resolution spatial profiling of broad range of tissue section sizes (upto 10mm x 8 mm). In this protocol, we provide detailed step-by-step resource for implementing the Nova-ST spatial transcriptomics workflow in you lab. Bioinformatics and data analysis workflows are detailed in: https://github.com/aertslab/Nova-ST. For any protocol related or data analysis clarifications, you can reach out to us via nova.st.aertslab@gmail.com.
Guidelines
Section: HDMI sequencing
Oligonucleotide details:
HDMI32-DraI: CAAGCAGAAGACGGCATACGAGAT TCTTTCCCTACACGACGCTCTTCCGATCT NNVNBVNNVNNVNNVNNVNNVNNVNNVNNNNN TCTTGTGACTACAGCACCCTCGACTCTCGC TTTTTTTTTTTTTTTTTTTTTTTTTTT TTTAAA GACTTTCACCAGTCCATGAT GTGTAGATCTCGGTGGTCGCCGTATCATT
HDMI32-DraI was ordered using Ultramer service from IDT. Upon receipt, the HDMI-32 oligonucleotide were reconstituted in the Ultrapure water. The oligonucleotide was diluted to 10 nM before proceeding with the HDMI sequencing.
Read1-DraI: ATCATGGACTGGTGAAAGTC TTTAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA GCGAGAGTCGAGGGTGCTGTAGTCACAAGA
Read1-DraI was also ordered using from IDT with PAGE purification. Upon receipt, the Read1-DraI oligonucleotide was reconstituted in the Ultrapure water. The oligonucleotide was diluted to 100 nM before proceeding with the HDMI sequencing.
The HDMI32-DraI was diluted to 10 nM and the library and qPCR is used to estimate the library concentration. The concentration estimated from qPCR is used to normalize the HDMIDraI-32 library for the HDMI sequencing on Novaseq 6000 S4 flowcell.
Section: Preparation of Nova-ST chips
During the development of Nova-ST workflow we have developed two strategies for preparation of Nova-ST chips from the NovaSeq S4 flow cell and listed below are some consideration for choosing the appropriate method for cutting out the barcoded chips for Nova-ST workflow:
- Manual cutting strategy: As described in our pre-print, this method is based on semi-automated glass cutting method, where we have used the NOMAD 3 CNC milling machine from Carbide3D to score the glass surface into a 1cm x 1cm cutting grid. This CNC milling machine comes with a 130W spindle and we used a diamond drag bit from the CNC milling machine manufacturer for scoring the glass surface. Post scoring, we used traditional glass running pliers (Speedwox, Amazon) to cut the glasses into 1 cm x 1 cm chip tiles. We also tried the manual cutting strategy proposed in Open-ST, another high resolution spatial transcriptomics workflow (https://www.biorxiv.org/content/10.1101/2023.12.22.572554v1). Both of these strategies, despite the numerous cutting optimizations and fine-tunings, we have found this procedure usually resulted in quite varied results, especially while cutting larger chip size of 1 cm2 tiles. Cutting of the thicker glass section is much more challenging to get precise cuts. In addition, the physical manipulation of the chips during the cutting process also introduces artifacts on the functionalized surface of the chip, which would directly affect the performance of the assay. Also, the first step of separating the think and thick glass layers is also quite challenging with uneven cuts and breakages. All-in-all, we find the manual glass cutting strategy to produce sub-optimal glass cuts and therefore resulting in reduced recovery of ST chips. In order to improve the chip recovery and to optimize the chip cutting strategy we adopted and moved to a more automated workflow.
- Automated glass dicing strategy: In this new strategy, we use a wafer dicing instrument (DISCO DAD Automatic dicing saw; DAD 3220) to accurately cut the NovaSeq chips to varied dimensions. This instrument gives a great flexibility in cutting any desired dimensions. This instrument should commonly be available in electrical and electronics lab facilities. DAD 3220 employs a high-speed spindle (1.5 kW) fitted with an extremely thin diamond blade. The thickness of the cutting blades used varies with the material being cut, and in the case of glass cutting this is about 200 µm . The optimized glass dicing strategy provides close to 100% chip recovery. Manual intervention in the strategy is minimal and thus the artifact
The protocol describes the details on both the cutting strategies. If access to the wafer dicing instrument is a possibility, its highly recommended to use this for cutting of Nova-ST chips due to the high reliability and reproducibility in getting accurately cut Nova-ST chips.
