Dec 19, 2022

Public workspaceLight-Seq Cell Barcoding V.2

  • Jocelyn Y. Kishi1,2,3,4,
  • Ninning Liu1,2,3,
  • Emma R. West5,6,3,
  • Kuanwei Sheng1,2,
  • Jack J. Jordanides1,2,
  • Matthew Serrata1,2,
  • Constance L. Cepko5,6,7,4,
  • Sinem K. Saka1,2,8,4,
  • Peng Yin1,2,4
  • 1Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts 02115, USA;
  • 2Department of Systems Biology, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 3These authors contributed equally;
  • 4Co-corresponding;
  • 5Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 6Howard Hughes Medical Institute, Chevy Chase, Maryland 20815, USA;
  • 7Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts 02115, USA;
  • 8European Molecular Biology Laboratory (EMBL), Genome Biology Unit, 69117 Heidelberg, Germany
  • Light-Seq
Icon indicating open access to content
QR code linking to this content
Protocol CitationJocelyn Y. Kishi, Ninning Liu, Emma R. West, Kuanwei Sheng, Jack J. Jordanides, Matthew Serrata, Constance L. Cepko, Sinem K. Saka, Peng Yin 2022. Light-Seq Cell Barcoding. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly77jplx9/v2Version created by Ninning Liu
Manuscript citation:
Kishi, J.Y., Liu, N., West, E.R. et al. Light-Seq: light-directed in situ barcoding of biomolecules in fixed cells and tissues for spatially indexed sequencing. Nat Methods (2022). https://doi.org/10.1038/s41592-022-01604-1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: December 18, 2022
Last Modified: December 19, 2022
Protocol Integer ID: 74165
Keywords: Light-Seq, Spatial Transcriptomics
Funders Acknowledgements:
Wyss Institute
Grant ID: Validation Project
Abstract
We present Light-Seq, an approach for multiplexed spatial indexing of intact biological samples using light-directed DNA barcoding infixed cells and tissues followed by ex situ sequencing. Light-Seq combines spatially targeted, rapid photocrosslinking of DNA barcodes onto complementary DNAs in situ with a one-step DNA stitching reaction to create pooled, spatially indexed sequencing libraries. This light-directed barcoding enables in situ selection of multiple cell populations in intact fixed tissue samples for full-transcriptome sequencing based on location, morphology or protein stains, without cellular dissociation. Applying Light-Seq to mouse retinal sections, we recovered thousands of differentially enriched transcripts from three cellular layers and discovered biomarkers fora very rare neuronal subtype, dopaminergic amacrine cells, from only 4–8 individual cells per section. Light-Seq provides an accessible workflow to combine in situ imaging and protein staining with next generation sequencing of the same cells, leaving the sample intact for further analysis post-sequencing.
Materials
General Buffers
ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Thermo Fisher ScientificCatalog #AM9625
ReagentDNAse/RNAse free distilled waterInvitrogenCatalog #10977023
ReagentTriton X-100Sigma AldrichCatalog #T8787-50ML
ReagentSodium Chloride (5M)Invitrogen - Thermo FisherCatalog #AM9760G
Reagent10 x 2 ml IDTE pH 7.5 (1X TE Solution)IDTCatalog #11-01-02-02
ReagentSSC (20X), RNase-freeThermo FisherCatalog #AM9765
ReagentTween 20Sigma AldrichCatalog #P9416-50ML
ReagentPierce™ 16% Formaldehyde (w/v), Methanol-freeThermo FisherCatalog #28908
ReagentFormamide (Deionized)Thermo FisherCatalog #AM9342
ReagentPOLY-D-LYSINE HYDROBROMIDE MOL WT 70000 - 5MGSigma AldrichCatalog #P6407-5MG
ReagentPierce™ 20X Borate BufferThermo FisherCatalog #28341

Cell culture
ReagentDMEM, high glucose, GlutaMAX™ Supplement, pyruvateThermo FisherCatalog #10569010
ReagentPenicillin StreptomycinInvitrogen - Thermo FisherCatalog #15140 122
ReagentBlasticidin S hydrochloride 10 mg/ml in HEPES buffer sterile-filteredThermo ScientificCatalog #J67216.XF
ReagentMEM Non-Essential Amino Acids Solution (100X)Thermo FisherCatalog #11140050
ReagentCalf Bovine Serum Iron FortifiedATCCCatalog #30-2030
ReagentFetal Bovine Serum, certified, heat inactivated, United StatesThermo FisherCatalog #10082147 ReagentTrypLE™ ExpressThermo Fisher ScientificCatalog #12605010
ReagentDPBS with Ca and Mg Gibco - Thermo FischerCatalog #14040-133

Enzymes and related reagents
ReagentMaxima H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0753
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
ReagentTerminal Transferase - 2,500 unitsNew England BiolabsCatalog #M0315L
Reagent2′3′-Dideoxyadenosine 5′-Triphosphate 100 mM solutionSigma AldrichCatalog #GE27-2051-01
ReagentDeoxynucleotide Solution Set - 25 umol of eachNew England BiolabsCatalog #N0446S
ReagentThermoPol Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9004S
ReagentBst DNA Polymerase Lg Frag - 8,000 unitsNew England BiolabsCatalog #M0275L
ReagentRNase H - 1,250 unitsNew England BiolabsCatalog #M0297L
ReagentDeoxynucleotide Solution Mix - 8 umol of eachNew England BiolabsCatalog #N0447S
ReagentKAPA HiFi DNA PolymeraseKapa Biosystems

Gels
ReagentGeneRuler Low Range DNA Ladder, ready-to-useThermo FisherCatalog #SM1193
ReagentNovex™ TBE-Urea Gels, 15%, 15 wellThermo FisherCatalog #EC68855BOX
ReagentUltraPure™ TBE Buffer 10XThermo Fisher ScientificCatalog #15581044
ReagentE-Gel™ 1 Kb Plus Express DNA LadderThermo FisherCatalog #10488091
ReagentE-Gel™ Sample Loading Buffer, 1XThermo FisherCatalog #10482055
ReagentE-Gel™ EX Agarose Gels, 1%Thermo FisherCatalog #G402001
ReagentSYBR™ Gold Nucleic Acid Gel Stain (10,000X Concentrate in DMSO)Thermo FisherCatalog #S11494
qPCR and DNA purification
ReagentSYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563
ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880
ReagentQubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230

Cell chambers
Reagentu-Slide 18 well Poly-L-Lysine (Custom order)IbidiCatalog #81814


Protocol materials
ReagentTrypLE™ ExpressThermo Fisher ScientificCatalog #12605010
ReagentPierce™ 16% Formaldehyde (w/v), Methanol-freeThermo FisherCatalog #28908
ReagentCalf Bovine Serum Iron FortifiedATCCCatalog #30-2030
ReagentMaxima H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0753
ReagentRNase H - 1,250 unitsNew England BiolabsCatalog #M0297L
ReagentKAPA HiFi DNA PolymeraseKapa Biosystems
ReagentQubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
ReagentBlasticidin S hydrochloride 10 mg/ml in HEPES buffer sterile-filteredThermo ScientificCatalog #J67216.XF
ReagentRNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen - Thermo FisherCatalog #10777019
ReagentThermoPol Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9004S
ReagentBst DNA Polymerase Lg Frag - 8,000 unitsNew England BiolabsCatalog #M0275L
ReagentDeoxynucleotide Solution Mix - 8 umol of eachNew England BiolabsCatalog #N0447S
ReagentSodium Chloride (5M)Invitrogen - Thermo FisherCatalog #AM9760G
ReagentSYBR™ Gold Nucleic Acid Gel Stain (10,000X Concentrate in DMSO)Thermo FisherCatalog #S11494
Reagentu-Slide 18 well Poly-L-Lysine (Custom order)IbidiCatalog #81814
ReagentDPBS with Ca and Mg Gibco - Thermo Fisher ScientificCatalog #14040-133
ReagentFormamide (Deionized)Thermo FisherCatalog #AM9342
ReagentDMEM, high glucose, GlutaMAX™ Supplement, pyruvateThermo FisherCatalog #10569010
ReagentMEM Non-Essential Amino Acids Solution (100X)Thermo FisherCatalog #11140050
ReagentTriton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #T8787-50ML
ReagentNovex™ TBE-Urea Gels, 15%, 15 wellThermo FisherCatalog #EC68855BOX
ReagentAgencourt AMPure XPBeckman CoulterCatalog #A63880
ReagentTween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416-50ML
ReagentPOLY-D-LYSINE HYDROBROMIDE MOL WT 70000 - 5MGMerck MilliporeSigma (Sigma-Aldrich)Catalog #P6407-5MG
ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Thermo Fisher ScientificCatalog #AM9625
ReagentSYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOThermo FisherCatalog #S7563
ReagentPierce™ 20X Borate BufferThermo FisherCatalog #28341
ReagentTerminal Transferase - 2,500 unitsNew England BiolabsCatalog #M0315L
ReagentE-Gel™ 1 Kb Plus Express DNA LadderThermo FisherCatalog #10488091
ReagentE-Gel™ EX Agarose Gels, 1%Thermo FisherCatalog #G402001
Reagent10 x 2 ml IDTE pH 7.5 (1X TE Solution)IDTCatalog #11-01-02-02
ReagentPenicillin StreptomycinInvitrogen - Thermo FisherCatalog #15140 122
ReagentGeneRuler Low Range DNA Ladder, ready-to-useThermo FisherCatalog #SM1193
ReagentE-Gel™ Sample Loading Buffer, 1XThermo FisherCatalog #10482055
ReagentSSC (20X), RNase-freeThermo FisherCatalog #AM9765
Reagent2′3′-Dideoxyadenosine 5′-Triphosphate 100 mM solutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #GE27-2051-01
ReagentFetal Bovine Serum, certified, heat inactivated, United StatesThermo FisherCatalog #10082147
ReagentDeoxynucleotide Solution Set - 25 umol of eachNew England BiolabsCatalog #N0446S
ReagentUltraPure™ TBE Buffer 10XThermo Fisher ScientificCatalog #15581044
ReagentDNAse/RNAse free distilled waterInvitrogenCatalog #10977023
ReagentFetal Bovine Serum, certified, heat inactivated, United StatesThermo FisherCatalog #10082147
ReagentHEK293 / GFP stable cellsCatalog #SC001
ReagentNIH/3T3ATCCCatalog #CRL-1658
ReagentDMEM, high glucose, GlutaMAX™ Supplement, pyruvateThermo FisherCatalog #10569010
ReagentPenicillin StreptomycinInvitrogen - Thermo FisherCatalog #15140 122
ReagentBlasticidin S hydrochloride 10 mg/ml in HEPES buffer sterile-filteredThermo ScientificCatalog #J67216.XF
ReagentMEM Non-Essential Amino Acids Solution (100X)Thermo FisherCatalog #11140050
ReagentCalf Bovine Serum Iron FortifiedATCCCatalog #30-2030
ReagentTrypLE™ ExpressThermo Fisher ScientificCatalog #12605010
ReagentDPBS with Ca and Mg Gibco - Thermo Fisher ScientificCatalog #14040-133
Reagentu-Slide 18 well Poly-L-Lysine (Custom order)IbidiCatalog #81814
ReagentPOLY-D-LYSINE HYDROBROMIDE MOL WT 70000 - 5MGMerck MilliporeSigma (Sigma-Aldrich)Catalog #P6407-5MG
ReagentPierce™ 20X Borate BufferThermo FisherCatalog #28341
ReagentDNAse/RNAse free distilled waterInvitrogenCatalog #10977023
ReagentTween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416-50ML
ReagentPierce™ 16% Formaldehyde (w/v), Methanol-freeThermo FisherCatalog #28908
ReagentDPBS with Ca and Mg Gibco - Thermo Fisher ScientificCatalog #14040-133
ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Thermo Fisher ScientificCatalog #AM9625
ReagentTriton X-100Merck MilliporeSigma (Sigma-Aldrich)Catalog #T8787-50ML
ReagentFormamide (Deionized)Thermo FisherCatalog #AM9342
ReagentSodium Chloride (5M)Invitrogen - Thermo FisherCatalog #AM9760G
ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Thermo Fisher ScientificCatalog #AM9625
ReagentTween 20Merck MilliporeSigma (Sigma-Aldrich)Catalog #P9416-50ML
ReagentThermoPol Reaction Buffer Pack - 6.0 mlNew England BiolabsCatalog #B9004S
Reagent2′3′-Dideoxyadenosine 5′-Triphosphate 100 mM solutionMerck MilliporeSigma (Sigma-Aldrich)Catalog #GE27-2051-01
ReagentDeoxynucleotide Solution Set - 25 umol of eachNew England BiolabsCatalog #N0446S
ReagentTerminal Transferase - 2,500 unitsNew England BiolabsCatalog #M0315L
Before start
This protocol is for selective barcoding of cells seeded onto an Ibidi 18-well µ-slide. A separate protocol can be found for selective barcoding of tissue samples.

Clean workspace (bench, pipettes, etc.) with 70% ethanol before starting.
When the protocol calls for water, always use UltraPure water.
All reagents should be molecular-grade and RNAse free.
All reactions with enzymes are prepared on ice.

Key Equipment:
Microscope
Light-Seq requires an optical system that can focus UV light onto specific regions of interest. In the publication, we employ a wide field microscope with a 365 nm LED and a digital micromirror device (DMD) to accomplish this, but other systems are also amenable. We have also tested a point-scanning confocal microscope with a 405 nm laser. We recommend consulting your microscopy core or representative to discuss the best solution at your institution.

Flat-top Thermocycler
The first few steps of the protocol require thermal cycling and incubations of tissue slides. For this, we recommend the Eppendorf® Mastercycler® nexus Flat Thermal Cyclers (VWR Cat No. 71003-568).
Protocol Overview
Protocol Overview
This protocol is for selective barcoding of cells seeded onto an Ibidi 18-well µ-slide for our Light-Seq paper. https://www.nature.com/articles/s41592-022-01604-1

A separate protocol can be found for selective barcoding of tissue samples.

The protocol will take roughly one week with some pause points. An example schedule can be:

Day 0: Cell seeding and chamber preparation
Cell seeding is an overnight process, should be performed the day before planned barcoding.

Chamber Preparation
An overnight process, should be performed in parallel with cell seeding

Day 1: Cell fixation, in situ reverse transcription, A-tailing
Cell fixation and permeabilization (10-20 minutes)
Reverse transcription (2.5 hours)
A-tailing (1 hour)

Day 2: Barcoding, cDNA displacement and Cross-junction synthesis
Barcoding (0.5 - 2 hours, depending on number of desired ROI's)
cDNA displacement (1 hour)
Cross-junction synthesis (1-2 hours)

Day 3: qPCR amplification
qPCR (5 hours)

Day 4: Library prep for NGS
Library Preparation for Next-Generation Sequencing (3 hours)
Cell line maintenance
Cell line maintenance
For our cell mixing experiment, we used two different cell lines
  • HEK-293-GFP (Human)
  • 3T3 (Mouse)

Which must be cultured and maintained separately prior to a cell mixing experiment.

Cell lines
ReagentHEK293 / GFP stable cellsGibco, ThermoFisherCatalog #SC001
ReagentNIH/3T3Gibco, ThermoFisherCatalog #CRL-1658

Reagents needed:
ReagentDMEM, high glucose, GlutaMAX™ Supplement, pyruvateGibco, ThermoFisherCatalog #10569010
ReagentPenicillin StreptomycinGibco, ThermoFisherCatalog #15140 122
ReagentBlasticidin S hydrochloride 10 mg/ml in HEPES buffer sterile-filteredGibco, ThermoFisherCatalog #J67216.XF
ReagentMEM Non-Essential Amino Acids Solution (100X)Gibco, ThermoFisherCatalog #11140050
ReagentCalf Bovine Serum Iron FortifiedGibco, ThermoFisherCatalog #30-2030
ReagentFetal Bovine Serum, certified, heat inactivated, United StatesGibco, ThermoFisherCatalog #10082147
HEK293-GFP Cell line growth media

DMEM, GlutaMax growth media supplemented with:
AB
ReagentConcentration
Fetal Bovine Serum (FBS)10%
MEM non-essential amino acids0.1 mM
Penicillin Streptomycin1%
Blasticidin10 μg/mL
The blasticidin is supplemented into the growth media at Concentration10 µg/µL in order to act as a selective marker for the eGFP expression cassette inserted into the HEK cells.

For growing the HEK-GFP cells after an initial thaw from a frozen aliquot, it is recommended to grow the cells in a flask with pre-warmed 37 C media without blasticidin for 1 night.
  • The blasticidin can be too much of a stressor after the initial thaw and will stunt growth.

The following day, replace the media with pre-warmed 37C growth media with blasticidin.
3T3 Cell line growth media

DMEM, GlutaMax growth media supplemented with:
AB
ReagentConcentration
Calf Bovine Serum (BCS)10%
Penicillin Streptomycin1%
Note that the ATCC website recommends their 3T3 cells to be grown in Calf Bovine Serum rather than Fetal Bovine Serum. We have found that the cells do indeed grow far better in the calf serum than the FBS serum.
Cell splitting and subculture protocol

Our cell splitting and subculturing protocol generally follows the recommended ATCC protocols that are listed on their website for all their cell lines:

Reagents needed
ReagentTrypLE™ ExpressGibco, ThermoFisherCatalog #12605010
ReagentDPBS with Ca and Mg Gibco, ThermoFisherCatalog #14040-133

Cell Splitting
The following protocol assumes a standard T-75 corning flask for volumes.
Pre-warm all buffers to be used to 37C.

  1. Aspirate out cell growth media with a pipette. Aspirate away from cells.
  2. Wash cells with 10 mL of DPBS.
  3. Aspirate out the DPBS media
  4. Add 2-3 mL of Trypsin and coat the surface evenly.
  5. Place flask in the 37C incubator for 5-10 min. Cells should detach in that time.
  6. Add 7-8 mL of DMEM growth media to inactivate the trypsin.
  7. Pipette media up and down to de-clump cells. Wash the entire flask surface with media to get any cells that are still adhering to the flask.

Splitting and re-plate the cells.
To do a quick and dirty split without a cell counter, we typically dilute the cells to some volume in fresh media depending on how long we want to wait before the cells become confluent.

A rule of thumb that we use is:
1 mL in 10 ml (1:10) - 1-2 days
0.5 mL in 10 ml (1:20) - 3 days
0.4 mL in 10 ml (1:25) - 4 days

Incubate in a cell culture incubator at 37C and 5% CO2
Preparing the ibidi Chamber (overnight)
Preparing the ibidi Chamber (overnight)
While the cells are growing, it is good to start preparing the chamber the day before you plan to seed the cells.

The chamber itself will initially be coated with Poly-L-Lysine (PLL) from the vendor and it will be coated again with Poly-D-Lysine (PDL). We find that a double coating greatly improves cell adhesion, especially for HEK cells. This is important in order for the cells to be robust against the repeated washing steps with 60% formamide.

Reagents needed:
Reagentu-Slide 18 well Poly-L-Lysine (Custom order)Gibco, ThermoFisherCatalog #81814
ReagentPOLY-D-LYSINE HYDROBROMIDE MOL WT 70000 - 5MGGibco, ThermoFisherCatalog #P6407-5MG
ReagentPierce™ 20X Borate BufferGibco, ThermoFisherCatalog #28341
ReagentDNAse/RNAse free distilled waterGibco, ThermoFisherCatalog #10977023

Prepare PDL aliquots
  • Dissolve PDL to a working concentration of Concentration0.3 mg/mL in 2X Borate buffer (diluted in water)
  • Store aliquots at Temperature-20 °C

Chamber Coating
All steps with the chamber open should be ideally performed in a sterile fume hood to prevent contamination during drying steps

  1. Take a clean 18-well PLL chamber and pipette 100 μL of the PDL solution into each well
  2. Place the lid back on the chamber, cover and leave in 4C, overnight.
  3. In the hood, pipette off the PDL solution and dry in hood for 1 hour.
  4. Wash each well with UltraPure water (100 μL) X3.
  5. Dry in hood for 1 hour.

Note
Storing Chambers
After the final drying step, the chamber is ready for use. We typically use the chamber within a day of preparation. Some sites have suggested that a double-coated chamber can be stored for up to 2 weeks before use, however we have not tested this.

Cell Seeding
Cell Seeding
1d
1d
Cell seeding and co-culturing

The day before the barcoding experiment, we will then need to seed and co-culture both cell lines in a single ibidi well.

Co-culture growth media
DMEM, GlutaMax growth media supplemented with:
AB
ReagentConcentration
Calf Bovine Serum (BCS)10%
MEM non-essential amino acids0.1 mM
Penicillin Streptomycin1%
The growth media here is a combination of the two different cell growth media.
We find that HEK can grow equally well in Calf Bovine Serum.
Blasticidin must be removed, since the 3T3 cells do not carry the resistance marker for it.

