Mar 18, 2024
Version 2
In vivo tissue-specific chromatin profiling in Drosophila V.2
- 1Purdue University
External link: https://www.biorxiv.org/content/10.1101/2021.03.23.436625v1
Protocol Citation: Vikki M. Weake, Juan P P Jauregui-Lozano, Sarah E McGovern 2024. In vivo tissue-specific chromatin profiling in Drosophila. protocols.io https://dx.doi.org/10.17504/protocols.io.kxygxp1d4l8j/v2Version created by Vikki M. Weake
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 14, 2023
Last Modified: March 18, 2024
Protocol Integer ID: 87799
Abstract
Chromatin regulation plays an essential role in many nuclear processes, and genome-wide chromatin profiling approaches contribute to understanding how chromatin regulates cell homeostasis. Chromatin dysregulation lies in the heart of many human diseases, which most of them have a tissue-specific nature. Because of the physiological similarity of Drosophila and humans, tissue-specific studies can be performed using fruit flies. Here, we present an improved nuclear tagging approach that allows for efficient purification of cell-type specific nuclei from Drosophila increasing yield and stringency. Using this protocol, we purified photoreceptor neuron nuclei, and demonstrate the feasibility and high quality of chromatin accessibility profiling as well as profiling of histones and histone modifications, using Omni-ATAC and ChIP-seq, respectively. Last, we describe a modification to the nuclei purification protocol that allows for application of recently developed CUT&Tag and demonstrate that CUT&Tag outperforms traditional ChIP-seq, although protocol might require further optimization.
Guidelines
References:
Corces, M., Trevino, A., Hamilton, E.et al.An improved ATAC-seq protocol reduces background and enables interrogation of frozen tissues.Nat Methods14,959–962 (2017). https://doi.org/10.1038/nmeth.4396
Materials
1X PBS (Phosphate-buffered saline ) Dynabeads™ Protein G for ImmunoprecipitationThermo FisherCatalog #10003D anti GFP antibodyRocheCatalog #11814460001
Anti-Histone H3 antibodyAbcamCatalog #ab1791 Anti-Histone H3 (tri methyl K4) antibody - ChIP gradeAbcamCatalog #Ab8580 Anti-Histone H3 (tri methyl K36) antibody - ChIP gradeAbcamCatalog #Ab9050 llumina Tagment DNA TDE1 Enzyme and Buffer KitsilluminaCatalog #20034197 IDT® for Illumina® DNA/RNA UD Indexes Set A Tagmentation (96 Indexes 96 Samples)illuminaCatalog #20027213 CUTANA™ pAG-Tn5 for CUT&TagEpiCypherCatalog #15-1017
Protocol materials
Ovation® SoLo RNA-Seq Library Preparation KitTecanCatalog #0502-32
Step 30
CUTANA™ High Fidelity 2X PCR Master MixEpiCypherCatalog #15-1018
Step 90
IDT® for Illumina® DNA/RNA UD Indexes Set A Tagmentation (96 Indexes 96 Samples)Illumina, Inc.Catalog #20027213
Materials
Dynabeads™ Protein G for ImmunoprecipitationThermo FisherCatalog #10003D
Materials, Step 69
Proteinase K Solution (20 mg/mL)Thermo Fisher ScientificCatalog #AM2548
Step 57.3
Agencourt AmPure XP beadsCatalog #A63880
In 2 steps
IDT for Illumina Nextera DNA Unique Dual IndexesIllumina, Inc.Catalog #20027213
Step 39
ChIP DNA Clean & ConcentratorZymo ResearchCatalog #D5205
Step 57.4
Qubit 1X dsDNA HS Assay KitThermo Fisher ScientificCatalog #Q33230
In 2 steps
Anti-Histone H3 antibodyAbcamCatalog #ab1791
Materials
anti GFP antibodyRocheCatalog #11814460001