Materials
1. Reagents
UltraPure™ DNase/RNase-Free Distilled WaterThermo Fisher ScientificCatalog #10977023
KAPA Library Quantification Kit for Illumina® PlatformsKapa BiosystemsCatalog #KK4835
Illumina NovaSeq 6000 S4 kit; 35 cyclesIllumina, Inc.Catalog #20044417
Sodium hydroxide, 10N aq. soln., Thermo Scientific ChemicalsThermo Fisher ScientificCatalog #J63736.AE
Tris-HCl, 1M Solution, pH 8.0, Molecular Biology Grade, Ultrapure, Thermo Scientific ChemicalsThermo Fisher ScientificCatalog #J22638.AE
DOW SYLGARD 184, 1.1KG Silicone Elastomer, Flowable, Sylgard® 184, RT Cure, Transparent, Container, Dow CorningCatalog #101697
DraI - 10,000 unitsNew England BiolabsCatalog #R0129L
ParafilmContributed by users
TE pH 7.5 IDT TechnologiesCatalog #11-01-02-02 1 Liter IDTE pH 8.0 (1X TE Solution)Integrated DNA Technologies, Inc. (IDT)Catalog #11-05-01-09
Exonuclease I (E.coli) - 15,000 unitsNew England BiolabsCatalog #M0293L
Quick CIP – 5,000 unitsNew England BiolabsCatalog #M0525L
3M 201E 48MM Masking Tape, Crepe Paper, Cream, 48 mm x 50 m3M corporationCatalog #201E 48MM
RNaseZap®Thermo ScientificCatalog #AM9780
DNAZap™ PCR DNA Degradation SolutionsThermo FisherCatalog #AM9890
Tris (1 M), pH 7.0, RNase-freeThermo FisherCatalog #AM9851
1M Tris-HCl pH 7.5Thermo Fisher ScientificCatalog #15567027
Tris (1 M), pH 8.0, RNase-freeThermo FisherCatalog #AM9856
2. Equipments
Equipment
NovaSeq 6000
NAME
DNA Sequencer
TYPE
Illumina
BRAND
-
SKU
LINK
Equipment
Bel-Art™ SP Scienceware™ Space Saver Vacuum Desiccators
NAME
Vacuum Desiccators
TYPE
Bel-Art™ SP Scienceware™
BRAND
NA
SKU
Equipment
Diaphragm vacuum pump, VACUUBRAND®
NAME
Vacuum pump
TYPE
VACUUBRAND
BRAND
NA
SKU
Equipment
Incubator
NAME
Memmert
BRAND
Incubator IN55
SKU
HDMI Sequencing
HDMI Sequencing
Before Starting
The NovaSeq S4 reagents stored at -20 °C is taken out and thawed at 4 °C for atleast 16:00:00 -20:00:00 before sequencing. Prior to sequencing these reagents are removed and warmed to 25 °C for atleast 00:30:00 .
The NovaSeq S4 flowcell stored at 4 °C is thawed to Room temperature at least 00:30:00 before sequencing.
Thaw HDMI32-DraI and Read1-DraI oligonucleotides to Room temperature , and prepare 20 µL of 100 micromolar (µM) of Read1-DraI read primer and prepare 200 µL of 1 micromolar (µM) of HDMI32-DraI oligonucleotide for HDMI sequencing. The 1 micromolar (µM) of HDMI32-DraI oligonucleotide is subject to qPCR quantification for library normalization
Sequencing
Prepare NaOH for denaturation (Mix the content well).
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| NaOH | 4 M | 0.2 M | 5 ul | |
| Nuclease Free Water (NFW) | 95 ul |
Prepare Tris 8 (Mix the content well)
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| Tris 8.0 | 1 M | 10 mM | 2 ul | |
| NFW | 198 ul |
Prepare Tris 8 for neutralization (Mix the content well)
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| Tris 8.0 | 1 M | 0.4 M | 40 ul | |
| NFW | 60 ul |
1.5 nanomolar (nM) of normalized HDMI library is prepared by diluting the qPCR quantified HDMI32-DraI oligonucleotide using 10 mM Tris 8.0 buffer.
Denaturing of the HDMI sequencing library is performed by adding 0.2 Molarity (M) NaOH to a final concentration of 0.04 Molarity (M) .
Incubate for 00:08:00 .
Neutralize the denatured HDMI library by adding 0.4 Molarity (M) Tris 8 solution to a final concentration of 67 millimolar (mM) . The final concentration of the HDMI library prior to loading on sequencer is 300 picomolar (pM) .