Detach cells from flask and re-suspend in 1 mL growth media

  1. Aspirate out media with a pipette (2 mL glass) Aspirate away from cells.
  2. Wash with 10 mL of DPBS (pre-warmed)
  3. Aspirate out media (2 mL glass)
  4. Add 2 mL of Trypsin, coat the well evenly. (5 mL pipette)
  5. Place 2 min in incubator (Minimize time in trypsin!, check if detached after 2 min)
  6. Add 8 mL of Co-culture media (w/ BCS), should inactivate rest of trypsin. (10 mL pipette)
  7. Pipette media up and down, using the surface to remove adherent cells.
  8. Put media in 10 mL tube and spin down for 5 min at 200 RCF.
  9. Aspirate cell media and resuspend in 1 mL media.

Measure cells with a cell counter
This step is highly recommended in order to seed the cells to an optimal density in the wells.
  1. Put 10 μL of cell media with 10 μL of dye for cell counter.
Seed Cells
Note
For a single well in a 18-well ibidi chamber, we find that seeding roughly 5000 3T3 cells and 4000 HEK cells together gives a good density of cells after an overnight growth.
We seed slightly more 3T3 cells because they tend to be larger than HEK and seeding more 3T3 gives better density of cells within a single field of view.


1. Pre-warm the co-culture growth media to 37C.
2. Take the prepped 18-well ibidi chamber and add 80 μL of pre-warmed media to all the wells that you want to seed the cells in.
  1. 3. Using cell counter, seed with 10 μL for EACH cell into the 18-well ibidis for a total of 100 μL.
If we want to seed 5k cells, then we need to dilute the cell culture to a density of 500 cells/μL
By pipetting a small volume of cells into a larger volume of media, we ensure a more even cell deposition.
4. Create a pre-mixture of both cell lines into a stock tube. ~200 μL.
5. Pipette 20 μL into each well that requires the mixture. Pipette up and down to mix.
6. Grow overnight in 37C incubator.
Fixation, Permeabilization, Reverse Transcription
Fixation, Permeabilization, Reverse Transcription
3h
3h

Note
The protocol for in situ reverse transcription here is largely similar to what we did with the mouse retina tissue. There are some differences in the fixation and permeabilization steps for cell culture.

Reagents:
ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Gibco, ThermoFisherCatalog #AM9625
ReagentTriton X-100Gibco, ThermoFisherCatalog #T8787-50ML
ReagentTween 20Gibco, ThermoFisherCatalog #P9416-50ML
ReagentPierce™ 16% Formaldehyde (w/v), Methanol-freeGibco, ThermoFisherCatalog #28908
ReagentFormamide (Deionized)Gibco, ThermoFisherCatalog #AM9342
ReagentSodium Chloride (5M)Gibco, ThermoFisherCatalog #AM9760G
ReagentDPBS with Ca and Mg Gibco, ThermoFisherCatalog #14040-133

Reagents for Reverse Transcription
ABC
ReagentsSupplierCat. No.
Thermo Scientific™ Maxima H Minus Reverse Transcriptase (200 U/μL) (includes 5X buffer)Thermo ScientificFEREP0753
Triton-X-100Sigma AldrichT8787- 50ML
5M NaClInvitrogenAM9760G
TWEEN® 20Sigma AldrichP9416- 50ML
PBSInvitrogenAM9625
FormamideInvitrogenAM9342
UltraPure WaterInvitrogen10977023
Deoxynucleotide (dNTP) Solution Mix - 8 μmol at 10mM eachNEBN0447S
RNaseOUT™ Recombinant Ribonuclease InhibitorInvitrogen10777019

Reverse Transcription DNA Oligos
ABCDE
NameDescriptionSequenceSupplierPurification
RT.5N.3GRT PrimerTTTACACGATTGAGTTATNNNNNGGGIDTHPLC
Recommended to dilute this primer to a 10 µM stock.

Buffers
Fixation buffer (4% FA)
Prepare in fume hood if possible, formaldehyde is toxic.
  • Take one ampule of 16% FA and dilute 1:4 in 1X PBS
  • Store aliquots in -20C

Permeabilization buffer (0.25% Triton X-100)
4 mL 1X PBS
10 µL Triton X-100

1X PBS (40 mL)
4 mL 10X PBS
36 mL Ultrapure water

0.1% PBS-Tween (30 mL)
30 mL 1X PBS
30 µL Tween-20

Stringent Wash (0.1% PBS-Tw + 60% formamide):
3 mL 10X PBS
18 mL 100% formamide
9 mL UltraPure H2O
30 μL Tween-20
Note: Store at 4C for use later during barcoding.

High-Salt Wash (1X PBS + 1 M NaCl + 0.1% Tween- 20):
4 mL 10X PBS
8 mL 5 M NaCl
28 mL UltraPure H2O
40 μL Tween-20
Note: Store at room temperature for use later during barcoding.

10% Triton X-100 (100 μL):
10 μL Triton X-100
90 μL UltraPure water
Note: Mix very well by vortexing. Recommended to make this in a 2 mL tube for better mixing.

Reverse Transcription Master Mix (RTMM)
ABC
ReagentReaction concentrationμL reagent per 50 μL reaction
5X RT buffer1x10
10 mM dNTPs300 μM1.5
UltraPure water26
10% Triton X-1000.5%2.5
10 μM RT.5N.3G primer1 μM5
100 mM RnaseOUT6 mM3
Maxima RT H Minus (200 U/uL)8 U/μL2
Total50
Note: Keep on ice. Leave out RnasaOUT and Maxima RT H Minus until final step.

Fixation and permeabilization

  1. Remove ibidi chamber with cells from the incubator and carefully remove the cell media. Cells may not be super adherent prior to fixation.
  2. Wash once with pre-warmed 37C DBPS.
  3. Warm 4% FA to room temperature. Fix cells by adding ~75 μL of 4% FA into each well for 10 minutes at room temperature.
  4. Wash wells 2x with 1X PBS.
  5. Permeabilize cells with 0.25% Triton for 10 minutes at room temperature.
  6. Wash wells 2x with 1X PBS.
  7. Immediately move to reverse transcription.

In situ Reverse transcription.

Add enzymes (Maxima RT H minus and RNAse Out) to Reverse Transcription Master Mix (RTMM) and mix well.

1. After washing wells with 1XPBS, add 50 µL of RTMM to each well.
2. Place slide on a flat-top thermocycler.

Reverse Transcription Thermocycler Program
12-cycle ramp program (Lid: 60°C):
Phase 1:
22°C 30 mins
Phase 2 (12 cycles):
8°C 30 s
15°C 30 s
25°C 30 s
30°C 1 min
37°C 1 min
42°C 2 min
Phase 3:
42°C 30 min
4°C Forever

3. Wash each well 3 x 5 min in Stringent Wash.
4. Wash each well 2 x 2 min in High Salt Wash.
5. Wash each well 2 x 2 min in 0.1% PBS-Tw.
6. Resuspend in 0.1% PBS-Tw.

Optional Pause Point: Store at 4C overnight before A-tailing.
2h 30m
A-Tailing
A-Tailing
45m
45m

Note
The A-tailing protocol for the cell-mixing is overall very similar to the one used for the retina barcoding protocol. The volumes of reagents used here will be reflective of the smaller 18-well ibidi chamber instead of the larger 8-well used for the retina barcoding protocol.

