Oct 28, 2024
Version 2
Non-invasive Detection Method for Bonamia ostreae in Ostrea edulis using the Franklin qPCR machine V.2
- Lavanya M Vythalingam1,
- Tim Regan1,
- Tim Bean1
- 1The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh
Protocol Citation: Lavanya M Vythalingam, Tim Regan, Tim Bean 2024. Non-invasive Detection Method for Bonamia ostreae in Ostrea edulis using the Franklin qPCR machine. protocols.io https://dx.doi.org/10.17504/protocols.io.q26g7y311gwz/v2Version created by Tim Regan
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 20, 2023
Last Modified: October 28, 2024
Protocol Integer ID: 111019
Keywords: Bonamia ostrea, Ostrea edulis, qPCR, Real-Time PCR, Environmental DNA, in-situ detection
Funders Acknowledgement:
UK Seafood Innovation Fund
Grant ID: FS042
Abstract
This is a comprehensive protocol for using the Franklin qPCR (Biomeme Inc.) machine to detect the presence of Bonamia ostreae parasite in European flat oyster (Ostrea edulis). Previous methods relied on sacrificially dissecting animals to perform histology. While sensitive, these methods were destructive and untested animals carrying Bonamia ostreae are not detected. Here, we present a non-invasive alternative method to detect Bonamia ostreae from Ostrea edulis pseudofaeces/faeces using a portable qPCR machine.
Attachments
Image Attribution
Special thanks to Kieran Hennigan (Bass Rock Films, UK) for recording the SOP video.
Materials
- Container to hold oysters
- Aeration tubing, airstones, and pumps
- Pasteur pipette
- 1.5 ml Eppendorf tube for sediment
- Lysing matrix A bead-beating tube
- qPCR primers (B.ostreae, O.edulis)
- Taqman qPCR probe (B.ostreae, O.edulis)
- 1uM Barb column filter
- 1ml syringe
- Bleach
Sample Collection
Sample Collection
18h
18h
Collect oysters and wash to remove any excess mud/sediment on their shells.
Separate collected animals and cover with seawater (approx. 1 L for every 200 g of live animal).
Note
1) The volume of seawater used is a ballpark figure, which should allow for quite a bit of variation.
2) Ensure that animals from separate testing sites are held separately, with strict bio-security protocols in place to prevent cross contamination.
3) Ensure animals are aerated and kept in a place with minimal disturbance to ensure they filter and produce faeces.
Aerate buckets overnight for 16:00:00 at ambient temperature on sampling location (see Figure 1).
Figure 1: Set up for incubation process
16h
Collect the sediment remaining in the bottom of each bucket (faeces and pseudofaeces) using a Pasteur pipette into a 1.5 mL Eppendorf tube.
Note
1) Allow the sediment to settle for 00:05:00 minutes before removing the excess supernatant.
2) Leave approximately 1 mL ml of sediment with some water to aid in the transferring process when using a Pasteur pipette.
OPTIONAL: Store samples collected at -20 °C until further use.
Disinfect all equipment with working strength bleach according to biosecurity SOPs.
DNA Extraction
DNA Extraction
Extract DNA from the sediment samples by physical beating in 2 mL Lysing matrix A tubes and filter through a 1 uM barb column filter.
Use a syringe with a 1 uM pre-filter to remove the supernatant without debris.
Make two holes in the first M1 chamber and transfer sample into the Biomeme M1 cartridge.
Process filtered sediment through the Biomeme M1 extraction cartridge (see Figure 2), according to the manufacturer’s protocol (refer to link below).
Figure 2: Biomeme M1 extraction cartridge
On-site Franklin qPCR assay
On-site Franklin qPCR assay
1m 20s
1m 20s
Store DNA at -4 °C until further use.
Transfer 20 µL of extracted DNA to Biomeme Go-Strip assay tube (see Figure 3).
Figure 3: Transferring extracted DNA into Biomeme Go-strips assay tube
Note
The qPCR mastermix consists of: 20 µL sample, 1.8 µL primers, 0.5 µL B.ostreae probe, 0.45 µL O.edulis probe, and 1.85 µL nuclease free water.
Note
The three assays consist of B. ostreae (Marty et al., 2006) to assess for presence of the pathogen, Ostrea edulis (Sanchez et al., 2014) to check the quality of the DNA extraction, and a technical internal positive control (IPC) assay (provided by Biomeme Inc) to ensure the reaction has worked.
Follow the instructions on connecting the qPCR machine to the phone using the Biomeme app. Choose the LyoDNA test (Figure 4) and follow the on screen instructions.
Figure 4: Test Selection on the Biomeme App
Place the Biomeme Go-Strip assay tubes into the Franklin device in the correct orientation (see Figure 5).
Figure 5: Biomeme Go-Strip assay tubes placed in the correct orientation according to instructions
Run a qPCR assay using the Franklin qPCR machine against the three probe-based assays. Primers and probes used in this assay is given below (Table 1).
Note
| A | B | C | D | |
| Name | Designation | Primer Sequence 5’- 3’ | Reference | |
| Bon18S_F_Marty | Forward Primer | CCCGGCTTCTTAGAGGGACTA | Marty et al (2006) | |
| Bon18S_F_Marty | Reverse Primer | ACCTGTTATTGCCCCAATCTTC | ||
| Bon18SFAM_Marty | Probe | FAMCTGTGTCTCCAGCAGAT-BHQ1 | ||
| OEDU16S_F | Forward Primer | GGCGCCCCACCTAAAAAT | Sánchez et al (2004) | |
| OEDU16S_R | Reverse Primer | AGACCCCGTGCAACTTTTAAAG | ||
| OEDU16S_P | Probe | [TxRd]TGAAACTCCTAAACAAGTTG[BHQ2] |
Table 1: Real-time qPCR assays used
The Franklin qPCR protocol consisted of 00:01:00 minute heat activation and 45 cycles of 95 °C for 1 second and 60 °C for 00:00:20 .
1m 20s
Use the Biomeme app on the phone to analyse the qPCR results to determine the presence of Bonamia ostreae. Refer to Figure 6 for an example of positive Bonamia ostreae presence.
Figure 6: The green dots and the Cq values in the first row indicate positive Bonamia ostreae detection (based on a Cq value cut-off point of 35)
Figure 7: Schematic of Bonamia ostreae detection process
Video SOP
Video SOP
A video of this procedure is also available here:
