Nov 07, 2024
In-house NGS-Based HIV Genotyping protocol v.01
- ayitewala alisen1,
- Hellen Oundo Rossette1,
- Julius Sseruyange1,
- Wilson Tenywa1,
- Moses Murungi1,
- Godwin Tusabe1,
- Stephen Kanyerezi1,
- Caroline Makoha1,
- Aloysius Ssemaganda1,
- Isaac Ssewanyana1,
- Charles Kiyaga1,
- Susan Nabadda1
- 1Central Public Health Laboratories
Protocol Citation: ayitewala alisen, Hellen Oundo Rossette, Julius Sseruyange, Wilson Tenywa, Moses Murungi, Godwin Tusabe, Stephen Kanyerezi, Caroline Makoha, Aloysius Ssemaganda, Isaac Ssewanyana, Charles Kiyaga, Susan Nabadda 2024. In-house NGS-Based HIV Genotyping protocol v.01. protocols.io https://dx.doi.org/10.17504/protocols.io.81wgbzo5ngpk/v1
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: September 02, 2024
Last Modified: November 07, 2024
Protocol Integer ID: 106833
Keywords: Next Generation Sequencing, HIV Genotyping, HIV drug resistance testing, CPHL, In-House Assay
Disclaimer
This in-house brewed protocol, validated for HIV drug resistance testing, supports routine antiretroviral therapy optimization and surveillance at Uganda's Central Public Health Laboratories. For adoption, please consult relevant in-country guidelines and recommendations.
Abstract
This standard operating procedure (SOP) outlines the laboratory workflow for HIV drug resistance (HIVDR) genotyping assays performed on plasma samples. The assay utilizes next-generation sequencing (NGS) technology to identify mutations associated with antiretroviral treatment (ART) resistance and detect HIV-1 subtypes. Key Steps include;
Sample Preparation and Processing:
- RNA Extraction: Viral RNA is extracted from plasma samples using a silica membrane spin column-based RNA extraction method.
- Amplicon Generation: Target regions of the HIV genome, including the protease, reverse transcriptase, and integrase genes, are amplified using RT-PCR.
Library Preparation and Sequencing:
- Library Preparation: Amplified DNA fragments are prepared for sequencing using Illumina or Oxford Nanopore Technologies (ONT) library preparation kits.
- Sequencing: Prepared libraries are sequenced on Illumina MiSeq or ONT MinION Mk1C platforms, generating millions of short DNA sequences (FastQ files).
Data Analysis and Interpretation:
- Bioinformatics Pipeline: Sequencing reads are analyzed using an in-house developed bioinformatics pipeline integrating Hydra, Sierra local, and the Stanford University HIV database.
- Web-based Analysis: Alternatively, sequencing reads can be directly analyzed using the Stanford University HIV database.
- Results Interpretation: Resistance mutations with ≥20% relative abundance are interpreted for predicted phenotypic resistance, and HIV-1 subtype is determined.
- Reporting: A comprehensive report summarizing resistance mutations, HIV-1 subtype, and potential treatment implications is generated.
This SOP ensures accurate and efficient HIVDR genotyping, supporting informed ART optimization.
Guidelines
Conducting an in-house HIV genotyping assay requires careful planning and adherence to specific guidelines to ensure accuracy and reliability. Here are some key guidelines:
- ValidationValidate the assay against a gold-standard method, such as Sanger sequencing, to ensure accuracy and precision. This involves testing clinical samples and comparing results.
- Quality ControlImplement robust quality control measures, including proficiency testing panels and regular calibration of equipment. This helps maintain consistency and reliability in the assay results.
- WorkflowFollow a standardized workflow that includes viral RNA extraction, targeted amplicon generation, amplicon sequencing, and data analysis. Each step should be meticulously documented and performed with precision.
- TrainingEnsure that personnel conducting the assay are well-trained and proficient in the techniques and protocols used. Regular training sessions and proficiency assessments can help maintain high standards.
- Data AnalysisUse appropriate bioinformatics tools and software for data analysis to accurately identify and interpret genetic variants. Ensure that the in-house analysis pipeline is validated and regularly updated.
- DocumentationMaintain detailed records of all procedures, results, and any deviations from the standard protocol. This documentation is crucial for troubleshooting and for future reference.
Materials
Nucleic Acid Extraction Kit: For isolating DNA or RNA from your samples.
Library Preparation Kit: For preparing sequencing libraries from the extracted nucleic acids.
PCR Reagents: Including primers, dNTPs, and polymerase for amplification steps.
Sequencing Platform: Such as Illumina, or ONT.
Indexing Adapters: For multiplexing samples, allowing multiple samples to be sequenced together.
Bioinformatics Software: For data analysis, such as mutation calling.
Personal Protective Equipment (PPE): Gloves, lab coats for handling biological samples.
Biosafety Cabinet: For working with potentially infectious samples.
Thermocycler: For PCR amplification steps.
Centrifuge and Microcentrifuge: For sample preparation and nucleic acid purification.
UV Spectrophotometer: For measuring nucleic acid concentration and purity.
Fluorometer: For more accurate nucleic acid quantitation.
Reagents for Library Cleanup: Such as magnetic beads for purifying sequencing libraries.
Sequencing Buffers: Required for the sequencing process on your chosen platform.
Data Storage Solutions: Adequate storage for large sequencing data files.