Reagents needed:
ReagentThermoPol Reaction Buffer Pack - 6.0 mlGibco, ThermoFisherCatalog #B9004S
Reagent2′3′-Dideoxyadenosine 5′-Triphosphate 100 mM solutionGibco, ThermoFisherCatalog #GE27-2051-01
ReagentDeoxynucleotide Solution Set - 25 umol of eachGibco, ThermoFisherCatalog #N0446S
We are only using the dATP from the dNTP set

ReagentTerminal Transferase - 2,500 unitsGibco, ThermoFisherCatalog #M0315L

ReagentPBS - Phosphate-Buffered Saline (10X) pH 7.4Gibco, ThermoFisherCatalog #AM9625
ReagentTween 20Gibco, ThermoFisherCatalog #P9416-50ML

Prepare Aliquots
1. Create aliquots of 10 mM dATP (20 µL aliquots) and 25 mM ddATP (~3 µL aliquots). Store at -20C.
Both reagents are supplied in ultrapure water.
2. Dilute 25 mM ddATP stock further to 250 μM (1:100 dilution from 25 mM stock).

Buffers
A-tailing master mix
ABCD
Reagent stock concentrationReaction concentrationµL reagent per 50 µL reactionCat no.
10X ThermoPol Reaction Buffer1X5B9004S
10 mM dATP1 mM5N0446S
250 μM ddATP25 μM5GE27-2051-01
Ultrapure water32.510977023
TdT enzyme (20,000U/mL)1000 U/mL2.5M0315L
Total50

0.1% PBS-Tw (30 mL):
30 mL 1X PBS
30 μL Tween-20

A-tailing protocol

  1. Wash wells once (from previous step) with 0.1% PBS-Tw.
  2. Aspirate, add 50 μL A-tailing Master Mix and incubate for 30 min at 37C.
  3. Wash 3 x 1 min in 0.1% PBS-Tw.

Optional Pause Point: Store at 4C overnight before barcoding.

Light-Directed Barcoding of cDNAs
Light-Directed Barcoding of cDNAs

Light-directed barcoding of select Cells for sequencing
Light-directed barcoding is performed sequentially for different regions of interest/cell populations within the same sample. For the cellmixing experiment, we barcoded roughly 25 cells for each cell line for a total of 50 cells per well.

Light-Seq barcodes used
In the paper, we barcoded the HEK cells first with barcode 1 (Cy5).
Then 3T3 cells second with barcode 2 (Cy3).
ABCDE
GATE.D12.B1 Barcode sequence 1 - Cy5 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDTATGGATGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy5-3] GeneLinkPAGE
GATE.D12.B2 Barcode sequence 2 - Cy3 labeled barcode strand. GGAGTTGGAGTGAGTGGATGAGTGATGDDDDDDDDDDDDGTTAGGTGAGTTATATAACTCA[cnvK]TCGTGTAAAT[Cy3-3] GeneLinkPAGE
Note: Fluorescently labelled barcode strands are light-sensitive and should be protected from light if left out for long periods of time, although some ambient light is acceptable.
Ambient light is generally far too low power to excite a fluorophore or activate the crosslinker. We routinely do all steps in well-lit rooms, but cover the samples and tubes with foil during incubation periods.

Barcoding Reagents
ABC
ReagentsSupplierCat. No.
Dextran Sulfate 50% SolutionSigma AldrichS4030
Salmon-sperm DNAThermo FisherAM9680
5 M NaClInvitrogenAM9760G
TWEEN® 20Sigma AldrichP9416- 50ML
PBSInvitrogenAM9625
FormamideInvitrogenAM9342
UltraPure WaterInvitrogen10977023
Barcode DNA Oligos (see sequences table)GeneLink

From the buffers we prepared in Step 5. We will also need.
1X PBS (40 mL)
4 mL 10X PBS
36 mL Ultrapure water

0.1% PBS-Tween (30 mL)
30 mL 1X PBS
30 µL Tween-20

Stringent Wash (0.1% PBS-Tw + 60% formamide):
3 mL 10X PBS
18 mL 100% formamide
9 mL UltraPure H2O
30 μL Tween-20
Note: Store at 4C for use later during barcoding.

High-Salt Wash (1X PBS + 1 M NaCl + 0.1% Tween- 20):
4 mL 10X PBS
8 mL 5 M NaCl
28 mL UltraPure H2O
40 μL Tween-20
Note: Store at room temperature for use later during barcoding.

Barcode Hybridization Solution (See note at top of section)
ABC
ReagentReaction concentrationμL per 50 μL well**
10X PBS1x5
5M NaCl500 mM5
UltraPure water38.7
TWEEN® 200.1%0.05
Total48.75
**Dextran sulfate makes this mix viscous, so it is recommended to make significant excess (~1.2X what is needed for the number of wells).

Barcoding Solution (250 nM final concentration)

Barcode 1 Solution (per 50 µL well - make excess!):
1.25 μL of 10 μM Barcode Strand (GATE.D12.B1)
48.75 μL hybridization master mix

Barcode 2 Solution (per 50 µL well - make excess!):
1.25 μL of 10 μM Barcode Strand (GATE.D12.B2)
48.75 μL hybridization master mix
Barcoding Workflow

1. Wash 1x with High Salt Wash.

2. Aspirate out High-salt and add 50 µL of Barcode 1 solution.
Incubate for 30 minutes at room temperature. Cover from light.

3. Aspirate to remove all liquid, then wash 3 x 1 min in High-Salt Wash.
This removes most of the un-hybridized barcoding strands.
The barcoding strand has enough base-pairing to be relatively stable in high-salt buffer.

4. Sample is now ready to be barcoded, bring to instrument and draw ROI's around desired regions.
See supplemental in publication for proper alignment of the photomask.

5. Wash wells 2x with Stringent Wash. Let sit in stringent wash for 2 minutes on last wash.
Repeat this step three more times, for a total of 4 x 2 = 8 washes.
6. Wash 2 x 2 min in High-Salt Wash, then add fresh High-Salt Wash.

7. Repeat steps 1-6 for Barcode 2.

Transfer to 0.1% PBS-Tween and optionally image barcoded cDNAs to visualize.
Optional Pause Point: Store at 4C overnight in a humidified chamber.
Displacement of cDNAs and cross-junction synthesis
Displacement of cDNAs and cross-junction synthesis
Now that cDNAs are barcoded and A-tailed, they must be extracted for library preparation and sequencing. To do this, the RNA template is digested by mild RNaseH treatment, which degrades the RNA bound to the barcoded cDNAs in situ, liberating the barcoded cDNAs for collection.

The workflow for cDNA displacement is largely similar to the one we used for the retina tissue.
Note: Use low retention tips.

