Dec 12, 2024

Public workspaceIn vitro Transcription (IVT) of Guide RNAs for Cytoplasmic Microinjection

DOI
dx.doi.org/10.17504/protocols.io.36wgq3kdylk5/v1
  • 1University of Adelaide;
  • 2SAHMRI
Jayshen Arudkumar
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.36wgq3kdylk5/v1
Protocol Citation: Jayshen Arudkumar, Yu C.J. Chey, Sandra Piltz, Paul Quinton Thomas, Fatwa Adikusuma 2024. In vitro Transcription (IVT) of Guide RNAs for Cytoplasmic Microinjection. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgq3kdylk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 15, 2024
Last Modified: December 12, 2024
Protocol Integer ID: 93518
Keywords: CRISPR, Microinjection, mouse, embryo, DMD, Phenotyping, Knockout
Disclaimer
These protocols are for research purposes only.
Abstract
Paper abstract: CRISPR-Cas9 gene-editing technology has revolutionised the creation of precise and permanent modifications to DNA, enabling the generation of diverse animal models for investigating potential treatments. Here, we provide a protocol for the use of CRISPR-Cas9 to create murine models of Duchenne Muscular Dystrophy (DMD) along with a step-by-step guide for their phenotypic and molecular characterisation. The experimental procedures include CRISPR microinjection of embryos, molecular testing at the DNA, RNA, and protein levels, forelimb grip strength testing, immunostaining and serum creatine kinase (CK) testing. We further provide suggestions for analysis and interpretation of the generated data, as well as the limitations of our approach. These protocols are designed for researchers who intend on generating and using mouse models to study DMD as well as those seeking a detailed framework of phenotyping to contribute to the broader landscape of genetic disorder investigations.  

Protocol summary: In this section we present a protocol for CRISPR injection into mouse zygotes to create the ΔEx51 DMD model. Here, we successfully generated guide RNAs (sgRNAs) targeting intronic regions flanking the mouse Dmd target region of exon 51 to create a large intervening deletion.
Image Attribution
BioRender was used to generate figures for this manuscript.
Materials
  1. NEB HiScribe‱ T7 Quick High Yield RNA Synthesis Kit 
  2. Qiagen RNEasy Mini Kit RNA Cleanup (Qiagen) 
  3. Purified pX459V2 construct (backbone from Addgene Plasmid #62988) 
  4. T7 primer + FWD and REV sequences with overhangs 
  5. NEB Formaldehyde Load Dye 
  6. QIAquick Gel Extraction Kit (Qiagen) 
  7. QIAQuick PCR Purification Kit (Qiagen) 
Safety warnings
Wear proper PPE (gloves, safety goggles, enclosed shoes and lab coat) and prepare solvents in a chemical fume hood. Dispose used solvents or waste material in an appropriate biohazard waste containers.
Ethics statement
Animal work described in this manuscript has been approved and conducted under the oversight of the Animal Ethics Committee of South Australian Health and Medical Research Institute (SAHMRI) and The University of Adelaide. 
Choosing a sgRNA pairing to create the deletion
Choosing a sgRNA pairing to create the deletion
The in-silico design of guide RNAs was conducted through various online guide design tools and narrowed down based on their predicted on-target and off-target activities. Tools that we would recommend for this task include Benchling and CRISPOR (1). The phospho-annealed guide oligos were then cloned into BbsI-linearised pX459V2 plasmid using the Golden Gate Assembly method. Note that ‘CACC’ and ‘AAAC’ overhangs allow the oligos to bind the complementary overhanging DNA at the cut sites in the plasmid created by the BbsI digestion (2). This process yielded two recombinant constructs, each housing the left intron and right intron, respectively. 

gRNA 1 (Right Intron)   Position is 156bp away from 3' exon 51  Forward: 5' - GGTCAACCTAACTACAATCA - 3'  Rev comp: 5' - TGATTGTAGTTAGGTTGACC - 3'    Forward oligo: 5' - CACCGGTCAACCTAACTACAATCA - 3' 
Reverse oligo: 5' - AAACTGATTGTAGTTAGGTTGACC - 3' 
 
gRNA 2 (Left Intron)  Position is 290bp away from 5' exon 51  Forward: 5' - GTTTATAAGCACAAGTATTG - 3'  Rev comp: 5' - CAATACTTGTGCTTATAAAC - 3'    Forward oligo: 5' - CACCGTTTATAAGCACAAGTATTG - 3' 
Reverse oligo: 5' - AAACCAATACTTGTGCTTATAAAC - 3' 
PCR amplification of guide template
PCR amplification of guide template

