Jun 21, 2022
iTracer-perturb Plasmid Prep
This protocol is a draft, published without a DOI.
- 1ETHZ - ETH Zurich
Protocol Citation: Ashley Maynard, Hsiu-Chuan Lin 2022. iTracer-perturb Plasmid Prep. protocols.io https://protocols.io/view/itracer-perturb-plasmid-prep-b66drha6
Manuscript citation:
He, Z., Maynard, A., Jain, A. et al. Lineage recording in human cerebral organoids. Nat Methods 19, 90–99 (2022). https://doi.org/10.1038/s41592-021-01344-8
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: April 05, 2022
Last Modified: June 21, 2022
Protocol Integer ID: 60325
Keywords: lineage tracing, barcodes, genomic lineage tracer, iTracer
Abstract
Induced pluripotent stem cell (iPSC)-derived organoids provide models to study human organ development. Single-cell transcriptomics enable highly resolved descriptions of cell states within these systems; however, approaches are needed to directly measure lineage relationships. Here we establish iTracer, a lineage recorder that combines reporter barcodes with inducible CRISPR–Cas9 scarring and is compatible with single-cell and spatial transcriptomics. We apply iTracer to explore clonality and lineage dynamics during cerebral organoid development and identify a time window of fate restriction as well as variation in neurogenic dynamics between progenitor neuron families. We incorporate gene perturbation (iTracer-perturb) and assess the effect of mosaicTSC2 mutations on cerebral organoid development. Our data shed light on how lineages and fates are established during cerebral organoid formation. More broadly, our techniques can be adapted in any iPSC-derived culture system to dissect lineage alterations during normal or perturbed development.
This protocol describes the creation of the iTracer vectors.
Order iTracer plasmids
Order iTracer plasmids
pSBbi-iTracer-perturb-R2AG-gG
pSBbi-iTracer-perturb-B2AG-gG
Order and amplify the guide donor plasmid
Order and amplify the guide donor plasmid
Order plasmid: pMJ114 from addgene (https://www.addgene.org/85995/?gclid=CjwKCAjw0a-SBhBkEiwApljU0o4BqNfCIJ0XWMbzs8XS691A3nujA1zPVsyWJjiVOAHEKqRWnAoSQxoCzXoQAvD_BwE)
Amplify pMJ114 by taking a non-filtered p10 tip and dipping into glycerol stock of pMJ114. Add this tip to 3 mL of 2yt buffer + Ampicillin
Incubate Overnight (~16hr) at 37 °C .
Harvest the cells from the liquid culture and use a Qiagen Miniprep (Qiagen #27106X4) column to purify the plasmid and elute in 35 µL . Nanodrop the purified plasmid to obtain the concentration.
Digest the pMJ114 plasmid
Digest the pMJ114 plasmid
BstXI followed by BlpI digestion (removes the "filler" guide")
Run a 1% agarose gel and preform a gel extraction clean up to obtain a clean plasmid fragment.
Order custom guide
Order custom guide
To add your custom guide first order your guide, replacing [YOURgRNA] sections with the sequences you wish to target.
forward: atgg [YOURgRNA] gtttaagagc
reverse: ttagctcttaaac [YOURgRNA(complement and reverse)] ccataaac
Ligate your custom gRNA into pMJ114 plasmid
Ligate your custom gRNA into pMJ114 plasmid
Phosphorylate and anneal the oligo pairs from step 8:
1 µL 10uM forward primer
1 µL 10uM reverse primer
1 µL of 10x T4-Ligase Buffer
6.5 µL water
Ligate (T4 DNA ligase, NEB #M0202S)
100 ng of digested plasmid from step 7
1 µL of phosphorlated and annealed oligo pairs from step 9
3 µL of 10x ligase buffer
1 µL of T4 DNA ligase
add water to 30 µL
Incubate at Room temperature for at least 1hr
Transform component cells with:
50 µL cells + 10 µL reaction mix
On ice 00:15:00
Heat shock the cells for 00:00:45 at 42 °C
Place tubeOn ice for 00:01:00
Add 350 µL SOC
Incubate by shaking (~250 rpm ) for 00:45:00 at 37 °C
Plate cells on Amp plates and incubate overnight at 37 °C
Select a subset of colonies for sequencing for quality control and for mini prep. Here you will split the colony between your choice of sequencing platform to check for incorporation of your guide and amplifying your colony by taking a non-filtered p10 tip and dipping into colony and adding this tip to 3 mL of 2yt buffer + Ampicillin.