Materials, Step 5
DNA Clean & Concentrator™-5Zymo ResearchCatalog #D4003
Step 38
100ml TE Buffer [1X], pH 8.0, Low EDTA (Tris-EDTA; 10mM Tris base, 0.1mM EDTA)G-BiosciencesCatalog #786-150
Step 93
PureProteome™ Magnetic StandMerck MilliporeSigma (Sigma-Aldrich)Catalog #LSKMAGS08
Step 4
llumina Tagment DNA TDE1 Enzyme and Buffer KitsIllumina, Inc.Catalog #20034197
Materials
RNase A (10 mg/mL)Thermo Fisher ScientificCatalog #EN0531
Step 57.2
Dynabeads™ Pan Mouse IgGInvitrogen - Thermo FisherCatalog #11041
Step 69
Pierce™ 16% Formaldehyde (w/v) Methanol-freeThermo Fisher ScientificCatalog #28906
Step 47
Dynabeads™ Pan Mouse IgGInvitrogen - Thermo FisherCatalog #11041
Step 3
cOmplete™ EDTA-free Protease Inhibitor CocktailRocheCatalog #4693132001
Step 9
Anti-Histone H3 (tri methyl K36) antibody - ChIP gradeAbcamCatalog #Ab9050
Materials
Quick-DNA Microprep Plus KitZymo ResearchCatalog #D4074
Step 33
NEBNext High-Fidelity 2X PCR Master Mix - 50 rxnsNew England BiolabsCatalog #M0541S
Step 39
CUTANA™ pAG-Tn5 for CUT&TagEpiCypherCatalog #15-1017
Materials, Step 80
Qubit RNA HS Assay KitThermo Fisher ScientificCatalog #Q32852
Step 29
Capillary electrophoresis instrument (e.g. Agilent Tapestation 4200)
Step 44
Anti-Histone H3 (tri methyl K4) antibody - ChIP gradeAbcamCatalog #Ab8580
Materials
TRI ReagentZymo ResearchCatalog #R2050-1-50
Step 29
Ovation® Ultralow V2 DNA-Seq Library Preparation KitTecanCatalog # 0344NB-A01
Step 68
Recipes
Recipes
Homogenization/wash buffer
40 mM HEPES, pH 7.5
120 mM KCl
0.4% NP40 (IGEPAL)
Dilution buffer [cold]
40 mM HEPES, pH 7.5
120 mM KCl
Bead washing buffer [cold]
1X Phosphate Buffer Saline (PBS) buffer, pH 7.4
2.5 mM MgCl2
0.02% Tween-20
## Omni-ATAC
Omni-ATAC tagmentation mix
25 µL 2X buffer
2.5 µL Tn5
16.5 µL PBS
0.5 µL 1% digitonin
0.5 µL 10% Tween-20
5 µL H2O
## ChIP-seq
A1 buffer
15 mM HEPES
15 mM NaCl
60 mM KCl
4 mM MgCl2
0.5% Triton X-100
Nuclei Lysis Buffer
50 mM Tris
10 mM EDTA
1% SDS
X-ChIP dilution buffer
16.7 mM Tris-HCl, pH 8.0
167 mM NaCl
1% Triton X-100
1.2 mM EDTA
X-ChIP elution buffer
100 mM NaHCO3
1% SDS
Low Salt Buffer
20 mM Tris-HCl, pH 8.0
150 mM NaCl
0.1% SDS
1% Triton X-100
2 mM EDTA
High Salt Buffer
20 mM Tris-HCl, pH 8.0
500 mM NaCl
0.1% SDS
1% Triton X-100
2 mM EDTA
LiCl wash buffer
10 mM Tris-HCl, pH 8.0
250 mM LiCl
0.1% Na-Deoxycholate
0.1% NP-40 or IGEPAL
1 mM EDTA
TE buffer
10 mM Tris-HCl, pH 8.0
1 mM EDTA
## CUT&Tag
Wash 150 buffer
20 mM HEPES, pH 7.5
150 mM NaCl
0.5 mM Spermidine
1X Roche cOmpleteTM, Mini, EDTA-free protease inhibitor (1 tablet/10mL Wash150 buffer)
Store at 4C for up to 1 week
Digitonin150 buffer
Wash buffer + 0.01% Digitonin
Prepare fresh each day and store at 4C
Antibody150 buffer
Digitonin buffer + 2 mM EDTA
Prepare fresh each day and store at 4C
Wash300 buffer
20 mM HEPES, pH 7.5
300 mM NaCl
0.5 mM Spermidine
1X Roche cOmpleteTM, Mini, EDTA-free Protease Inhibitor (1 tablet/10 mL Wash300 buffer)
Store at 4C for up to 1 week
Digitonin300 buffer
Wash 300 Buffer + 0.01% Digitonin
Prepare fresh each day and store at 4C
Tagmentation buffer
Wash buffer + 10 mM MgCl2
Store at 4C for up to 1 week
TAPS buffer
10 mM TAPS, pH 8.5
0.2 mM EDTA
Store at RT for up to 6 months
SDS Release Buffer
10 mM TAPS, pH 8.5
0.1% SDS
Store at RT for up to 6 months
SDS Quench Buffer