Note
The oligos used for Forward and Reverse PCRs are seen in Supplementary Table S1. Here is an expanded form:    gRNA 1 (Right Intron)  
T7 Guide Primer for Forward PCR:   5' - TTAATACGACTCACTATAGGGTCAACCTAACTACAATCA - 3' 
  
gRNA 2 (Left Intron) 
T7 Guide Primer for Forward PCR:  5' - TTAATACGACTCACTATAGGTTTATAAGCACAAGTATTG - 3' 
  tracrRNA Reverse Primer: 5’ - AAAAGCACCGACTCGGTGCC - 3’ 

Prepare PCR mix using the T7 Guide Primer for Forward PCR and tracrRNA reverse primer. The T7 promoter is introduced into the template. Add 1 μL of each of the miniprepped recombinant guide plasmids (at ∼1-3 ng/μL) to 1 tube each and 1 μL Ultrapure water to the final tube.

AB
Reagent Amount 
Ultrapure water 12.3 μL  
NEB Phusion HF Reaction Buffer (5x)  4 μL  
T7 guide primer (10 μM)  1 μL  
tracrRNA reverse primer (10 μM)  1 μL  
Roche PCR Grade Nucleotide Mix (10 mM)  0.5 μL  
NEB Phusion HF DNA Polymerase (2 U/μL)  0.2 μL  
Total  19 μL  
 
Place the tubes in a thermocycler with the following parameters:
ABC
Steps T7 PHUSION 
1 98°C 3 min 
2 98°C 15 s 
3 60°C 20 s 
4 72°C 15 s 
5 Go to step 2 32 times 
6 72°C 5 min 
7 4°C ∞ 


PCR
PCR amplification of guide template
PCR amplification of guide template
Make a 1% agarose gel and run 5 μL of the PCR products 40 min @100 V.

Note
Testing to see if the plasmid has the correct insert. Band should be present at approximately 100 bp

Combine the remainder of all PCR reactions with the correct band and perform Qiagen PCR Purification on the mixture. Use NanoDrop to measure concentration of DNA. A260/A280 values should fall in the range of 1.8-2.0.

Note
This is to confirm if the DNA is still present and determine the amount needed for the IVT reaction.

In vitro transcription (IVT)
In vitro transcription (IVT)
Transfer 2 μL to a PCR tube for testing later.


Note
We are using the purified PCR product as the template for IVT with the NEB HiScribe™ T7 Quick High Yield RNA Synthesis Kit.

Mix the following reagents in a PCR tube:
AB
Reagent Amount 
Ultrapure H2O Up to 60 μL 
IVT gRNA Product 40 μL 
NEB DNase I (RNAse-free) (2 U/μL) 4 μL 
Total 104 μL 
Note
Degrades DNA 

Incubate 15 min @ 37 °C.
Incubation
Transfer 2 μL to a separate PCR tube for testing later.
Perform Qiagen RNEasy Mini Kit RNA Cleanup, eluting in 30 μL water.
Transfer 2 μL to a separate PCR tube for testing later.
Add 2 μL NEB Formaldehyde Load Dye to each of the 2 μL RNA aliquots set aside.
Place the mixture in a thermocycler with the following parameters:
Steps Reagent Amount 
1 85°C 3 min 
2 4°C ∞ 

Make an RNase-free 1% agarose gel and run RNA aliquots 30 min @ 100 V.


Note
Testing the gRNA has been produced correctly. Bands should be present at >100 bp (RNA will run higher on the gel than DNA when run against a DNA ladder).

Cytoplasmic Injection
Cytoplasmic Injection
On the day of zygote injection, prepare the injection mix as follows:

AB
Reagent Amount 
Ultrapure H2O 10.125 μL 
Injection buffer (10x) 1.5 μL 
gRNA 1 To give 50 ng/μL 
gRNA 2 To give 50 ng/μL 
SpCas9 mRNA To give 100 ng/μL 
Total 15 μL 
Protocol references
1. Concordet JP, Haeussler M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic acids research. 2018;46(W1): W242–W245. doi: 10.1093/nar/gky354

2. Adikusuma, F., Pfitzner, C., & Thomas, P. Q. (2017). Versatile single-step-assembly CRISPR/Cas9 vectors for dual gRNA expression. PloS one, 12(12), e0187236. https://doi.org/10.1371/journal.pone.0187236