Mini prep (Qiagen #27106X4) the clone(s) that sequencing confirms has the incorporated guide.
PCR amplify the guide area using:
forward primer: ggggtcggcaattgaaaccggtcgtgaccgagcttgtctgccc
reverse prmer: gggaaataggccctcgcacatcgtgatagtcagactggaaaaaaagcacc
Amplify barcodes by combing the following in a PCR tube:
1.25 µL 10uM forward primer
1.25 µL 10uM reverse primer
1.25 µL guide template
12.5 µL of Phusion Master Mix
9.5 µL water
Run PCR program
98 °C for 00:02:00
(25 cycles total)
Step 5.2: 98 °C for 00:00:10
Step 5.3: 58 °C for 00:00:20
Step 5.4: 72 °C for 00:00:20
72 °C for 00:05:00
4 °C until ready to proceed.
7m 50s
Run a 1% agarose gel and preform a gel extraction clean up to obtain a clean PCR product (guide product).
Amplify iTracer-perturb plasmid
Amplify iTracer-perturb plasmid
1h 1m 45s
1h 1m 45s
Transform component cells with:
50 µL cells + 2 µL plasmid
On ice 00:15:00
Heat shock the cells for 00:00:45 at 42 °C
Place tubeOn ice for 00:01:00
Add 350 µL SOC
Incubate by shaking (~250 rpm ) for 00:45:00 at 37 °C
Add reaction mix to 3 mL of 2yt buffer + Ampicillin
1h 1m 45s
Incubate Overnight (~16hr) at 37 °C .
Harvest the cells from the liquid culture and use a Qiagen Miniprep (Qiagen #27106X4) column to purify the plasmid and elute in 35 µL . Nanodrop the purified plasmid to obtain the concentration.
AgeI digest of iTracer-perturb plasmid
AgeI digest of iTracer-perturb plasmid
To cut the plasmid for guide-product insertion first digest the plasmid with AgeI by combining in a PCR tube:
5 µg iTracer-perturb plasmid
5 µL Cutsmart buffer (NEB #B7204)
3 µL AgeI
fill to 50 µL with water
Incubate 37 °C Overnight
Run 1% agarose gel with digested and undigested plasmid (control) to check for complete cutting.
Perform a column clean up (Macherey-Nagel #REF740609.50) of AgeI fragmented plasmid and nanodrop.
Gibson assembly of guide product and iTracer-perturb
Gibson assembly of guide product and iTracer-perturb
Calculate the pmol of 1ul of the guide-product and the pmol of 1ul of the iTracer-perturb plasmid fragment (this calculator can help https://ch.promega.com/resources/tools/biomath/)
Example:
guide amplicon = 500bp with 0.18ug/ul = 0.55pmol DNA (in 1ul)
plasmid fragment = 5613bp with 0.2044ug/ul = 0.055pmol (in 1ul)
guide product should be 10 fold the molar excess of an insert, therefore:
10 x 0.055 pmol (the plasmid fragment) = 0.55 pmol (the molarity we need of our barcodes)
In this example we will use 1ul of guide-product for 1ul of vector in the gibson assembly
Combine in a PCR tube:
calculated amount of guide-product (shown above)
1uL iTracer-perturb (AgeI fragmented plasmid)
10 µL Gibson Assembly Mix (NEB #E2611S)
fill to 20 µL with water
** control run same reaction without guide product.
Incubate 00:15:00 at 50 °C . Then place On ice .
15m
50 µL cells + 10 µL reaction mix
On ice 00:15:00
Heat shock the cells for 00:00:45 at 42 °C
Place tubeOn ice for 00:01:00
Add 350 µL SOC
Incubate by shaking (~250 rpm ) for 00:45:00 at 37 °C
Plate the reaction volume on Ampicillin plates and incubate Overnight at 37 °C
Plate the control reaction on Ampicillin plates and incubate Overnight at 37 °C
Select a subset of colonies for sequencing for quality control and for mini prep. Here you will split the colony between your choice of sequencing platform to check for incorporation of your guide and amplifying your colony by taking a non-filtered p10 tip and dipping into colony and adding this tip to 3 mL of 2yt buffer + Ampicillin.