0.67% Triton-X 100 in Molecular grade H2O
Store at RT for up 6 months
Primers:
Nextera P1: AATGATACGGCGACCACCGAGA
Nextera P2: CAAGCAGAAGACGGCATACGA
Universal i5: AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG
Indexed i7-1: CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGT
Indexed i7-2: CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGGAGATGT
Indexed i7-3: CAAGCAGAAGACGGCATACGAGATTTCTGCCTGTCTCGTGGGCTCGGAGATGT
Indexed i7-4: CAAGCAGAAGACGGCATACGAGATGCTCAGGAGTCTCGTGGGCTCGGAGATGT
Drosophila stocks
Drosophila stocks
Generate flies expressing GFPKASH protein in the cell type of interest by crossing UAS-GFPKASH or QUAS-GFPKASH flies with the appropriate Gal4 or QF driver. Confirm expression patterns by microscopy. We typically generate recombinant flies expressing the driver and GFPKASH where both transgenes are homozygous (two copies) because this is convenient for expanding the flies, and we have found that the IP efficiency improves with higher expression. However, we can also obtain nuclei from flies expressing only a single copy of the driver and GFPKASH, even when combining these with other UAS-transgenes such as RNAi or overexpression.
Bead-antibody coupling
Bead-antibody coupling
30m
Note: The following amounts of Dynabeads and antibody are for 400 fly heads. These amounts can be scaled depending on input.
Incubate 20 μL/reaction of Dynabeads™ Pan Mouse IgGInvitrogen - Thermo FisherCatalog #11041 in 1 mL bead washing buffer for 10 min at RT with constant rotation.
Transfer tube to magnet stand and remove supernatant.
- For this step, and all steps involving the magnet - briefly spin tubes in a microcentrifuge to remove any liquid from the cap before placing tube on the magnet stand.
- We use a 1 mL pipettor to remove the supernatant at all bead/magnet steps.
- Wait at least 1 min to make sure all beads are cleared from solution before pipetting liquid out.
PureProteome™ Magnetic StandSigma AldrichCatalog #LSKMAGS08
Resuspend beads in 1 mL bead washing buffer and add 2 μg anti GFP antibodySigma AldrichCatalog #11814460001 .
Incubate at room temperature for 30 min with constant rotation.
Transfer tube to magnet and remove supernatant.
Resuspend beads in 100 μL 0.1% homogenization/wash buffer (mix 3 parts dilution buffer and 1 part homogenization/wash buffer for a final NP-40 concentration of 0.1%).
- The resuspension volume can be altered depending on how many samples are being processed. Aim for 50 μL/sample. E.g., if you are processing 4 samples for NIE, resuspend in 200 μL 0.1% homogenization/wash buffer.
Homogenization
Homogenization
10m
Homogenization notes:
- Always keep homogenizer on ice
- Use 3 mL of homogenization buffer for any number up to 400 fly heads - from flies snap frozen in liquid nitrogen and stored at -80°C
- Fresh samples can also be used e.g., partially dissecting tissues from larvae, whole embryos - but nuclei can be isolated successfully from frozen flies and this is our standard approach for neuronal cell types in the adult head
Add 3 mL of homogenization/wash buffer and 100 μL 25X cOmplete™ EDTA-free Protease Inhibitor CocktailRocheCatalog #4693132001 to a Dounce homogenizer. Keep on ice.
Transfer frozen flies into 15 mL conical tubes. Pre-chill the sieves, flies, and paint brush using liquid nitrogen.