Displacement Reagents
ABC
ReagentsSupplierCat. No.
ThermoPol® Reaction Buffer PackNEBB9004S
RNase H - 1,250 unitsNEBM0297L
UltraPure WaterInvitrogen10977023

Cross-Junction Synthesis Reagents
ABC
ReagentsSupplierCat. No.
Bst DNA Polymerase, Large Fragment- 8,000 unitsNEBM0275L
ThermoPol® Reaction Buffer PackNEBB9004S
UltraPure WaterInvitrogen10977023
Deoxynucleotide (dNTP) Solution Mix - 8 μmol at 10mM eachNEBN0447S
Cross-Junction Synthesis Primer
ABCDE
NameDescriptionSequenceSupplierPurification
GATC.20T.pPrimer for Cross-Junction SynthesisGAGAATGTGAGTGAAGATGTATGGTGATTTTTTTTTTTTTTTTTTTTIDTHPLC

Buffers
Displacement Mix
ABC
ReagentReaction concentrationµL reagent per 50 µL well
10x ThermoPol Reaction Buffer1x5 μL
RNase H (from NEB) (5,000U/mL)250 U/mL2.5 μL
UltraPure Water42.5 µL
Total50

Displacement Workflow

Note
NOTE: The eluate must be collected in this step!
At this point we must collect the generated cDNA library after displacement with RNAase H treatment.

As a general rule, every step should use low-retention tips and lo-bind tubes, and care should be taken to minimize the number of pipetting steps.

Because the cDNA library has not been PCR amplified at this stage, any pipetting error, or contaminating samples will be amplified for all downstream steps.

1. Aspirate out buffer from previous step and add 67.5 μL of Displacement Mix to each well.
Incubate on flat-top incubator for 37C for 30 minutes.

2. Prepare a set of lo-bind PCR tubes that will collect the eluate from each well by pipetting 1.6 μL of 1 μM GATC.20T.p cross-junction synthesis primer into each tube.
Pre-pipetting the primer into the tube will minimize the number of pipette steps the cDNA library is subjected to. For example, adding the primer after collection will introduce another pipette tip into the solution which some cDNA's may stick to.

3. Prepare a set of 20 nM GATC.20T.p primer solution. Take a low-retention tip and pipette this solution up and down and three times to "pre-block" it with the primer DNA.
Pipetting this solution with a tip helps to block the tip with some DNA to prevent any cDNA from sticking to the tip surface.
Take care not to generate bubbles during this step.

4. With the same empty tip from step 3, move to a well and carefully pipette the solution in the well up and down three times.
The well should still be in displacement mix along with the now displaced cDNA's. It is important to not over-pipette or introduce bubbles into the solution at this stage.
The mild agitation we introduce with pipetting up and down should help resuspend the cDNA library.

5. Collect the eluate and place in a collection tube that contains the GATC.20T.p primer. Pipette up and down a few times to mix the primer.

6. Repeat steps 1-5 with a fresh tip for all wells.

7. Heat inactivate the collection tubes in 75C for 20 min.

8. Re-hydrate the chamber wells and wash wells 3 times with 0.1% PBS-Tw.
The chamber containing the samples can be stored for follow-up immunostains.

9. Move on to Cross-junction synthesis.

Optional: Samples can be imaged after displacement to verify that the fluorescent barcode signal is no longer present. At this point, follow-up stains can be performed on the sample including antibody stains, H&E, etc.

Barcoded sample
Barcoded HEK (magenta) and 3T3 cells (mouse)
Displaced samples
Fluorescent image of same cells after displacement of cDNA's. Note that most of the nuclear signal remained while the cytoplasmic signal decreased. Thus the collected cDNA library is mostly cytoplasmic RNA.
Cross-junction synthesis

1. Add 10.9 μL Cross-Junction Synthesis Mix to each tube:

Cross-Junction Synthesis Mix
ABC
ReagentFinal Reaction concentrationμL reagent per 80 μL well
10X ThermoPol buffer1x1.25
10mM dNTPs100 μM0.8
Ultrapure water0.85
Bst LF polymerase (8,000U/mL)800U/mL8
Total10.9
Note: These volumes are for 80 μL wells, and volumes should be scaled according to well volume. Note that the primer (GATC.20T.p) was added in the previous step, before heat inactivation.

2. Vortex and spin briefly.
3. Incubate in a thermocycler for:
37C for 30 mins
80C for 20 mins (heat inactivation)
4. The resulting products are CJS Samples. Proceed to qPCR to amplify CJS Samples.

Optional Pause Point : Store at -20C overnight.
qPCR Amplification
qPCR Amplification

Note
The qPCR protocol for the cell mixing is largely similar to the one for the retina tissue.

Cross-Junction Synthesis libraries of barcoded cDNAs are now amplified and prepared for sequencing. We tested both the Kapa Hifi HotStart and Taq polymerase for this step and saw similar results for both. Only the Kapa Hifi results were published in the paper.
We recommend performing qPCR with 30 cycles on a small subset of each sample (5 μL sample in a 10 μL PCR), to identify the appropriate cycle number where the yield displays an inflection point for optimal amplification.

qPCR Primers
ABCDE
NameDescriptionSequenceSupplierPurification
GATEPCR Primer 1GGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
GATCPCR Primer 2GAGAATGTGAGTGAAGATGTATGGTGAIDTHPLC

Reagents for qPCR
ABC
ReagentsSupplierCat. No.
SYBR™ Green I Nucleic Acid Gel Stain - 10,000X concentrate in DMSOInvitrogenS7563
HiFi HotStart DNA Polymerase, KapaBiosystemsRocheKK2502
UltraPure WaterInvitrogen10977023

qPCR to Determine Amplification Cycle Number
1. Vortex CJS Samples.
2. Dilute Sybr Green I dye in water to make 5x solution (e.g. dilute 10,000X stock twice, 1:100 in water, then 1:20 in water).
3. Create PCR master mix:

AB
Kapa qPCR Master Mix
ReagentµL reagent per 10 µL reaction
5x SYBR Green I1
Kapa HiFi HotStart buffer (5x)2
10 µM GATE primer0.3
10 µM GATC primer0.3
10 mM dNTPs from Kapa kit0.3
UltraPure water0.9
Kapa HiFi Hot Start polymerase0.2
Total5
The ratio of Kapa qPCR Master Mix to Cross-Junction Synthesis Solution is 1:1, so each sample will have a 10 μL total PCR with 5 μL of Kapa qPCR Master Mix and 5 μL of Cross-Junction Synthesis Solution.

4. Quickly vortex and spin down master mix, then add 5 μL master mix into each tube.
5. Add 5 μL of appropriate sample from Cross-Junction Synthesis reaction to each tube.
6. Quickly vortex and spin down reactions.
7. Place into qPCR machine for 30 cycles and run the qPCR Machine Protocol.
qPCR Machine Protocol
98C for 3 minutes
30 cycles of:
98C for 20 seconds
60C for 30 seconds
72C for 2 minutes
Plate read
72C for 5 minutes
Melting curve analysis
Hold at 4C
8. Check amplification graph to choose appropriate cycle number.

Note
NOTE: Cycle number for amplification of the remaining Cross-Junction Synthesis Product should be chosen to prevent over-amplification of the library. In general, the optimal cycle number will correlate with the size of the barcoded region, which directly impacts how much amplifiable cDNA exists within the reaction.Note that for technical replicates, the amplification curves are generally very consistent. In general, optimal cycle number will vary across experiments and we recommend that the full PCR is run at the optimal cycle number per experiment.