Prepare the Read1-DraI primer concentration to 0.3 micromolar (µM) by adding 10.5 µL of 100 micromolar (µM) of Read1-DraI primer to 3489.5 µL of the HT1 buffer from the NovaSeq 6000 kit. Mix well and load the primer to the custom read primer 1 position in the NovaSeq reagent cartridge.
Proceed for HDMI sequencing. The sequencing configuration used for reading the HDMI barcodes is:
| A | B | |
| Read Configuration | Number of bases | |
| Read 1 | 37 | |
| Index 1 | 0 | |
| Index 2 | 0 | |
| Read 2 | 0 |
At the end of 34 cycles, perform manual abortion of the run by pressing the option of "End run without Wash".
The S4 flow cell is retrieved either for immediate downstream post processing steps, or it can also be stored safely at 4 °C for at least 2 weeks (based on our experience). Users not having direct access to NovaSeq 6000 instrument can instruct sequencing facility to perform the HDMI sequencing and arrange for refrigerated transport of the flowcell in its original shipping case. In order the prevent the flow channels from evaporation, the inlet and outlet of the flow cell is plugged with 1.5 mm Polydimethylsiloxane (PDMS) punch.
Preparation of the 1.5 mm PDMS plugs:
The monomer (part A) and catalyst (part B) of SYLGARD 184 Silicone Elastomer Kit is prepared in a 10:1 weight ratio in a plastic container.
Using a spatula, the components were mixed thoroughly till the PDMS become milky white texture.
To remove the air bubble from the PDMS mix, it is degassed in a vaccum chamber for a total duration of 02:00:00 .
Depending of the length of the biopsy needle, pour the degassed PDMS to a petridish to the appropriate level and incubate in a 80 °C oven for a total duration of 02:00:00 to polymerize PDMS.
Using a fine spatula (Sigma Aldrich, Cat. No. Z193216-2EA), pry out the polymerized PDMS block out of the petridish and place on aluminum foil.
Using a disposable biopsy punch (World Precision Instrument; Cat. No. 504647), create 1.5-2 mm PDMS punches. With help of fine tweezers, use these punches to block the inlet and the outlet of the NovaSeq HDMI flow cell.
Flow cell cleanup & Enzymatic treatment
Flow cell cleanup & Enzymatic treatment
Before Starting
Thaw the following components:
- 10x rCutSmart buffer
- Switch on the incubator to 37 °C .
Prepare the 1X rCutSmart buffer. Mix the content well.
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| 10x rCutSmart buffer | 10X | 1X | 60 ul | |
| NFW | 540 ul |
Prepare the DraI mix (without enzyme). Mix the content well.
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| 10x rCutSmart buffer | 10X | 1X | 60 ul | |
| ** DraI enzyme | 20 U/ul | 2 U/ul | 60 ul | |
| NFW | 480 ul |
Incubate both of the above buffer (without the enzyme, marked with **) at 37 °C for at least 00:30:00
Remove the sequencing reagents from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator. Wash the flow channels of the sequencing flow cell with 200 µL of NFW. Repeat this step for a total of 3 times.
Note
While flowing the water through the channels, make sure to flow it slowly and evenly to ensure no air traps in the flow channel. Its important to make sure the channel surfaces are wet evenly. Also, ensure this for all the subsequent washes in this protocol. If you observe an air trap remove the liquid in the channels completely by using vacuum liquid aspirator and refill the channel again.
Between each wash, the liquid in the channels are completely aspirated using vacuum liquid aspirator. The channels should be dry after the aspiration.
Remove the NFW from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator. Wash the flow channels of the sequencing flow cell with 140 µL of 1X rCutSmart buffer.
Add 60 µL of DraI Enzyme to the DraI mix (enzyme marked in **) above to the buffer mix. Mix the content well using a P1000 pipette. Remove the fluid from from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator and load the flow cell channels with140 µL DraI mix cocktail.
Absorb the excess fluids from the inlet & outlet of the sequencing flow cell and using a precision forcep (VWR Cat. No. BOCH1930), block the inlets and & outlets using the 1.5-2mm PDMS biopsy cores to prevent evaporation of the reagents. Apply scotch tape to ensure no evaporation losses.
Place the flow cell into a humidification chamber made with a large square petridish with some tissue towel paper soaked in NFW. Seal the petridish with parafilm tapes to completely seal the large petridish.
Incubate the flowcell in the sealed humidification chamber at 37 °C in an oven for a duration of 16:00:00 to 20:00:00 .
