Malik AU, Karapetsas A, Nirujogi RS, Chatterjee D, Phung TK, Wightman M, Gourlay R, Morrice N, Mathea S, Knapp S, Alessi DR, PKC isoforms activate LRRK1 kinase by phosphorylating conserved residues (Ser1064, Ser1074 and Thr1075) within the COR GTPase domain. Biochemical Journal 479(18). doi: 10.1042/BCJ20220308
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: April 19, 2022
Last Modified: August 15, 2022
Protocol Integer ID: 60998
Keywords: LRRK1, Bacculovirus, Protein production
Abstract
The production of LRRK1 protein and its variants was performed using bacculovirus expression system. The method includes three major steps cloning, large scale expression and protein purification. The high quality LRRK1 protein produced through this method has been used for further biochemical and biophysical studies.
Guidelines
Expression
Protein quality depends on several factors, for eg. condition of insect cells, virus quality, expression time etc.
Purification
Every steps are performed at 4 °C
Column and beads has to properly equilibrated or regenerated before starting
Protein stability during purification can be improved by using different strategies, such as increasing salt concentration, use of additives or protease inhibitors
Materials
PURIFICATION BUFFERS
Ni-NTA
Lysis or Wash Buffer
50 mM HEPES 7.4, 500 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, 5% glycerol
Elution Buffer
50 mM HEPES 7.4 500 mM NaCl, 300 mM imidazole, 0.5 mM TCEP, 5% glycerol
SP chromatography
Buffer Minus
20 mM HEPES 7.4 0.5 mM TCEP, 5% glycerol
Buffer Plus
20 mM HEPES 7.4, 2.5 M NaCl, 0.5 mM TCEP, 5% glycerol
Buffer 250
20 mM HEPES 7.4, 250 mM NaCl, 0.5 mM TCEP, 5% glycerol
GF or Storage Buffer
20 mM HEPES 7.4, 150 mM NaCl, 0.5 mM TCEP, 0.5% glycerol
EQUIPMENTS
Shaker
Infors HT multitron
Centrifuge
Thermo Scientific Sorvall LYNX 6000
AKTA
ÄKTA Basic
ÄKTA Pure 25
MATERIALS
Expression
Insect-XPRESS Medium (Lonza)
3 L-Erlenmeyer glass flask
Purification
Ni-beads (Cytiva #17531803)
SP-sepharose column (Cytiva #17505701)
HiLoad 16/600 Superdex 200 pg gel filtration column
Amicon Ultra 15 mL Centrifugal Filters 10,000 MWCO (Millipore)
Safety warnings
All experiments were performed following the rules of S1 lab regulations.
Cloning & mutagenesis
Cloning & mutagenesis
Amplify the DNA coding for the human LRRK1 residues 20 to 2015 (OHu72031 from Genscript) using the forward primer TACTTCCAATCCGCTGTGTGTCCAGAACGTGCCATGG and the reverse primer TATCCACCTTTACTGTCACCTTCTCTTGCGAGTGCAAGCCTCC. PCR was performed by applying a touch-down protocol.
Thermal cycling procedure:
95 °C00:10:00
(95 °C00:00:3068 °C00:00:3068 °C00:10:00 ) X 5
(95 °C00:00:3060 °C00:00:3068 °C00:10:00 ) X 5
(95 °C00:00:3055 °C00:00:3068 °C00:10:00 ) X 5
(95 °C00:00:3050 °C00:00:3068 °C00:10:00 ) X 20
68 °C00:10:00
1h 4m
The T4 polymerase-treated amplicon was inserted into the transfer vector pFB-6HZB (SGC) by ligation-independent cloning.
Point mutations were introduced applying the QuikChange method.
The resulting plasmids were utilized for the generation of recombinant Baculoviruses according to the Bac-to-Bac expression system protocol (Invitrogen).
Expression
Expression
9.6 L of exponentially growing Sf9 cells (2 X 106 cells/mL in Lonza Insect-XPRESS medium) were infected with high-titre Baculovirus suspension.
After 66:00:00 of incubation (27 °C and 90 rpm), cells were harvested by centrifugation.
2d 18h
Purification
Purification
1h
1h
The pelletes were washed with PBS, re-suspended in lysis buffer (50 mM HEPES 7.4, 500 mM NaCl, 20 mM imidazole, 0.5 mM TCEP, 5% (by vol) glycerol).
Lysed by sonication on ice using a 13‑mm probe (35% amplitude, 5 s pulse / 10 s pause, 3 min total pulse time).
The lysate was cleared by centrifugation (01:00:00, 100.000 x g, 4 °C).
1h
The supernatant is loaded onto a previously equilibrated Ni-beads (Cytiva #17531803) in gravity flow columns.
After vigorous washing (20-30 CV) with lysis buffer, the His6-Z tagged protein was eluted in lysis buffer containing imidazole (50 mM HEPES 7.4 500 mM NaCl, 300 mM imidazole, 0.5 mM TCEP, 5% glycerol).
The eluate was diluted with buffer containing no NaCl, (20 mM HEPES 7.4 0.5 mM TCEP, 5% glycerol) in order to reduce the NaCl-concentration to 250 mM
The diluted protein was loaded onto an 5 mL SP-Sepharose column (Cytiva #17505701) connected to an ÄKTA Basic system.
Wash with buffer containing 250 mM NaCl (20 mM HEPES 7.4, 250 mM NaCl, 0.5 mM TCEP, 5% glycerol) until the absorbance of the flowthrough is below 5 mAU
His6 Z TEV-LRRK1 was eluted with a 250 mM to 2.5 M NaCl gradient.
The protein was treated with TEV protease (molar ratio TEV to substrate about 1:50) overnight to cleave the His6 Z tag.
Contaminating proteins, the cleaved tag, uncleaved protein and TEV protease were removed by another combined SP-Sepharose Ni NTA step.
LRRK1 was concentrated and subjected to gel filtration in storage buffer (20 mM HEPES 7.4, 150 mM NaCl, 0.5 mM TCEP, 0.5% glycerol) using an AKTA Pure system combined with an S200 gel filtration column.
The final yield as calculated from UV absorbance was 0.1 mg/L.