After the test qPCR on a small amount of sample, a PCR is performed on all of the CJS Samples to amplify the entire sample for library preparation and sequencing. The cycle number for amplification is chosen based on the test qPCR in the previous step, to prevent over-amplification. Each Cross-Junction Synthesis product (1 per sample well) is amplified in a separate tube. This protocol is identical to the prior qPCR, but scaled to amplify the entire sample and with a reduced number of cycles.

All of the sample should be amplified. However, some qPCR machines have a limit of 50 uL/reaction. Therefore, the full volume should be split into multiple PCRs to ensure accurate amplification.

Amplification of Full Samples
1. Briefly vortex and spin CJS Samples.
2. Measure the volume of CJS sample in each tube and use to calculate volume of qPCR master mix needed for each sample (1:1 ratio of qPCR master mix : CJS sample).
Note: Ensure that PCR volumes do not exceed the limits for your machine and otherwise, split into multiple tubes.
3. Dilute Sybr Green I dye in water to make 5x solution (e.g. dilute 10,000X stock twice, 1:100 in water, then 1:20 in water).
4. Create qPCR master mix:

AB
Kapa Full qPCR Master Mix
ReagentµL reagent per 50 µL reaction
5x SYBR Green I10
Kapa HiFi HotStart buffer (5x)20
10 µM GATE primer3
10 µM GATC primer3
10 mM dNTPs from Kapa kit3
Ultrapure water9
Kapa HiFi hot start polymerase2
Total50
5. Add the entire remaining sample with equal parts master mix to each tube.
6. Quickly vortex and spin down reactions.
7. Place into qPCR machine for exactly XX cycles and run the Full qPCR Machine Thermocycler Program.

Full qPCR Machine Thermocycler Program
98C for 3 minutes
XX cycles of:
98C for 20 seconds
60C for 30 seconds
72C for 2 minutes
Plate read
72C for 5 minutes
Hold at 4C
*XX is based on the amplification curves from the test qPCR. This number will likely range between 16 and 25.
8. The resulting products are Amplified Samples. Store at -20C.

Ideally the amplification will stop right at the exponential phase of the signal.
An example is shown in a phone screenshot below where the amplification is stopped at cycle 22. Past this cycle would be the inflection point and the signal increase will start to slow and eventually plateau. There is generally little benefit to amplifying the library past this point and can also lead to over-amplification of the library.

Example qPCR curve

Note
As a general rule, we like to keep amplified libraries separate from non-amplified libraries. In our case, separate -20 freezers for amplified and non-amplified samples.
Library Preparation for Illumina Sequencing
Library Preparation for Illumina Sequencing
Light-Seq uses conventional tagmentation-based library preparation for Illumina sequencing, but with custom primers for the secondary PCR and for Read 1/i5 sequencing. The custom primers are necessary to specifically enrich for and sequence amplicons containing the light-directed barcode sequences. The first step is bead purification of the amplified libraries for each well, followed by tagmentation, secondary PCR amplification, and a second bead purification.

We generally like to use the magnetic stand rack from permagen
Equipment
0.2 mL PCR Strip Magnetic Stand
NAME
Permagen
BRAND
MSR812
SKU
LINK

Library Preparation Reagents
ABC
ReagentsSupplierCat. No.
Magnetic Separator (or equivalent)PermagenMSR812
Ampure XP BeadsBeckmanA63881
Ethyl alcohol, pure (200 proof)Sigma AldrichE7023-1L
Qubit™ 1X dsDNA High Sensitivity (HS) and Broad Range (BR) Assay KitsInvitrogenQ33231
Nextera XT Library Preparation KitIlluminaFC-131-1096
UltraPure WaterInvitrogen10977023

Library Preparation DNA Oligos
These primer sequences are used for unique indexing of samples for pooled sequencing. For each sample, a unique pair of S50X and Next.N70X are required. You do not need to order all primers, only enough pairs to uniquely index your samples of interest. Because the custom i5 index primer does not work well on all Illumina machines, we highly recommend each sample be prepared with a unique i7 index. We hope to adjust our recommendations on this front soon, so stay tuned for updated protocols.

The full table of index primers used can be found in the supplement of our publication
as well as the partner protocols.io for the retina

Bead purification of Amplified Samples
NOTE: Each well/replicate is processed separately.

The ampure bead purification is based off of the ratio of sample volume to beads. The ampure bead solution contains PEG. The premise is that the the PEG will act as a crowding agent to induce DNA binding to the bead surface, and the concentration of PEG can be adjusted to size select for the desired DNA size. We use a 1.2x ratio for bead purification which should get rid of most DNA <100 bp, <100bp should get rid of most primer dimers and fragmented DNA.

  1. Make 50 mL of 80% Ethanol, diluted in UltraPure water. (Over time the concentration will slowly decrease but even a 70% Ethanol mixture will also work).
  2. For each well, combine 80 µL Amplified Sample with 96 µL Ampure XP Beads in a new PCR tube. 1.2x ratio.
  3. Mix well by pipetting (incubate at room temperature for 5 min). DO NOT overextend this step.
  4. Place on Magnetic Separator Stand for 2 min.
  5. Discard supernatant. Wash 3 x 30 sec with 200 µL of 80% Ethanol.
  6. Discard ethanol and aspirate remainder with a small 10 µL tip.
  7. Air dry for ~5 min, until beads are dry. Beads will change color slightly when dry. Try not to overdry the beads, otherwise they will crack.
  8. Add 30 µL of Ultrapure water to resuspend the beads.
  9. Remove from the magnetic stand. Mix well by pipetting or vortexing and incubate for 2 min at room temperature.
  10. Place Magnetic Separator Stand for 1 min. Collect supernatants in new PCR tubes. These are Purified Amplified Samples.



Measure DNA concentrations of Amplified Samples with Qubit HS dsDNA assay.
It is critical that an accurate dsDNA concentration is obtained for the next step. A nanodrop is not sufficient for this purpose. Therefore a Qubit high sensitivity dsDNA assay must be performed on all samples.

This should be done according to the manufacturer's instructions, found here: https://assets.fishersci.com/TFS-Assets/LSG/manuals/MAN0017455_Qubit_1X_dsDNA_HS_Assay_Kit_UG.pdf.

1. Measure concentrations using Qubit Fluorometer.
2. Record concentrations of each Purified Amplified Sample.

Perform Nextera tagmentation
Reagents in this section are from the Nextera XT Library Preparation Kit (Illumina cat. no. FC-131-1096). Tagmentation will fragment the amplified PCR products into shorter sequences, and the length of the reaction time determines how much fragmentation occurs. Therefore, it is very important to follow the times strictly.

1. In a clean set of PCR tubes, aliquot 7 µL of Neutralize Tagment Buffer (NT). This will be used to stop the tagmentation and prevent over-tagmentation. One tube per sample/well is required. Set aside, next to the thermocycler.

2. To a new PCR tube for each Purified Amplified Sample (on ice):
a. Add 10 µL of Tagment DNA buffer (TD)
b. Add 2 ng of purified Purified Amplified Samples and add water up to 5 µL. Calculated sample and water volume to add based on the Qubit concentrations from previous step.
c. Add 5 µL of Amplicon Tagment Mix (ATM) to lid of tube. This mixture contains the tagmentation enzyme. We will spin the tube down to add all enzymes at the same time.