After 16:00:00 of incubation, check the flow channel and if air bubble are found in the flow channels, repeatgo to step #25 with fresh with DraI mix cocktail and incubate for an additional 04:00:00 .
Before Starting
Thaw the following components:
- 10x Exonuclease I buffer
- Switch on the incubator to 37 °C .
Prepare the 1X Exonuclease I buffer. Mix the content well.
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| 10x Exonuclease I buffer | 10X | 1X | 60 ul | |
| NFW | 540 ul |
Prepare the Exonuclease I mix (without enzyme). Mix the content well.
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| 10x Exonuclease I buffer | 10X | 1X | 60 ul | |
| NFW | 493.25 ul |
Incubate both of the above buffer at 37 °C for at least 00:30:00 .
Remove the DraI mix cocktail from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator. Wash the flow channels of the sequencing flow cell with 200 µL of NFW. Repeat this step for a total of 3 times.
Between each wash, the liquid in the channels are completely aspirated using vacuum liquid aspirator.
- Remove the NFW from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator. Wash the flow channels of the sequencing flow cell with 130 µL of 1X Exonuclease I buffer.
Add 30 µL of to the Exonuclease I enzyme + 16.75 µL Quick CIP enzyme to the Exonuclease I mix above. Mix the content well using a P200 pipette. Remove the fluid from from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator and load the flow cell channels with140 µL Exonuclease I mix cocktail each.
Absorb the excess fluids from the inlet & outlet of the sequencing flow cell and using a precision forcep, block the inlets and & outlets using the 1.5-2mm PDMS biopsy cores to prevent evaporation of the reagents. Apply scotch tape to ensure no evaporation losses.
Place the flow cell into a humidification chamber made with a large square petridish with some tissue towel paper soaked in NFW.
Incubate the flow cell in the humidification chamber at 37 °C in an oven for a duration of 00:45:00
After the incubation, check the flow channel and if air bubble are found in the flow channels, repeatgo to step #25 with fresh Exonuclease I mix cocktail and incubate for an additional 00:15:00 .
Remove the Exonuclease I mix cocktail from the flow channels of the NovaSeq flow cell using vacuum liquid aspirator. Wash the flow channels of the sequencing flow cell with 200 µL of NFW. Repeat this step for a total of 3 times.
Between each wash, the liquid in the channels are completely aspirated using vacuum liquid aspirator.
The enzymatically treated S4 flow cell can then be processed directly for the Nova-ST chip preparation, or it can also be stored safely at 4 °C for at least 2 weeks (based on our experience).
If the flow cell is going to be stored, replace the NFW from the flow channels with 200 µL of IDT TE8 buffer. Absorb the excess fluids from the inlet & outlet of the sequencing flow cell and using a precision forceps, block the inlets and & outlets using the 1.5-2mm PDMS biopsy cores to prevent evaporation of the reagents. Apply scotch tape to ensure no evaporation losses and proceed with the storage.
Please read the "Guidelines & Warnings" section, before the glass cutting step to prepare Nova-ST chips.
Manual cutting strategy for Nova-ST chip preparation
Manual cutting strategy for Nova-ST chip preparation
5m
Before Starting:
Clean all the surfaces and tools being used for preparing the Nova-ST with 70% Ethanol followed by RNA zap and DNA zap.
Prepare 0.1N NaOH solution
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| NaOH | 10N | 0.1N | 5 ml | |
| NFW | 495 ml |
Prepare 0.1M Tris 7.5 solution
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| Tris pH 7.5 | 1M | 0.1M | 50 ml | |
| NFW | 450 ml |
If the NovaSeq flow cell after the enzymatic treatment has been stored at 4 °C , remove the PDMS plugs and wash the flow channels of the sequencing flow cell with 200 µL of NFW. Repeat this step for a total of 3 times.
Between each wash, the liquid in the channels are completely aspirated using vacuum liquid aspirator.
The orientation of the chip is marked with the QR code present in the corner of the NovaSeq flow cell.
The flow cell is removed from its plastic adapter by releasing the plastic clip holding the chip. The flow cell is then incubated at 50 °C for 00:20:00 to dry the flow channels.
Using a scalpel, gently pry between the thin & thick glass layers which is separated by a black gasket. This has to be done on all sides of the flow cell. By gentle prying, the layers would slowly separate on all the sides. Once the layers have separated significantly, hold them and gradually separate the layers by hand till the thin and thick layers have separated completely.
Note
Its crucial to perform this step with at most care & diligence. The thin glass layer is very fragile and this section can encounter uneven stress if not handled carefully and could result in breakage or shattering.