Protocol materials
PhiX Control v3Illumina, Inc.Catalog #FC-110-3001
Step 25
Illumina® DNA/RNA UD Indexes Set A, B, C, D Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654, 20091656, 20091658, 20
Step 16
Qubit™ dsDNA Quantification HS Assay KitsThermo ScientificCatalog #Q32854
In 2 steps
DNA Gel Loading Dye (6X)Thermo ScientificCatalog #R0611
Step 11
NaOH powderMerck MilliporeSigma (Sigma-Aldrich)Catalog #655104
Step 25
Flow Cell (R10.4.1)Oxford Nanopore TechnologiesCatalog #FLO-MIN114
Step 20.1
QIAamp Viral RNA Mini Kit QiagenCatalog #52906
Step 1
Superscript IV One-Step RT-PCR SystemThermo ScientificCatalog #12594100
Step 9
Platinum SuperFi II PCR Master Mix (2X)Thermo ScientificCatalog #12368050
Step 13
MiSeq Reagent KitsIllumina, Inc.Catalog #MS-102-3003, MS-102-2002, MS-103
Step 30
Rapid Barcoding Kit 96 V14Oxford Nanopore TechnologiesCatalog #SQK-RBK114.96
Step 16
UltraPure™ BSA (50 mg/mL)Thermo ScientificCatalog #AM2616
Step 20.1
SYBR™ Safe DNA Gel StainThermo ScientificCatalog #S33102
Step 11
UltraPure™ DNA Typing Grade™ 50X TAE BufferThermo ScientificCatalog #24710030
Step 11
Illumina DNA Prep, (M) Tagmentation (96 Samples, IPB)Illumina, Inc.Catalog #20060059
Step 16
High Sensitivity D1000 DNA Screen Tape assays KitsAgilent TechnologiesCatalog #5067-5585, 5067-5584
Step 22.1
Bioanalyzer High Sensitivity DNA Analysis kitAgilent TechnologiesCatalog #5067-4626
Step 22.1
AMPure XP Reagent, 450 mLBeckman CoulterCatalog #A63882
Step 16
Ultrapure AgaroseThermo ScientificCatalog #16500500
Step 11
GeneRuler 1 kb DNA LadderThermo ScientificCatalog #SM0312
Step 11
Safety warnings
When conducting an in-house HIV genotyping assay, it's crucial to be aware of potential pitfalls and challenges that could affect the accuracy and reliability of your results. Here are some important warnings:
- Contamination: Be vigilant about contamination at all stages of the assay. Use separate work areas and equipment for RNA extraction, PCR setup, and post-PCR analysis. Implement strict contamination control measures to prevent cross-contamination between samples.
- Sample Quality: Ensure that the RNA samples are of high quality and free of inhibitors. Poor quality samples can lead to inaccurate genotyping results. Use appropriate methods to assess the integrity and purity of the RNA before starting the assay.
- Technical Errors: Be aware of potential technical errors during PCR amplification, sequencing, and data analysis. Regularly calibrate and maintain equipment, and ensure that all reagents are fresh and stored properly. Follow the protocol meticulously to avoid deviations that could impact results.
- Data Interpretation: Misinterpretation of sequence data can lead to incorrect genotyping results. Use validated bioinformatics tools and ensure that the analysis pipeline is up-to-date. Train personnel thoroughly in data analysis and interpretation.
- Variant Coverage: Ensure that your sequencing coverage is sufficient to detect minor variants. Low coverage can result in missed mutations or false-negative results. Optimize your sequencing depth based on the target regions and the sensitivity required for the assay.
- Regulatory Compliance: Be aware of and comply with relevant regulatory guidelines and standards for clinical assays. This includes adhering to quality control measures, documentation requirements, and proficiency testing.
- Ethical Considerations: Ensure that patient data is handled with confidentiality and respect. Follow ethical guidelines for informed consent and data privacy.
Before start
This protocol is specifically designed for HIV-1 plasma samples with a viral load greater than 1000 copies/mL. To ensure optimal results, please obtain a recent viral load test result before initiating the
protocol. Additionally, take note of the following;
- Equipment Check: Ensure that all equipment is calibrated and functioning correctly. This includes pipettes, thermocyclers, and sequencers. Regular maintenance and calibration are essential to avoid any technical errors during the assay.
- Reagent Preparation: Prepare and aliquot all reagents in advance to avoid contamination and ensure consistency. Store them at appropriate temperatures and conditions as recommended by the manufacturers.
- Safety Protocols: Follow all biosafety guidelines when handling HIV-1 plasma samples. Wear appropriate personal protective equipment (PPE) such as gloves, lab coats, and safety goggles. Work in a biosafety cabinet if necessary.
- Sample Handling: Use sterile techniques when handling plasma samples to prevent contamination. Ensure that samples are properly labeled and stored at appropriate temperatures to preserve their integrity.
- Training and Documentation: Ensure that all personnel involved in the assay are adequately trained. Keep thorough documentation of all training activities, sample information, and experimental details.
- Environmental Conditions: Make sure the laboratory environment is suitable for sensitive molecular biology work. This includes controlling temperature, humidity, and minimizing potential sources of contamination.
- Contamination Control: Implement measures to minimize the risk of contamination, such as using separate areas for pre- and post-PCR processes, and regularly cleaning work surfaces and equipment.
Viral RNA isolation using QIAmp Qiagen RNA Mini Kit
Viral RNA isolation using QIAmp Qiagen RNA Mini Kit
1d
1d
Record Reagent Lot Number:
- QIAamp Viral RNA Mini Kit QiagenCatalog #52906
Preparation of Carrier RNA (1 μg/μL)
Add Buffer AVE to the tube containing Lyophilized Carrier RNA to obtain a solution of 1 μg/μl (i.e., add 310 μl Buffer AVE to 310 μg lyophilized carrier RNA, or 1550 μl Buffer AVE to 1550 μg lyophilized carrier RNA; check the tube label for content).
Preparation of Buffer AVL + carrier RNA Mix
Check Buffer AVL for precipitate, and if necessary incubate at 80 °C until the precipitate is dissolved
Calculate the volume of Buffer AVL–carrier RNA mix needed per batch of samples by selecting the number of samples to be simultaneously processed from Table below.
| A | B | C | D | E | F | |
| No. of Samples | Buffer AVL (ml) | Carrier RNA-AVE (uL) | No. of Samples | Buffer AVL (ml) | Carrier RNA-AVE (uL) | |
| 1 | 0.56 | 5.6 | 13 | 7.28 | 72.8 | |
| 2 | 1.12 | 11.2 | 14 | 7.84 | 78.4 | |
| 3 | 1.68 | 16.8 | 15 | 8.4 | 84 | |
| 4 | 2.24 | 22.4 | 16 | 8.96 | 89.6 | |
| 5 | 2.80 | 28 | 17 | 9.52 | 95.2 | |
| 6 | 3.36 | 33.6 | 18 | 10.08 | 100.8 | |
| 7 | 3.92 | 39.2 | 19 | 10.64 | 106.4 | |
| 8 | 4.48 | 44.8 | 20 | 11.20 | 112 | |
| 9 | 5.04 | 50.4 | 21 | 11.76 | 117.6 | |
| 10 | 5.60 | 56 | 22 | 12.32 | 123.2 | |
| 11 | 6.16 | 61.6 | 23 | 12.88 | 128.8 | |
| 12 | 6.72 | 67.2 | 24 | 13.44 | 134.4 |
Volumes of Buffer AVL and carrier RNA
Note
Buffer AVL–carrier RNA should be prepared fresh, and is stable at 2–8°C for up to 48 h. This solution develops a precipitate when stored at 2–8°C that must be dissolved by warming at 80°C before use.