Mini prep (Qiagen #27106X4) the clone(s) that sequencing confirms has the incorporated guide. (iTracer-perturb+guide plasmid)
Order barcodes
Order barcodes
To ensure the greatest barcode diversity please order the barcode components below:
barcode template: GGACGAGCTGTACAAGTAAGCTGATCCWNNNNNNNNNWCCAAGCgcccttgagcatctgacttc
barcode forward primer: GGACGAGCTGTACAAGTAAGCTG
barcode reverse primer: gaagtcagatgctcaagggcGCTTG
Amplify barcodes
Amplify barcodes
Resuspend all primers to concentration of 100 micromolar (µM) , you can store these stocks at -20 °C
Dilute stock primers to 10 micromolar (µM)
Dilute barcode template 50 micromolar (µM)
Amplify barcodes by combing the following in a PCR tube:
1.25 µL diluted barcode forward primer (from step #3)
1.25 µL diluted barcode reverse primer (from step #3)
0.5 µL diluted barcode template (from step #3)
9.5 µL water
Run PCR program
98 °C for 00:02:00
(25 cycles total)
Step 5.2: 98 °C for 00:00:10
Step 5.3: 58 °C for 00:00:20
Step 5.4: 72 °C for 00:00:20
72 °C for 00:05:00
4 °C until ready to proceed.
7m 50s
Run 1% agarose gel with 1 µL of amplified barcode product to check for successful amplification.
NotI Digest of iTracer-perturb+guide plasmid
NotI Digest of iTracer-perturb+guide plasmid
To cut the plasmid for barcode insertion first digest the plasmid with NotI-HF by combining in a PCR tube:
5 µg iTracer-perturb+guide plasmid
5 µL Cutsmart buffer (NEB #B7204)
3 µL NotI-HF
fill to 50 µL with water
Incubate 37 °C Overnight
Run 0.5% agarose gel with digested and undigested plasmid (control) to check for complete cutting.
Perform a get extraction clean up (Macherey-Nagel #REF740609.50) of EcoRI fragmented plasmid and nanodrop.
Gibson Assembly of Barcodes into iTracer plasmid
Gibson Assembly of Barcodes into iTracer plasmid
15m
15m
Calculate the pmol of 1ul of the barcodes (step #7) and the pmol of 1ul of the plasmid fragment (step #13) (this calculator can help https://ch.promega.com/resources/tools/biomath/)
Example:
barcodes = 63bp with 0.0238ug/ul = 0.57pmol DNA (in 1ul)
plasmid fragment (iTracer-R) = 5613bp with 0.2044ug/ul = 0.055pmol (in 1ul)
barcodes should be 10 fold the molar excess of an insert, therefore:
10 x 0.055 pmol (the plasmid fragment) = 0.55 pmol (the molarity we need of our barcodes)
In this example we will use 1ul of barcodes for 1ul of vector in the gibson assembly
Combine in a PCR tube:
1ul of the calculated volume of EcoRI fragmented plasmid
1ul of the calculated volume of barcodes from step #15
10 µL NEBuilder®HiFi DNA Assembly Master Mix (NEB #E2621S)
fill to 20 µL with water
** Make sure to set-up a control following the same reaction conditions above but without barcodes, instead add water. We will use this reaction to estimate self ligation of the plasmid.
Incubate 00:15:00 at 50 °C . Then place On ice .
15m
50 µL cells + 10 µL reaction mix
On ice 00:15:00
Heat shock the cells for 00:00:45 at 42 °C
Place tubeOn ice for 00:01:00
Add 350 µL SOC
Incubate by shaking (~250 rpm ) for 00:45:00 at 37 °C
1h 1m 45s
Plate the total reaction volume on Ampicillin plates (x3 15cm square plates) and incubate Overnight at 37 °C
Plate 30% of total volume of the control reaction (to be comparable to experimental above) and incubate Overnight at 37 °C
Collect final plasmids
Collect final plasmids
To collect Gibson assembled plasmids use 10 mL of 2yt buffer and a scraper to collect all the colonies.
Wash the plate with5-7 mL 2yt buffer and collect in the same tube as the collection in step #18.
Perform x3 Qiagen Midiprep (Qiagen #12143) reactions, elute in 200 µL
Pool final midiprep reactions (final volume ~600 µL ) and nanodrop for final concentration. You now have barcoded iTracer-perturb plasmids ready for electroporation into your cells!