After separating the layers, the glass slides are glued to paper masking tapes. The excess paper tapes around the glass slides are trimmed away.
Note
The masking tapes are used to keep the chip together during the cutting process. It’s important to do this to ensure the chips are not lost or flipped during the cutting process. It’s extremely difficult to identify the correct functionalized surface of the chip if its flipped during the manipulation.
The scoring pattern was created using the machine suppliers dedicated software, Carbide Create. The glass plates dimensions were defined in the software as well as the desired scoring pattern. The pattern used for scoring both the glass slides:
The green colored area is cut for the preparing Nova-ST chips. The area shaded with grey corresponds to non-functional area and is excluded from cutting.
The glass slides were aligned and fixed onto the bread-board stage of the instrument. As per manufacturers protocol, the x, y and z coordinates of the spindle is set. The scoring depths was then adapted according to the glass thickness and the direction. The thicker glass plate (1.2mm thick) was scored with a 0.6mm depth in the width direction (shortest side) and 0.2mm depth in the length direction. For the thin section (thickness 0.3mm), depths of 0.4mm and 0.1mm were used, respectively. Each score was performed with a single pass of the tool.
Note
It is important to note that the depth of cut defined in the software is not the actual depth. The actual depth differs due to the spring that retracts at the glass contact.
Retrieve the glass slides from the CNC machine. Using the glass running pliers (SPEEDEOX), place the glass slides such that the score lines align with the reference line on the pliers. Adjust the set screws of the pliers to control the width of the jaws such that the glass layer sits flushed against the jaws when held between it. Apply gentle pressure, to break the glass along the score lines. Firstly, break the glass slide along the width (shorter length). Then, break along the long score lines to produce 1cm2 Nova-ST chip tiles.
Note
It’s important to use the replacement rubber tips to ensure that the functional surface of the Nova Seq chip are not damaged or chipped during the processing steps. Also be sure to apply gently pressure to break the glass. Higher pressure can result in the undesired cuts in the thick glass layer.
Prepare 4x 24-well plate for transferring the chips. After cutting the chips, with help of sharp forceps gently remove the Nova-ST chips from the adhesive tape, without damaging the functional surface of the Nova-ST chip. Transfer the Nova-ST chips to the wells of 24 well plate according to an example color scheme described below:
Nova-ST chips derived from each of the colored regions go to respective 24 well plate.
The wells where the Nova-ST chips are stored are labeled according to their location in the S4 flowcell. This is needed for the identification of the location of the chips in the original NovaSeq flow cell. Example, the Nova-ST chip 1A1 is derived from the thick glass slide and is closest to the outlet port.
Note
It's important to handle the transfer of the thin Nova-ST chips to the 24 well plate, as they are very delicate and can break easily
After the chip transfer to the corresponding 24 well plates are completed, proceed with the wash steps below:
Using a multi-channel pipette, add 1 ml of NFW to the wells of the 24 well plate. After wash, discard NFW to a collection reservoir.
Note
Ensure all the chips are completely submerged in the liquid. The thin chips are light and buoyant and sometimes tends to float. If a Nova-ST chip floats, submerge the chip using a pipette tip and be sure to use a non-functional area to submerge the chip. Adding liquid directly to the chip surface helps with submerging the chips during the washes.
repeat the step for a total of 3X times.
Using a multi-channel pipette, add 1 ml of 0.1N NaOH solution to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. Incubate the chips for 00:05:00 at Room temperature . After incubation discard the 0.1N NaOH solution from the wells to a collection reservoir. After each wash remove as much as liquid possible from the wells.
repeat the step for a total of 3X times.
5m
Using a multi-channel pipette, add 0.1M Tris 7.5 solution to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. After incubation discard the 0.1M Tris 7.5 solution from the wells to a collection reservoir. After each wash remove as much as liquid possible from the wells.
repeat the step for a total of 3X times.
Using a multi-channel pipette, add 1 ml of 1x IDT TE 8 to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. After wash, discard the TE buffer to a collection reservoir.
Using a multi-channel pipette, add 1 ml of 1x IDT TE 8 to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. Seal the 24 well plate with parafilm M tapes and store the chips at 4 °C .
Automatic dicing strategy for Nova-ST chip preparation
Automatic dicing strategy for Nova-ST chip preparation
5m
Before Starting:
Clean all the surfaces and tools being used for preparing the Nova-ST with 70% Ethanol followed by RNA zap and DNA zap.