- Do not warm Buffer AVL–carrier RNA solution more than 6 times.
- Do not incubate at 80°C for more than 5 minutes. Frequent warming and extended incubation will cause degradation of carrier RNA
For larger numbers of samples, volumes can be calculated using the following sample calculation:
Where;
n = number of samples to be processed simultaneously
y = calculated volume of Buffer AVL
z = volume of carrier RNA to add to Buffer AVL
Dissolve the carrier RNA thoroughly, divide it into conveniently sized aliquots, and store it at -30 °C to -15 °C . Do not freeze-thaw the aliquots of carrier RNA more than 3 times
Preparation of AW1
Before using for the first time, add the appropriate amount of ethanol (96–100%) as indicated on the bottle of Buffer AW1
Preparation of AW2
Before using for the first time, add the appropriate amount of ethanol (96–100%) as indicated on the bottle of buffer AW2
Preparation of low titer samples
Turn on a refrigerated centrifuge, secure the rotor, close the lid and set to 4˚C, allow the centrifuge and rotor to reduce in temperature to 4˚C. This will take approximately 30 minutes00:30:00 .
Note
If you are unsure how to transfer the rotor or use the centrifuge, ask for advice from the supervisor before attempting to use
30m
Transfer 1mL of the samples i.e., plasma, serum, urine, cerebrospinal fluid, bone marrow and other body fluids that have very low viral titers to a 1.5ml microcentrifuge tube under a safety cabinet. Ensure equal volumes and tubes so that they are balanced.
Transfer the tubes to the preset refrigerated centrifuge at 4℃.
Centrifuge at maximum speed of 45,000 xg for one (1) hour. Ensure the samples are well closed and balanced.
After centrifugation, carefully disperse off the top most part of the supernatant leaving a desired volume at the bottom. Ensure that the pellet is not dislodged.
Procedure
Pipette 560 µL prepared Buffer AVL containing carrier RNA into a 1.5 ml Microcentrifuge tube
Note
- If the sample volume is larger than 140 μl, increase the amount of Buffer AVL–carrier RNA proportionally (e.g., a 280 μl sample will require 1120 μl Buffer AVL–carrier RNA) and use a larger tube.
- If the sample volume is smaller than 140 μl, top up with the required volume of PBS buffer
Add 140 µL Plasma to the Buffer AVL–carrier RNA in the Microcentrifuge tube
Mix by pulse-vortexing for 15 s
Note
To ensure efficient lysis, it is essential that the sample is mixed thoroughly with Buffer AVL to yield a homogeneous solution. Frozen samples that have only been thawed once can also be used
Incubate at room temperature for 10 min
Note
Viral particle lysis is complete after lysis for 10 min at room temperature. Longer incubation times have no effect on the yield or quality of the purified RNA
Briefly centrifuge the tube to remove drops from the inside of the lid
Add 560 μl ethanol (96–100%) to the sample, and mix by pulse-vortexing for 15 s. After mixing, briefly centrifuge the tube to remove drops from inside the lid.
Note
- Use only ethanol, since other alcohols may result in reduced RNA yield and purity. Do not use denatured alcohol, which contains other substances, such as methanol or methylethylketone.
- If the sample volume is greater than 140 μl, increase the amount of ethanol proportionally (e.g., a 280 μl sample will require 1120 μl ethanol).
- To ensure efficient binding, it is essential that the sample is mixed thoroughly with the ethanol to yield a homogeneous solution
Carefully apply 630 μl of the solution from step 5 to the QIAamp Mini column (in a 2 ml collection tube) without wetting the rim.
Close the cap, and centrifuge at 6000 xg (8000 rpm) for 1 min.
Place the QIAamp Mini column into a clean 2 ml collection tube, and discard the tube containing the filtrate.
Note
- Close each spin column to avoid cross-contamination during centrifugation.
- Centrifugation is performed at 6000 xg (8000 rpm) to limit Microcentrifuge noise. Centrifugation at full speed will not affect the yield or purity of the viral RNA.
- If the solution has not completely passed through the membrane, centrifuge again at a higher speed until all of the solution has passed through
Carefully open the QIAamp Mini column, and repeat step 6.
Note
If the sample volume was greater than 140 μl, repeat this step until all of the lysate has been loaded onto the spin column
Carefully open the QIAamp Mini column, and add 500 μl Buffer AW1
Close the cap, and centrifuge at 6000 xg (8000 rpm) for 1 min
Place the QIAamp Mini column in a clean 2 ml collection tube (provided), and discard the tube containing the filtrate.
Note
It is not necessary to increase the volume of Buffer AW1 even if the original sample volume was larger than 140 μl.
Carefully open the QIAamp Mini column, and add 500 μl Buffer AW2
Close the cap and centrifuge at full speed (20,000 xg; 14,000 rpm) for 3 min
Note
Residual Buffer AW2 in the eluate may cause problems in downstream applications. Some centrifuge rotors may vibrate upon deceleration, resulting in flow-through, containing Buffer AW2, contacting the QIAamp Mini column. Removing the QIAamp Mini column and collection tube from the rotor may also cause flow-through to come into contact with the QIAamp Mini column.
- In consideration of these scenarios, the next step should always be performed.
Place the QIAamp Mini column in a new 2 ml collection tube (not provided), and discard the old collection tube with the filtrate
Centrifuge at full speed for 1 min
Place the QIAamp Mini column in a clean 1.5 ml Microcentrifuge tube (not provided) and discard the old collection tube containing the filtrate
Carefully open the QIAamp Mini column and add 60 μl Buffer AVE equilibrated to room temperature
Close the cap, and incubate at room temperature for 1 min
Centrifuge at 6000 xg (8000 rpm) for 1 min
Note
- A single elution with 60 μl Buffer AVE is sufficient to elute at least 90% of the viral RNA from the QIAamp Mini column. Performing a double elution using 2 x 40 μl Buffer AVE will increase yield by up to 10%.