3. Briefly spin down tubes, vortex, and spin down. The tagmentation enzyme has now been added.

4. Place into PCR machine and incubate at 55°C for EXACTLY 5 minutes.

5. Immediately stop reactions with 5 µL of Neutralize Tagment buffer (NT).
(Use a multichannel to pipette the buffer from the previously aliquoted PCR tubes in step 1 to mix quickly).

6. Vortex and spin to ensure full mixing. Hold Tagmented Samples on ice.

Sample indexing PCR with unique i5 and i7 primer pairs
To pool Tagmented Samples from each well/replicate for sequencing, each sample is assigned a unique pair of i7 and i5 primer sequences. The primer pairings should be decided and documented. Each Tagmented Sample will be amplified briefly in this step to attached the sample-specific i5 and i7 sequences.

1. Assign and record unique index primer pairs to each sample. For example:
ABC
Samplei5 primeri7 primer
Tagmented Sample 1 (Well 1)S502.GATENext.N701
Tagmented Sample 2 (Well 2)S503.GATENext.N702
Tagmented Sample 3 (Well 3)S505.GATENext.N703
Tagmented Sample 4 (Well 4)S506.GATENext.N704
Each sample will receive a different pair of primers in the indexing PCR.

2. To each Tagmented Sample tube from the previous tagmentation step:
a. Add 6.5 µL water
b. Add 1.75 µL of standard Nextera (i7: Next.N70X) primer (from 10 uM stock)
c. Add 1.75 µL of custom Nextera (GATE, i5: S50X.GATE) primer (from 10 uM stock)
d. Add 15 µL PCR mix (NPM PCR master mix)
3. Vortex and spin down reactions.
4. Place in thermocycler and start Indexing PCR Program.
Indexing PCR Program
72°C for 3 minutes
95°C for 15 seconds
12 cycles of:
95°C for 15 seconds
55°C for 15 seconds
72°C for 40 seconds
72°C for 1 minute
Hold at 10°C
5. The resulting tubes are the Indexed Samples.

Purify indexed samples with Ampure Beads
The final bead purification will remove primers and other reagents from the sample prior to sending off for NGS. We now use a ratio of 0.9x as the indexed samples of interest should be a bit longer now.
  • Make 50 mL of 80% Ethanol, diluted in UltraPure water.
  • For each well, combine 50 µL of Indexed Sample and mix with 45 µL Ampure XP Beads in a new PCR tube.
  • Mix well by pipetting (incubate at room temperature for 5 min). DO NOT overextend this step.
  • Place on Magnetic Separator Stand for 2 min.
  • Discard supernatant. Wash 3 x 30 sec with 200 µL of 80% Ethanol.
  • Discard ethanol and aspirate remainder with a small 10 µL tip.
  • Air dry for ~5 min, until beads are dry. Beads will change color slightly when dry.
  • Add 30 µL of water to resuspend the beads.
  • Remove from the magnetic stand. Mix well by pipetting or vortexing and incubate for 2 min at room temperature.
  • Place on Magnetic Separator Stand for 1 min.
  • Collect supernatants in new tubes. These are the Purified Indexed Samples.

Measure DNA concentrations and length of Indexed Samples
1. Measure concentrations using Qubit HS dsDNA assay. This should be done according to the manufacturer's instructions, found here: https://assets.fishersci.com/TFS-Assets/LSG/manuals/MAN0017455_Qubit_1X_dsDNA_HS_Assay_Kit_UG.pdf.
2. Record concentrations of each Purified Indexed Sample.
3. Run 2 µL of each Purified Indexed Sample on a 1% agarose gel.


Sequencing
Sequencing
This library preparation is compatible with standard Illumina next-generation sequencing. Note that custom Read 1 and i5 index primers are required and are listed in the table below.

DNA Oligos for Sequencing
ABCD
DescriptionSequenceSupplierPurification
Custom Read 1 Primer -required for sequencing of amplicons.CGCCGGAGTTGGAGTGAGTGGATGAGTGATGIDTHPLC
Custom i5 index primer -required for some Illumina sequencers (see caption).CATCACTCATCCACTCACTCCAACTCCGGCGIDTHPLC
We note that the custom index primer is compatible with HiSeq, but for NovaSeq, unique i7 indices were needed for de-convolution due to inefficient i5 index sequencing.
We have found adding 60% above the standard concentration of each custom primer works well on many of the Illumina sequencers and would recommend this as a starting point.

Pooling samples and prepping for sequencing.
When preparing a pooled sample for sequencing, the total amount of DNA should not exceed the recommended amount for the NGS platform you are using. For example MiSeq and other instruments typically recommend 4 nM of DNA.

Below is an example prep we used for a MiSeq machine with a 30% PhiX spike in.
1. Prepare freshly diluted 0.2N NaOH.
2. Dilute PhiX to 4nM: 1 µL 10nM PhiX stock + 1.5 µL water
3. Prepare a pooled sample at 4 nM concentration. The volume needed should be calculated based on the final Qubit reading and the size of the amplicon from the gel.
4. Mix 1.5 µL 4nM PhiX + 3.5 uL 4nM pool (30% spike in)
5. Add 5 µL diluted NaOH, incubate for 5 minutes.
6. Add 1,657 µL Hyb buffer (HT1), vortex to make 12 pM. (HT1 will come with the MiSeq kit).
7. Add 600 µL of this sample to Well 17, tape over to avoid dust. This is the sample well.
8. Add 3.2 µL P5.GATE.p (Custom Read 1 Primer) into reservoir 12 (use syringe to pull out, spike primer, mix well, replace)
We have had good success with elevated custom primer concentrations on Illumina MiSeq and NextSeq machines. The standard custom primer concentrations worked for HiSeq. For NovaSeq, we haven't seen as good efficiency even with the elevated custom primer concentrations, particularly for the custom i5 index sequencing but hope to have updated recommendations soon. For now, we recommend having unique i7 index sequences for each sample to aid in sequence de-multiplexing, and that you check back here periodically or reach out for updated sequencer-specific recommendations.
Immunostaining
Immunostaining
A final immunostaining step can be performed on the cells.

All antibodies were spun down at 10,000 g for 10 min at 4 °C before use. Primary antibody mix (1x)
(150 µL) 1x PBS, 0.3% Triton X-100, 5% BSA mixture
(2 µL) Lamin B goat primary
(2 µL) TFAM mouse primary
(2 µL) alpha-tubulin rat primary

Secondary antibody mix (1x)
(150 µL) 1x PBS, 0.3% Triton X-100, 5% BSA mixture (1 µL) secondary alexa 647 anti-mouse
(1 µL) secondary Cy3b anti-goat
(1 µL) secondary alexa 488 anti-rat

1. Aspirate, add primary antibody solution and incubate at Room temp for 1 hour.
2. Wash 2 x 1 minute with 1xPBS
3. Aspirate, add secondary antibody solution and incubate at Room temp for 1 hour.
4. Wash 2 x 1 minute with 1xPBS
5. Aspirate, add DAPI solution and incubate at Room temp for 5 minutes.
6. Wash 2 x 1 minute with 1xPBS and resuspend in fresh 1xPBS
7. Image