Prepare 0.1N NaOH solution
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| NaOH | 10N | 0.1N | 5 ml | |
| NFW | 495 ml |
Prepare 0.1M Tris 7.5 solution
| A | B | C | D | |
| Component | Stock Concentration | Final Concentration | Volume | |
| Tris pH 7.5 | 1M | 0.1M | 50 ml | |
| NFW | 450 ml |
If the NovaSeq flow cell after the enzymatic treatment has been stored at 4 °C , remove the PDMS plugs and wash the flow channels of the sequencing flow cell with 200 µL of NFW. Repeat this step for a total of 3 times.
Between each wash, the liquid in the channels are completely aspirated using vacuum liquid aspirator.
The orientation of the chip is marked with the QR code present in the corner of the NovaSeq flow cell.
The NovaSeq flow is mounted on dicing tape which has a sticky backing that holds the flow cell on a thin sheet metal frame, to prepare for dicing process. The thick glass side of the flow cell is glued on to the adhesive film. In order to reduce the adjustment for alignment in the dicing machine, the flow cell is glued on to the dicing tape, pre-aligned.
The metal frame with flow cell is fixed to the dicing stage. The x-,y- and alignment is performed. The origin for the start of the dicing is initiated. Cutting speed is set to 1 mm/s and dicing process is initiated.
Firstly, the dicing is performed along the length of the NovaSeq flow cell and its cut into slabs of 1 cm thick. Without detaching the separated 1 cm slab from the dicing tape, the tape assembly is turned by 900 angle and the dicing is repeated along the width of the NovaSeq flow cell and it cut into desired dimensions. An example of a recent dicing pattern used by our lab:
Note
To ensure the glass layers are diced through the flow cell completely, observe for the score pattern on the dicing tape. If there is no score pattern on the dicing tape the NovaSeq chip has not been diced properly.
After the dicing steps are completed, the diced NovaSeq flow cell is removed from the instrument and the dicing tape is cut out to retrieve the diced NovaSeq flow cell.
Prepare 6x24-well plate for transferring the chips. For the dicing schema described in step 46, the following plate configuration is used:
The wells where the Nova-ST chips are stored are labeled according to their location in the S4 flowcell. This is needed for the identification of the location of the chips in the original NovaSeq flow cell. Example, the Nova-ST chip 3A1 is derived from the thick glass slide and is closest to the outlet port.
With help of sharp forceps gently remove the Nova-ST chips from the adhesive dicing tape. The Nova-ST chips at this stage is still bonded with the thin and thick sections still bonded. Using a fresh razor, pry gently at the side between the thin and thick section (as shown below). A gentle push is sufficient to separate the layers. Ensure not to disturb/damage the function surface of the Nova-ST chips.
Once the layers have been separated, place the separated chip on a paper towel with the functional surface facing up. After separating a batch of chips, using a sharp forceps, transfer the chips to the respective 24 well plate, with the functional surface of the chips facing upwards.
After all the chip transfer has been performed to the corresponding 24 well plates, proceed with the wash steps below:
Using a multi-channel pipette, add 1 ml of NFW to the wells of the 24 well plate. After wash, discard NFW to a collection reservoir.
Note
Ensure all the chips are completely submerged in the liquid. The thin chips are light and buoyant and sometimes tends to float. If a Nova-ST chip floats, submerge the chip using a pipette tip and be sure to use a non-functional area to submerge the chip. Adding liquid directly to the chip surface helps with submerging the chips during the washes.
repeat the step for a total of 3X times.
Using a multi-channel pipette, add 0.1N NaOH solution to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. Incubate the chips for 00:05:00 at Room temperature . After incubation discard the 0.1N NaOH solution from the wells to a collection reservoir. After each wash remove as much as liquid possible from the wells.
repeat the step for a total of 3X times.
Using a multi-channel pipette, add 0.1M Tris 7.5 solution to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. After incubation discard the 0.1M Tris 7.5 solution from the wells to a collection reservoir. After each wash remove as much as liquid possible from the wells.
repeat the step for a total of 3X times.
Using a multi-channel pipette, add 1 ml of 1x IDT TE 8 to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. After the wash, discard the TE buffer to a collection reservoir.
Using a multi-channel pipette, add 1 ml of 1x IDT TE 8 to the wells of the 24 well plate. Ensure all the chips are completely submerged in the liquid. Seal the 24 well plate with parafilm M tapes and store the chips at 4 °C .
Data processing
Data processing
Details on data processing, post HDMI sequencing can be found here https://github.com/aertslab/Nova-ST