- Elution with volumes of less than 30 μl will lead to reduced yields and will not increase the final concentration of RNA in the eluate
Record sample preparation details in the table below;
| A | B | C | D | E | F | G | H | I | |
| Sample Type | Sample ID | Lab ID | Is the sample concentrated? | Sample Volume (µl) | PBS Volume (µl) | AVL buffer Volume (µl) | Absolute Ethanol Volume (µl) | AVE Buffer Volume (µl) | |
Amplicon Generation-RT PCR with Superscript IV One-Step RT-PCR System
Amplicon Generation-RT PCR with Superscript IV One-Step RT-PCR System
1d
1d
Record Reagent Lot Number:
- Superscript IV One-Step RT-PCR SystemThermo ScientificCatalog #12594100
Preparation of One-Step RT-PCR
Thaw aliquoted 2x RT-PCR Master Mix Buffer, and Primers at room temperature. Vortex briefly and keep on ice until use.
Invert Superscript IV RT Mix to mix before use. Keep on ice.
Save the following SIV RT-PCR program on the thermal cycler;
- Choose the preheat lid option (105°C)
- Set the reaction volume to 13 μl
- 50 °C for 10 minutes
- 98 °C for 2 minutes
- 40 cycles of:
- 98°C for 10 seconds
- 62°C for 10 seconds
- 72°C for 45 seconds*
- 72°C for 5 minutes
- Hold at 4°C
Note
“*” Extension Time varies with the set of primers; adjust for 30 sec/kb.
Record the;
- Target Amplicon Size (bp)
- Extension Time
In a 1.5 ml tube, combine the following volumes to prepare the RT-PCR Reaction Mix. Multiply each volume by the number of reactions including a negative and positive control. A 10% reagent overage is included to account for small pipetting errors;
| A | B | C | |
| Reagents | Volume (μl) | ………….. x No. of Reactions | |
| Nuclease-free Water | 2.3375 | ||
| 2x RT-PCR Master Mix Buffer | 6.875 | ||
| Forward primer (25 µM) | 0.275 | ||
| Reverse primer (25 μM) | 0.275 | ||
| Superscript IV RT Mix | 0.1375 |
Note
The table below details the primers used to amplify the protease and reverse transcriptase genes as one amplicon, and the integrase gene as a separate amplicon. These amplicons are then combined for downstream library preparation. These primers are modified based on the most circulating HIV-1 subtypes A and D in Uganda. For re-use, refer to the HXB2 location in the table below;
| A | B | C | D | E | F | G | |
| Primer Name | Sequence | size | Sense | Concetration | Purification | HXB2 location | |
| HIVINT_1F | GTAACAGACTCACAGTATGCATTAGG | 26 | Forward | 25nMol | Desalted | 4106-4131 | |
| HIVINT_2F | GGGATTGGAGGAAATGAACAAGTAG | 25 | Forward | 25nMol | Desalted | 4241-4265 | |
| HIVINT_1R | GTATGCAGACCCCAATATGTTCTTAC | 26 | Reverse | 25nMol | Desalted | 5236-5261 | |
| HIVINT_2R | GGGATGTGTACTTCTGAACTTAC | 23 | Reverse | 25nMol | Desalted | 5191-5213 | |
| HIVPR_1F | CAATTGTGGCAAAGAAGGGCAC | 21 | Forward | 25nMol | Desalted | 1968-1989 | |
| HIVPR_2F | GGGCTGTTGGAAATGTGGAAAGG | 23 | Forward | 25nMol | Desalted | 2022-2044 | |
| HIVPR_3F | CTGAAAGACAGGCTAATTTTTTAGGG | 25 | Forward | 25nMol | Desalted | 2072-2097 | |
| HIVPR_4F | GGAGGCCAGGGAATTTTCCTCAGAGC | 26 | Forward | 25nMol | Desalted | 2120-2145 | |
| HIVRT_1R | GTGCTGGTACCCATGACAGGTAG | 23 | Reverse | 25nMol | Desalted | 4213-4235 | |
| HIVRT_2R | CACTAGCCATTGCTCTCCAATTG | 23 | Reverse | 25nMol | Desalted | 4352-4374 | |
| HIVRT_3R | GACATTTATCACAGCTGGCTACTAT | 25 | Reverse | 25nMol | Desalted | 4407-4431 | |
| HIVRT_4R | GTCTACTTGTCCATGCATGGCTTC | 24 | Reverse | 25nMol | Desalted | 4443-4466 |
Primer Table
Primer map
Mix gently and ensure all the components are at the bottom of the tube.
Centrifuge briefly if needed and keep on ice. For choice of primers, refer to the table below;
Label sterile 0.2 mL 8-tube strips with sample details. Put on a frozen ice-rack.
Add 9 μl of the RT-PCR reaction mix to each of the labelled tubes
Cover tubes with strip caps and transfer to the sample preparation room
In the sample preparation room, add 3.5 μl of RNA samples to the corresponding wells.
Note
Include a positive control from the previous batches, and nuclease-free water as a negative control. Record samples added.
Mix by pipetting up and down 10 times, and centrifuge briefly
Transfer to the PCR room, place on the preprogrammed thermal cycler and run the RT-PCR program
Remove from the thermal cycler, centrifuge briefly, and proceed with the visualisation
Note
Refer to Gel electrophoresis and visualization steps described in the next Section. Other approaches could be used.
Record sample preparation details in the table below;
| A | B | C | D | E | F | G | |
| Tube No. | Lab ID | Sample Type (RNA, cDNA) | RT-PCR Forward Primer | RT-PCR Reverse Primers | RT-PCR Results (Amplified or Failed) | ||
Store RT-PCR amplicons at -20°C for future use.
Gel electrophoresis and visualization
Gel electrophoresis and visualization
2h
2h
Record the reagent lot numbers:
- Ultrapure AgaroseThermo ScientificCatalog #16500500
- GeneRuler 1 kb DNA LadderThermo ScientificCatalog #SM0312
- DNA Gel Loading Dye (6X)Thermo ScientificCatalog #R0611
- SYBR™ Safe DNA Gel StainThermo ScientificCatalog #S33102
- UltraPure™ DNA Typing Grade™ 50X TAE BufferThermo ScientificCatalog #24710030
Preparation of an agarose gel electrophoresis apparatus
Determine the amount of agarose solution needed to cast your gel. Refer to the table below:
| A | B | C | |
| Fragment Size | % Agarose (in 1X TAE) | % Prepared | |
| 1000 to 23,000 | 0.6 | □ | |
| 800 to 10,000 | 0.8 | □ | |
| 400 to 8,000 | 1 | □ | |
| 300 to 7,000 | 1.2 | □ | |
| 200 to 4,000 | 1.5 | □ | |
| 100 to 3,000 | 2 | □ |
Note
Remember to take the thickness of the gel into account, as it affects both well volume and power requirements
Prepare an agarose gel by adding agarose powder to 1x TAE buffer i.e., for a 1% agarose, add 1 g of
agarose powder to 100 ml TAE 1x buffer in a conical flask.
