Dec 03, 2019
Loop L2 (even level) SapI type IIS cloning into pCs vectors
- Eftychis Frangedakis1,
- Susana Sauret-Gueto2,
- Anthony West3,
- Marta Marta Tomaselli2,
- Nicola Patron4,
- Marius Rebmann2,
- Jim Haseloff2
- 1University of Cambridge;
- 2Plant Sciences, University of Cambridge, OpenPlant;
- 3previously at Earlham Institute, Norwich;
- 4Earlham Institute, Norwich
- OpenPlant Project
Protocol Citation: Eftychis Frangedakis, Susana Sauret-Gueto, Anthony West, Marta Marta Tomaselli, Nicola Patron, Marius Rebmann, Jim Haseloff 2019. Loop L2 (even level) SapI type IIS cloning into pCs vectors. protocols.io https://dx.doi.org/10.17504/protocols.io.92fh8bn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 03, 2019
Last Modified: December 03, 2019
Protocol Integer ID: 30503
Materials
MATERIALS
Sterile water
dATP, 100mM, 25uMolesPromegaCatalog #U1205
BSA, molecular biology grade, 20 mg/ml New England BiolabsCatalog # B9000S
Tango BufferThermo Fisher ScientificCatalog #BY5
T4 DNA ligaseThermo Fisher ScientificCatalog #15224041
LguI (SapI)Thermo Fisher ScientificCatalog #ER1931
Loop pCs vectors
Loop pCs vectors
Loop vectors for nuclear transformation: pCs (A) and for chloroplast transformation pCschlo (B).
Loop fusion sites in the pCs vectors to assemble different L1 constructs into a L2 construct using a pCs vector and SapI are: a (ATG) and o (GCT).
Loop fusion sites in the pCs vectors to assemble different L2 constructs into a L3 construct using a pCk vector and BsaI are: A (GGAG), B (TACT), C (AATG), E (GCTT) and F (CGCT).
Left (LB) and right border (RB) repeats from nopaline C58 T-DNA for Agrobacterium-mediated nuclear transformation. SmR: spectinomycin bacterial resistance cassette. LacZ: lacZα cassette for blue-white screening of colonies.
Example of assembly of L1 constructs into a L2 device
Example of assembly of L1 constructs into a L2 device
Loop assembly of four transcription units (L1) into a L2 device using a pCs plasmid and SapI.
Protocol for assembly of L1 constructs into a L2 device
Protocol for assembly of L1 constructs into a L2 device
Determine the concentration of each DNA plasmid needed (L1 plasmids and pCs acceptor plasmid)with spectrophotometry (Nanodrop).
In the example in step 2, determine concentration of plasmids L1_001-Ck1, L1_002-Ck2, L1_003-Ck3, L1_004-Ck4 and pCsA
Prepare aliquots for each plasmid at a concentration of 15 nM for the L1 plasmids and of 7.5 nM for the acceptor pCs vector. With this final concentration, 1 µL of each plasmid is added to the plasmids mix (see step 6).
To calculate the concentration in ng/μL:
- For a final concentration of 15 nM, the concentration in [ng/ul] equals N (the length in bp of the plasmid) divided by 110. This is an approximation of the formula:
15∙10^(-9)mol/L x ((607.4 x N ) + 157.9)g/mol x 10^(-6)L/μL x 10^9ng/g = concentration (ng/μL)
- For a final concentration of 7.5 nM, the concentration in [ng/ul] equals N divided by 220.
Prepare the Loop assembly Even Level reaction master mix (MM) according to according to Table
| Component | Volume (μL) | |
| Sterile water | 2 | |
| 10x Tango buffer (Thermo Fisher) | 1 | |
| 1 mg/mL bovine serum albumin (NEB) | 0.5 | |
| T4 DNA ligase (5 U/µL) (Thermo Fisher) | 0.25 | |
| 10mM ATP (SIGMA) | 1 | |
| SapI (LguI) (5 U/µL) (Thermo Fisher) | 0.25 | |
| Final volume | 5 |
Prepare plasmids mix by adding in a 0.2 mL tube: 1 μL of each of the 4 L1 plasmids , and 1 μL of the pCs (see step 2). Mix well.
Add 5 μL of master mix (step 5) to the 5 μL of plasmids mix (step 6), to a final volume of 10 μL. Mix well.
Place samples in a thermocycler and use the following program:
Assembly: 26 cycles of 37 °C for 3 min and 16 °C for 4 min.
Termination and enzyme denaturation: 50 °C for 5 min and 80 °C for 10 min.
Transform 20 μL of chemically competent E. coli cells (transformation efficiency of 1 × 10^7 transformants/µg plasmid DNA) using 2 μL of the Loop assembly reaction and then plate on LB agar plates containing 100 μg/mL spectinomycin and 40 μg/mL of X-gal for blue-white screening.
Incubate O/N at 37 °C.
Colonies with white color are likely to contain a L2 insert cloned into the pCs vector (In the example in step 2: 001-002-003-004)
Blue color colonies will contain undigested pCs vector with LacZ
Confirm the presence of the correct insert with Sanger sequencing using the primers pC_F (GCAACGCTCTGTCATCGTTAC) and pC_R (GTAACTTAGGACTTGTGCGACATGTC) for pCs vectors, and pC_F and pC_R2 (CAATCTGCTCTGATGCCGCATAGTTAAG) for pCschlo vectors.