Vortex conical tubes containing flies for 3 seconds, then place tubes back into liquid nitrogen. Repeat 4 more times to separate fly heads from bodies.
Keep sieves cold by pouring a small amount of liquid nitrogen over them between vortexing tubes.
Pour flies into pre-cooled top sieve and tap top sieve so fly heads fall into middle sieve. Remove top sieve and tap middle sieve to get rid of any smaller debris.
Transfer separated fly heads from middle sieve into 7 mL glass Dounce homogenizer using a paint brush chilled using liquid nitrogen.
Grind samples in Dounce homogenizer with 5 "loose" pestle strokes.
- Homogenize slowly, lifting pestle all the way out to the wide bulb each time
- Twisting the pestle in the bottom may improve homogenization
Incubate samples on ice for 1 min.
Grind samples with 5 "tight" pestle strokes.
Filter homogenate using 40 μm cell strainer or Miracloth and glass funnel into two microcentrifuge tubes.
If using Miracloth:
- Cut ends off 1000 μL pipette tips (one per sample) using scissors sterilized with Ethanol - tips are cut so fly heads can be pipetted easily
- Put small glass funnel into microcentrifuge tube
- Cut a square of Miracloth (large enough to fit into funnel and extend slightly over the sides) and place into funnel
- Pipette half of homogenate through the Miracloth and funnel into one microcentrifuge tube using cut tip (head debris will stay in Miracloth, while nuclei will pass through)
- Transfer funnel and Miracloth into second microcentrifuge tube, and pipette rest of homogenate into tube
Centrifuge homogenate at 800 x g for 5 min at 4°C.
Carefully decant supernatant containing cell debris and resuspend the two pellets from each sample in 0.5 mL 0.1% homogenization/wash buffer total, combining the two pellets into one microcentrifuge tube.
Pipette combined pellets up and down ~10 times, or until pellet is completely dispersed.
Add 20 μL 25X protease inhibitor to each tube.
Nuclei - bead incubation
Nuclei - bead incubation
1h 30m
Add 50 μL antibody-bound beads into each tube that has homogenate
Or, split antibody-bound beads evenly between all tubes depending on the resuspension volume.
Incubate nuclei and antibody-bound beads for 60 min at 4°C with constant rotation.
Remove supernatant using a magnet.
Gently resuspend bead-bound nuclei with 1 mL 0.1% homogenization/wash buffer.
Incubate for 5 min at 4 °C with constant rotation.
Repeat wash steps 23-24 two more times.
After final wash, samples contain bead-bound GFP-expressing nuclei and can be used subsequently for RNA-seq, Omni-ATAC, ChIP-seq, CUT&Tag, or CUT&RUN.
RNA-seq
RNA-seq
Resuspend beads in TRI ReagentSigma AldrichCatalog #R2050-1-50 and purify according to the manufacturers' instructions. We typically use Direct-Zol microprep kit, eluting in 15 μL, and quantify 2 μL of eluted RNA using Qubit RNA HS Assay KitSigma AldrichCatalog #Q32852
Libraries for RNA-seq can be generated usingOvation® SoLo RNA-Seq Library Preparation KitSigma AldrichCatalog #0502-32 . This kit allows RNA inputs : [10 pg- 10 ng]. This library kit has ribodepletion step incorporated into the protocol using Drosophila anyDeplete, and libraries are therefore total nuclear RNA depleted for rRNA (not mRNA). We also recommend to use a library kit that has an in-solution DNAse step as part of the initial protocol because in our hands, the gDNA removal in the Direct-Zol kit is not 100% efficient.
Omni-ATAC
Omni-ATAC
Begin the Omni-ATAC protocol at this step using the bead-bound nuclei obtained in Step 22.
After third wash, resuspend nuclei in 500 μL homogenization/wash buffer
Quantify gDNA from 10% of nuclei suspension or count nuclei using hemocytometer. We typically determine gDNA using Quick-DNA Microprep Plus KitSigma AldrichCatalog #D4074 kit, and use this to determine the amount of nuclei suspension to use for Omni-ATAC. For comparisons between samples under different experimental conditions, the same amount of nuclei (DNA) should be used.