Record the;
- Amount of Agarose powder
- Volume of 1x TAE buffer
Mix the ingredients and dissolve the agarose in the microwave by heating the mixture just to the boiling point. Approximately, 1.5 minutes.
Remove the conical flask with a heavy-duty rubber glove and cool off the agarose mixture to hand temperature before adding Sybr Safe DNA Gel Stain.
Add 10 µl of Sybr Safe DNA Gel Stain to the molten agarose, mix gently by swirling the conical flask until homogenous.
Assemble gel casting system by placing the gel tray in the casting holder and placing the combs in the gel tray, and pour in the agarose mixture.
When the agarose gel has solidified, prepare the parafilm and dispense 2µl drops of 6X DNA gel loading dye solution onto parafilm for the number of samples to load, or pipette 2µl of 6X into 8-well strips for bulk loading.
Add 2 µl of each amplified PCR product and mix by pipetting up and down.
Pipette the mixture and dispense it into the appropriate well of the gel. Be sure to include the positive and negative control on your gel.
Briefly vortex the Gene Ruler 1 kb DNA Ladder and dispense 2µl in the dedicated slots.
Place the agarose gel in the horizontal electrophoresis system and run for about 30 minutes at 100 Volts.
After the gel electrophoresis is completed, place the gel on the gel imaging system i.e., iBright Imaging System
Amplicon Generation-Nested PCR with Platinum SuperFi II Master Mix
Amplicon Generation-Nested PCR with Platinum SuperFi II Master Mix
1d
1d
Note
A Nested PCR is an additional step to troubleshoot the samples that have failed to amplify by the RT-PCR
Record the reagent lot numbers:
- Platinum SuperFi II PCR Master Mix (2X)Thermo ScientificCatalog #12368050
Preparation of PCR amplification
Thaw primers at room temperature. Vortex briefly and keep on ice until use.
Note
The choice of the nested primers should be based on the external primers that were in the table above. Refer to the Primer map
Invert Platinum SuperFi II Master Mix to mix before use. Keep on ice.
Save the following SuperFi PCR program on the thermal cycler;
- Choose the preheat lid option (105°C)
- Set the reaction volume to 13 μl
- 98°C for 30 Seconds
- 35 cycles of:
- 98°C for 10 seconds
- 60°C for 10 seconds
- 72°C for 45 seconds*
- 72°C for 5 minutes
- Hold at 4°C
Note
“*” Extension Time varies with primer sets; adjust for 30 sec/kb.
Record the;
- Target Amplicon Size (bp)
- Extension Time
In a 1.5 ml tube, combine the following volumes to prepare the PCR Reaction Mix based on choice of the enzyme. Multiply each volume by the number of reactions including a negative and positive control. A 10% reagent overage is included to account for small pipetting errors;
| A | B | C | |
| Reagents | Volume (μl) | ………….. x No. of Reactions | |
| Nuclease free water | 5.225 | ||
| 2X SuperFi II Master Mix | 6.875 | ||
| Forward Primer (25 pmol/μl) | 0.275 | ||
| Reverse Primer (25 pmol/μl) | 0.275 |
SuperFi II DNA polymerase PCR Reaction Mix
Note
The choice of Nested primers should be based on the External primers used in the RT-PCR step. Refer to the primer map above.
Label sterile 0.2 mL 8-tube strips with sample details. Put on a frozen ice-rack.
Add 11.5 μl of the PCR reaction mix to each of the labelled tubes
Cover tubes with strip caps and transfer them to the PCR room
In the PCR room, add 1 μl of target DNA or cDNA samples to the corresponding wells. Include a positive control from the previous batches, and nuclease-free water as a negative control. Record samples added
Mix by pipetting up and down 10 times, and centrifuge briefly
Place on the preprogrammed thermal cycler and run the PCR program
Remove from the thermal cycler, centrifuge briefly and proceed with the visualisation
Note
Refer to Gel electrophoresis and visualization steps described in the above Section. Other approaches could be used.
Record sample preparation details in the table below;
| A | B | C | D | E | F | |
| Tube No. | Lab ID | Sample Type (Amplicon DNA) | PCR Forward Primer | PCR Reverse Primers | PCR Results (Amplified or Failed) | |
Store RT-PCR amplicons at -20°C for future use.
Library preparation can be achieved using either Illumina or Oxford Nanopore Technology platforms. Both methods have yielded comparable results in our experiments, however additional laboratory validation can help determine the optimal approach for specific needs.
Illumina-Illumina DNA Prep Kit166 steps
Record the reagent lot numbers:
- Illumina DNA Prep, (M) Tagmentation (96 Samples, IPB)Illumina, Inc.Catalog #20060059
- Illumina® DNA/RNA UD Indexes Set A, B, C, D Tagmentation (96 Indexes, 96 Samples)Illumina, Inc.Catalog #20091654, 20091656, 20091658, 20091660
Tagment DNA
Bring BLT and TB1 to room temperature. Vortex to mix
Save the following TAG program on the thermal cycler:
- Choose the preheat lid option and set to 100°C
- Set the react ion volume to 50 μl
- 55°C for 15 minutes
- Hold at 10°C
Label a new 96-well PCR plate TAG PCR
Add 2–30 μl DNA to each well of TAG PCR plate so that the total input amount is 100–500 ng.