Based on quantification, aliquot nuclei according to desired input amount. We have successfully used 50 ng or 100 ng DNA equivalent for Omni-ATAC, but it is likely that much lower input DNA levels will also work well using this protocol.
Using magnet, remove supernatant and resuspend nuclei in 50 μL of Omni-ATAC tagmentation mix
Perform Omni-ATAC as described in this publication: (Corces, 2017)
Incubate reaction for 30 minutes at 37C in a thermal shaker using 1000 RPM shaking speed.
Purify DNA usingDNA Clean & Concentrator™-5Sigma AldrichCatalog #D4003 and elute in 15 μL elution buffer (from the Zymo kit).
PCR amplify Omni-ATAC libraries:
25 μL NEBNext High-Fidelity 2X PCR Master Mix - 50 rxnsSigma AldrichCatalog #M0541S
15 μL purified DNA
10 μL IDT for Illumina Nextera DNA Unique Dual IndexesSigma AldrichCatalog #20027213
Amplify for 5 cycles
72C 5min
98C 30 sec
Then, 5 cycles of:
98C 10 sec
63C 30 sec
72C 1 min
Place reaction on ice
Determine additional PCR cycles using qPCR:
qPCR mix 1 rxn
25 uM Nextera P1 0.25 μL
25 uM Nextera P2 0.25 μL
100X Syber Green I 0.09 μL
NEBnext 2X 5 μL
diH2O 4.4 μL
Purify DNA using Agencourt AmPure XP beadsSigma AldrichCatalog #A63880 using double size selection (0.5-1X ratio)
Assess tagmentation patterns usingCapillary electrophoresis instrument (e.g. Agilent Tapestation 4200)Sigma Aldrich Libraries can be directly sequenced after this step.
ChIP-seq
ChIP-seq
Begin the ChIP-seq protocol at this step using the bead-bound nuclei obtained in Step 22.
After third wash, use a magnet to remove supernatant.
Resuspend bead-bound nuclei in 1 mL A1 buffer
Add Pierce™ 16% Formaldehyde (w/v) Methanol-freeSigma AldrichCatalog #28906 to a final concentration of 1%. We use these small ampules for ChIP experiments and discard ~2 weeks after opening, storing at 4C.
Rotate for 2 min at RT
Add Glycine to a final concentration of 125 mM for quenching and rotate for 5 min at RT
Resuspend in 140 uL of Nuclei Lysis Buffer
Transfer to sonication tube (MicroTube (6x16mm), AFA fiber with Snap-Cap 520045)
Sonicate chromatin with E220 Covaris
Conditions: 10 min with 2% duty cycle 105W, 200 CPB
Transfer the sonicated lysate to an eppendorf tube using a magnet to discard beads
Add X-ChIP dilution buffer to make up to 1mL final volume.
Centrifuge supernatant 10min at 20,000 x g at 4C.
Transfer supernatant [soluble chromatin] to new centrifuge tube on ice
Take a 5% fraction (for input prep go to step 51.1) and flash-freeze remaining chromatin in liquid nitrogen or continue to step 52
Fill up to 200 µL with X-ChIP elution buffer
Add 2 µL of RNase A (10 mg/mL)Sigma AldrichCatalog #EN0531 and incubate at 37C for 1 hour
Add 2 µL of Proteinase K Solution (20 mg/mL)Sigma AldrichCatalog #AM2548 and incubate at 55C overnight. It is important to do this incubation step at 55C (not higher temp).
Purify DNA using ChIP DNA Clean & ConcentratorSigma AldrichCatalog #D5205 and quantify 2 µL using Qubit 1X dsDNA HS Assay KitSigma AldrichCatalog #Q33230
Divide soluble chromatin based on number of antibodies to be used and fill up each tube to 1 mL with X-ChIP dilution buffer. We recommend using ~100ng equivalent of DNA (chromatin) per antibody for histone mark antibodies (eg H3K4me3), but lower amounts may be sufficient for bulk histone (eg histone H3). Higher amounts may be required depending on the epitope of interest.
Add 1 μg antibody of interest and incubate at 4C with constant rotation overnight
Day 2
Wash 25 µL of beads with 1 mL of X-ChIP dilution buffer to get rid of the slurry
Immuno-precipitate the antibody-chromatin complex with 25 µL G agarose beads (Santa Cruz) for 2 hours at 4C
Wash the beads with the following buffers for 5 min at RT with constant rotation: Low Salt Buffer, High Salt Buffer, LiCl Wash Buffer. Use 1 mL of each wash buffer, and remove supernatant using magnet as in other steps.
After LiCl wash, resuspend beads in 1 mL of TE buffer and transfer to new centrifuge tube (1.5 mL tube).
Incubate for 5 minutes at 4C
Using a magnet, remove supernatant and resuspend beads in 200 µL of X-ChIP Elution buffer
Extract the DNA from each ChIP sample obtained at step 60 using the same method as described for the input fraction (5%): steps 51.2 to 51.4 (RNAse, proteinaseK, purification).
Use purified DNA for library construction. We use Ovation® Ultralow V2 DNA-Seq Library Preparation KitSigma AldrichCatalog # 0344NB-A01 and have found that 100 pg and 2 ng of DNA yield comparable libraries.
CUT&Tag
CUT&Tag
If nuclei will be used for CUT&Tag, perform the nuclear immuno-enrichment (starting at step 3) using Dynabeads™ Pan Mouse IgGSigma AldrichCatalog #11041 instead of Dynabeads™ Protein G for ImmunoprecipitationSigma AldrichCatalog #10003D since Protein G coupled dynabeads might interfere with downstream steps in CUT&Tag.
After third wash, remove supernatant using a magnet and wash nuclei with 1 mL of cold Antibody 150 buffer three times
Using magnet, remove supernatant, resuspend bead-bound nuclei in 50 μL Antibody 150 buffer and transfer to PCR tube
Add 0.5 μg Primary antibody and gently pipette up and down to mix
Incubate for 1 hour at RT at 4C with constant rotation
Using magnet, remove supernatant, resuspend bead-bound nuclei in 50 µL cold Digitonin 150 buffer
Add 0.5 μg Secondary antibody
Incubate for 30 min at RT with constant rotation
Using a magnet, remove supernatant and add 200 μL cold Digitonin 150 Buffer
Repeat step 70 two times
Remove from magnet, add 50 μL cold Digitonin 300 buffer
Add 2.5 μL CUTANA™ pAG-Tn5 for CUT&TagSigma AldrichCatalog #15-1017 and pipette up and down to mix
Incubate samples for 1 hour at RT with constant rotation
Using a magnet, remove supernatant and add 200 μL cold Digitonin 300 buffer. Thoroughly resuspend by pipetting, return to magnet then pipet to remove supe
Repeat previous step for total of two washes
Remove from magnet, add 50 μL cold Tagmentation Buffer
Incubate for 1 hour at 37C in thermocycler
Using a magnet, remove supernatant and resuspend beads in 50 μL RT TAPS Buffer
Using a magnet, remove supernatant, add 5 uL RT SDS Release Buffer and vortex on max speed for 7 seconds. Quick spin to collect
Add 15 μL RT SDS Quench Buffer and vortex on max speed.
Add 2 μL each of Universal i5 and barcoded i7 primers (10 μM stocks)
Add 25 μL CUTANA™ High Fidelity 2X PCR Master MixSigma AldrichCatalog #15-1018 and mix
Amplify in a thermocycler using the following conditons:
a. 58C - 5 min
b. 72C - 5 min
c. 98C - 45 sec
d. 98C - 15 sec
e. 60C - 10 sec
f. Repeat d-e for a total of 14-21.
g. 72C - 1min
h. hold at 4C
We have found that 20 cycles yield optimal libraries when a H3K4me3 CUT&Tag reaction is started using nuclei corresponding to 100 ng gDNA
Clean CUT&Tab libraries using 1.3X amAgencourt AmPure XP beadsSigma AldrichCatalog #A63880
Elute DNA in 15 μL100ml TE Buffer [1X], pH 8.0, Low EDTA (Tris-EDTA; 10mM Tris base, 0.1mM EDTA)Sigma AldrichCatalog #786-150 and quantify using Qubit 1X dsDNA HS Assay KitSigma AldrichCatalog #Q33230
CUT&Tag libraries are ready for sequencing