Note
If DNA volume < 30 μl, add nuclease- free water to the DNA samples to bring the total volume to 30 μl
Vortex BLT (yellow cap) vigorously for 10 seconds to resuspend. Repeat as necessary
Combine the following volumes to prepare the Tagmentation Master Mix. Multiply each volume by the number of samples being processed. Reagent overage is already included for pipetting errors:
| A | B | |
| Reagent | Volume.................. No. of samples | |
| BLT (11 μl) | ||
| TB1 (11 μl) |
Vortex the Tagmentation Master Mix thoroughly to resuspend
Divide the Tagmentation Master Mix volume equally into an 8-tube strip
Using a 200 μl multichannel pipette, transfer 20 μl Tagmentation Master Mix from the 8-tube strip to each well of the plate containing a sample. Use fresh tips for each sample column
Discard the 8-tube strip after the Tagmentation Master Mix has been dispensed
Pipette each sample 10 times to resuspend
Place on the preprogrammed thermal cycler and run the TAG program
Post Tagmentation Cleanup
Bring TSB and TWB to room temperature. If precipitates are observed in TSB, heat at 37°C for 10 minutes, and then vortex until precipitates are dissolved
Save the following PTC program on the thermal cycler:
- Choose the preheat lid opt ion and set to 100°C
- Set the react ion volume to 60 μl
- 37°C for 15 minutes
- Hold at 10°C
Add 10 μl TSB to the plate
Slowly pipette each well 10 times to resuspend the beads, and then seal
Place on the preprogrammed thermal cycler and run the PTC program
Place the plate on the magnetic stand and wait until liquid is clear (~3 minutes)
Using a multichannel pipette, remove and discard supernatant
Wash two times as follows:
- Remove the sample plate from the magnetic stand and use a deliberately slow pipetting technique to add 100 μl TWB directly onto the beads. A deliberately slow pipetting technique minimizes the potential of TWB foaming to avoid incorrect volume aspiration and incomplete mixing.
- Pipette slowly until beads are fully resuspended.
- Place the plate on the magnetic stand and wait until the liquid is clear (~3 minutes).
- Using a multichannel pipette, remove and discard supernatant
Remove the plate from the magnetic stand and use a deliberately slow pipetting technique to add 100 μl TWB directly onto the beads
Pipette each well slowly to resuspend the beads
Seal the plate and place on the magnetic stand until the liquid is clear (~3 minutes)
Note
Keep on the magnetic stand and proceed to Amplify Tagmented DNA step. The TWB remains in the wells to prevent over drying of the beads
Amplify Tagmented DNA
Note
This step amplifies the tagmented DNA using a limited-cycle PCR program. The PCR step adds Index 1 (i7) adapters, Index 2 (i5) adapters, and sequences required for sequencing cluster generation
Thaw EPM on ice. Invert to mix, then briefly centrifuge
Thaw index adapters at room temperature. If tubes; vortex to mix, then centrifuge briefly. If plate; spin briefly before use
Save the following BLT PCR program on a thermal cycler using the appropriate number of PCR cycles.
Choose the preheat lid option and set to 100°C
- 68°C for 3 minutes
- 98°C for 3 minutes
- (*) cycles of:
- 98°C for 45 seconds
- 62°C for 30 seconds
- 68°C for 2 minutes
- 68°C for 1minutes
- Hold at 10°C
Note
"*" Choose the number of cycles in reference to the below;
| A | B | |
| Total DNA Input (ng) | Number of PCR Cycles (X) | |
| 1–9 | 12 | |
| 10–24 | 8 | |
| 25–49 | 6 | |
| 50–99 | 5 | |
| 100–500 | 5 |
Record the cycles used for each sample
Combine the following volumes to prepare the PCR Master Mix. Multiply each volume by the number of samples being processed. Reagent overage is included in the volume to ensure accurate pipetting;
| A | B | |
| Reagent | Volume........................No. of samples | |
| EPM (22 μl) | ||
| Nuclease-free water (22 μl) |
Vortex, and then centrifuge the PCR Master Mix at 280 × g for 10 seconds
With the TAG PCR plate on the magnetic stand, use a 200 μl multichannel pipette to remove and discard supernatant. Foam that remains on the well walls does not adversely affect the library
Remove from the magnet, and immediately add 40 μl PCR Master Mix directly onto the beads in each sample well
Immediately pipette to mix until the beads are fully resuspended. Alternatively, seal the plate and use a plate shaker at 1600 rpm for 1 minute
Seal the sample plate and centrifuge at 280 × g for 3 seconds
Add the appropriate index adapters to each sample
Using a pipette set to 40 μl, pipette 10 times to mix. Alternatively, seal the plate and use a plate shaker at 1600 rpm for 1 minute
Seal the plate with foil, and then centrifuge at 280 × g for 30 seconds
Place on the preprogrammed thermal cycler and run the BLT PCR program
Note
Safe Stopping Point
If you are stopping;
- Record the Stop Time
- Store at 2°C to 8°C for up to 30 days
Clean Up Libraries
Note
This step uses double-sided bead purification procedure to purify the amplified libraries.
Thaw IPB to room temperature. Vortex and invert to mix
Thaw RSB and bring to room temperature. Vortex to mix
Prepare fresh 80% Ethanol enough for all samples
Centrifuge sample plate at 280 × g for 1 minute to collect contents at the bot tom of the well
Place the TAG PCR plate on the magnetic stand and wait until the liquid is clear (~5 minutes)
Label a new 96 well PCR plate Wash1
Transfer 45 μl supernatant from each well of the TAG PCR plate to the corresponding well of Wash1
Vortex and invert IPB multiple times to resuspend
Add 40 μl nuclease-free water to each well of Wash1 containing supernatant
Add 45 μl IPB to each well containing supernatant
Pipette each well 10 times to mix. Alternatively, seal the plate and use a plate shaker at 1600 rpm for 1 minute
Seal the plate and incubate at room temperature for 5 minutes
Place on the magnetic stand and wait until the liquid is clear (~5 minutes)
During incubation, thoroughly vortex the IPB (undiluted stock tube), and label a new 96-well PCR plate Wash2
Add 15 μl to each well of Wash2 plate
Transfer 125 μl supernatant from each well of the Wash1 plate into the corresponding well of the Wash2 containing 15 μl undiluted IPB
Pipette each well 10 times to mix. Alternatively, seal the plate and use a plate shaker at 1600 rpm for 1 minute
Discard Wash1
Incubate Wash2 plate at room temperature for 5 minutes
Place on the magnetic stand and wait until the liquid is clear (~5 minutes)
Without disturbing the beads, remove and discard supernatant
Proceed to wash with 80% Ethanol
Wash two times as follows;
- With the plate on the magnetic stand, add 200 μl fresh 80% Ethanol without mixing.
- Incubate for 30 seconds.
- Without disturbing the beads, remove and discard supernatant
Use a 20 μl pipette to remove and discard residual Ethanol
Air-dry on the magnetic stand for 5 minutes
Remove from the magnetic stand
Add 32 μl RSB to the beads
Pipette to resuspend
Incubate at room temperature for 2 minutes
Place the plate on the magnetic stand and wait until the liquid is clear (~2 minutes)
Label new 96-well PCR plate CLEAN LIB
Transfer 30 μl supernatant to the CLEAN LIB plate
Note
Safe Stopping Point
If you are stopping;
- Record the stop time
- Seal the plate with adhesive foil seal, and store at -25°C to -15°C for up to 30 days
Pool Libraries
Note
This combines all libraries into one pool.
- When the DNA input is 100-500 ng, quantifying and normalizing individual libraries generated in the same experiment is unnecessary. However, the final yield of libraries generated in separate experiments can vary slightly. To achieve optimal cluster density, pool equal library volumes and quantify the pool before sequencing
For DNA Inputs of < 100 ng
- Quantify each library individually using Qubit™ dsDNA Quantification HS Assay KitsThermo ScientificCatalog #Q32854
For DNA Inputs of 100–500 ng
- Combine 5 μl of each library (up to 384 libraries) in a 1.7 ml microcentrifuge tube.
- Vortex to mix, and then centrifuge.
- Quantify the library pool
Check Library Quality
Note
This step assesses quality of 1μl library or pooled libraries
Analyze 1μl library or pooled libraries using a Bioanalyzer or Tape station
- Bioanalyzer High Sensitivity DNA Analysis kitAgilent TechnologiesCatalog #5067-4626
- High Sensitivity D1000 DNA Screen Tape assays KitsAgilent TechnologiesCatalog #5067-5585, 5067-5584
Dilute Libraries to the starting concentration
Note
This step dilutes libraries to the starting concentration for the sequencing system;
- Miseq (4nM)
- Iseq (2nM)
Calculate the molarity value of the library or pooled libraries using the following formula;
Using the molarity value, calculate the volumes of RSB and library needed to dilute libraries to the starting concentration for the Miseq system;
- Libraries quantified individually; dilute each library to the starting concentration.
- For multiplexed library pool: Add 10 μl of each diluted library to a tube
Note
Ensure that multiplexed libraries have unique index adapters
Record sample preparation details in the table below;
| A | B | C | D | E | F | G | H | I | |
| Lab ID | Genes amplified | DNA input (ng) | Index | BLT PCR Cycles | IPB input (µl) | Pool Library concn (ng/µl) | Average Pool Library size (bp) | Pool Library Concn (nM) | |
Follow denature and dilute instructions for the sequencing system to dilute to the final loading concentration
Denature and Dilute Libraries for the MiSeq system
Denature and Dilute Libraries for the MiSeq system
2h
2h
Record Reagent Lot Numbers
- NaOH powderMerck MilliporeSigma (Sigma-Aldrich)Catalog #655104
- PhiX Control v3Illumina, Inc.Catalog #FC-110-3001
Prepare Reagents
Prepare 1 ml of fresh 0.2 N NaOH
- Combine the following volumes in a microcentrifuge tube.
- Laboratory-grade water (800 μl)
- Stock 1 N NaOH (200 μl)
2. Invert the tube several times to mix
Note
Use the fresh dilution within 12 hours
Prepare HT1
- Remove HT1 from -25°C to -15°C storage and thaw at room temperature.
- Store at 2°C to 8°C until you are ready to dilute denatured libraries.
Denature and Dilute, 4 nM Libraries
Combine the following volumes in a microcentrifuge tube.
- 4 nM library (5 μl)
- 0.2 N NaOH (5 μl)
Vortex briefly and then centrifuge at 280 × g for 1 minute.
Incubate at room temperature for 5 minutes
Add 990 μl prechilled HT1 to the tube containing denatured library.
Note
The result is 1 ml of a 20 pM denatured library.
Dilute Denatured 20 pM Library to the desired concentration using the following volumes.
| A | B | C | D | E | F | G | |
| Concentration | 6 pM | 8 pM | 10 pM | 12 pM | 15 pM | 20 pM | |
| 20 pM library | 180 μl | 240 μl | 300 μl | 360 μl | 450 μl | 600 μl | |
| Prechilled HT1 | 420 μl | 360 μl | 300 μl | 240 μl | 150 μl | 0 μl |
Invert to mix and then pulse centrifuge
Note
This protocol has been optimised at 12 pM.
Denature and Dilute PhiX Control
Dilute PhiX to 4 nM by combining the following volumes in a microcentrifuge tube.
- 10 nM PhiX library (2 μl)
- 10 mM Tris-HCl, pH 8.5 with 0.1% Tween 20 (3 μl)
Note
If not prepared within the last 12 hours, prepare a fresh dilution of 0.2 N NaOH.
Denature PhiX Control by combining the following volumes in a microcentrifuge tube.
- 4 nM PhiX library (5 μl)
- 0.2 N NaOH (5 μl)
Vortex briefly to mix.
Centrifuge at 280 × g for 1 minute.
Incubate at room temperature for 5 minutes.
Dilute Denatured PhiX to Loading Concentration
Note
The PhiX Control can be denatured and diluted to either 12.5 pM or 20 pM depending on the Miseq reagent version to be used as shown in the table below;
| A | B | |
| Chemistry | Final PhiX Concentration | |
| MiSeq Reagent Kit v3 | 20 pM | |
| MiSeq Reagent Kit v2 | 12.5 pM |
Dilute Denatured PhiX to 20 pM by adding prechilled HT1 to the denatured PhiX library.
- Denatured PhiX library (10 μl)
- Prechilled HT1 (990 μl)
Invert to mix.
Note
You can store the denatured 20 pM PhiX library up to 3 weeks at -15°C to -25°C. After 3 weeks, cluster numbers tend to decrease. Label the Phix with the date
Dilute Denatured PhiX to 12.5 pM by adding prechilled HT1 to the denatured PhiX library.
- 20 pM denatured PhiX library (375 μl)
- Prechilled HT1 (225 μl)
Invert to mix.
Note
If you are using MiSeq Reagent Kit v3, no further dilution is required.
Combine Library and PhiX Control
Note
For most libraries, use a low-concentration PhiX control spike-in of 1% as a sequencing control. For low diversity libraries, increase the PhiX control spike-in to at least 5%.
Combine the following volumes of denatured PhiX control and denatured library.
| A | B | C | |
| Most Libraries (1% Spike-In) | Low diversity Libraries (≥5% Spike-In) | ||
| Denatured and diluted PhiX | 6 μl | 30 μl | |
| Denatured and diluted library | 594 μl | 570 μl |
Note
This protocol has been optimised for a 5% Spike-In
Set aside on ice until you are ready to load it onto the reagent cartridge for sequencing on a MiSeq System
Sequencing on a MiSeq System
Sequencing on a MiSeq System
Record Reagent lot numbers
- MiSeq Reagent KitsIllumina, Inc.Catalog #MS-102-3003, MS-102-2002, MS-103-1002, MS-103-1001
Note
Our experiments indicated that we can multiplex up to 384 samples on a MiSeq Reagent V3 (600 cycles) flow cell, 192 samples on a MiSeq Reagent V2 (300 cycles) flow cell, 96 samples on a MiSeq Reagent V2 Micro (300 cycles) flow cell, and 48 samples on a MiSeq Reagent V2 Nano (300 cycles) flow cell. These numbers can be adjusted based on laboratory preferences. Our goal is to achieve a coverage of >5000 for each sample
Preparation of MiSeq Reagents
Retrieve the corresponding sequencing cartridge and flow cell from the storage
Thaw the MiSeq cartridge using one of the methods below and record the thawing method, start and finish date/times
| A | B | C | D | |
| Tick | Cartridge Thawing Method | Start Time/Date | Stop Time/Date | |
| Refrigerator (2°C to 8°C) ~12 hrs. | ||||
| Room temperature air ~60 min | ||||
| Water bath (20°C to 25°C ~60 min |
Preparation of Sample sheet
Open the “Illumina Experiment Manager” icon
Select “Create Sample Sheet” button
Highlight “MiSeq” and proceed by selecting the “Next” button
Select ‘Other’ and a second set of options will appear
Select ‘FASTQ Only’ and click ‘Next’
On the “Workflow Parameters” section, complete the “FASTQ Only Run Settings” as follows:
- Reagent Cartridge Barcode: Enter the MiSeq run number.
- Library Prep Workflow: Illumina DNA Prep
- Index Adapters: Specify the Illumina UD Indexes
- Index reads: 2
- Experiment Names: MiSeq run number.
- Investigator Name: Enter the initials of the operator.
- Description: Leave blank.
- Date: Select date of sequencing.
- Read-type: Paired-end.
- Cycles Read 1: 151
- Cycles Read 2: 151
Ensure the “FASTQ Only Workflow Specific” settings are as follows:
- Custom Primer for Read 1: Box unchecked
- Custom Primer for Index: Box unchecked
- Custom Primer for Read 2: Box unchecked
- Reverse Complement: Box unchecked
- Use Adapter Trimming: Box checked
- Use Adapter Trimming Read 2: Box checked
Select the “Next” button
Select “Add Blank Row” to add rows and manually enter sample information. To remove rows, select at least one field, and then select “Remove Selected Rows”.
Enter the following information in the fields listed below:
- Sample ID: Name of sample.
- Index Well: Indices assigned to the samples
Ensure the “Sample Sheet Status” in the bottom left corner is deemed “valid”
Note
If the Sample Sheet Status is deemed “invalid”, the reason will be displayed in the “Reason” field in the bottom left corner. Any spaces or symbols in the sample ID may make the sheet invalid, as will conflicting indexes
Click ‘Finish’ to complete the worksheet. Save the sample sheet to a USB stick or on a computer, using the Sequencing Run ID as the file name
Note
The sample can as well be done or finalized on a separate computer
Clean Flow cell
Using plastic forceps, grip the flow cell by the base of the plastic cartridge and remove it from the flow cell container
Lightly rinse the flow cell with laboratory-grade water until both the glass and plastic cartridge are thoroughly rinsed of excess salts
With care, wipe around the black flow cell port gasket, thoroughly dry the flow cell and cartridge with a lint free lens cleaning tissue. Gently pat dry in the area of the gasket and adjacent glass
Clean the flow cell glass with an alcohol wipe. Make sure that the glass is free of streaks, fingerprints, and lint or tissue fibers.
Note
Do not use the alcohol wipe on the flow cell port gasket.
Dry excess alcohol with a lint-free lens cleaning tissue
Make sure that the flow cell ports are free of obstructions and that the gasket is well-seated around the flow cell ports
If the gasket appears to be dislodged, gently press it back into place until it sits securely around the flow cell ports
Prepare Miseq run
Open the Miseq Control Software (MCS) to the ‘Welcome Screen’ and select the ‘Sequence’ button
If you opt for “BaseSpace”: Log on to base space, otherwise proceed to load flow cell
Select the tick box for ‘Use BaseSpace for storage and analysis’
Click ‘Next’. The ‘Load Flow Cell’ screen will be visible
Open the Flow Cell compartment door
Press the white button to open the Flow Cell latch and push the latch fully open
Throw the used cell from the previous run into a sharps bin and replace with the cleaned flow cell. Align the cell with the two prongs on the flow cell platform
Hold the flow cell in place while slowly closing the latch to prevent dislodging of the flow cell
The MiSeq software will read and record the integrated radio-frequency identification (RFID) tag on the cell before the user is able to proceed to the next stage
Once this is done, click ‘Next’ button and close compartment door
The ‘Load Reagents’ screen is now visible. Open the
reagents compartment door and move the sipper lever into the ‘up’ position.
Remove the waste container and empty into a laboratory sink. Replace back into the waste container location
Remove wash bottle and replace with PR2 buffer
Lower the sipper lever and click “next”
Wait for the reagent chiller to release the wash cartridge before opening.
Remove wash cartridge and discard the used wash buffer.
Invert the reagent cartridge a minimum ten times to fully mix the reagents. Visually inspect the reagent at position 1 to make sure that it is fully thawed and free of precipitates
Gently tap the cartridge on the bench to reduce air bubbles in the reagents
Note
The MiSeq sipper tubes go to the bottom of each reservoir to aspirate the reagents,
so the reservoirs must be free of air bubbles.
Using a clean 1ml pipette tip, pierce the foil seal over the reservoir labelled ‘Load Samples’ (highlighted in orange).
Note
Other reagent positions do not need to be pierced as they are done automatically during the sequencing run
Vortex and centrifuge denatured library and transfer the full content (~600μl) of the tube into the ‘Load Samples’ reservoir
Insert the reagent cartridge and close the chiller and compartment door.
Note
The MiSeq software will read and record the integrated RFID tag on the Reagent Cartridge before the user is able to proceed to the next stage.
Press “Change Sample Sheet” and select the sample sheet prepared earlier
A review of the run parameters will be visible for verification. Select the sample sheet created. Click ‘Next’
The system performs a pre-run check of all components, disk space and network connections. This can take up to 10 minutes
Once all pre-run checks have been successful, click ‘Start Run’
Confirm the run has started before leaving
Note
Once started, do not open the compartment doors or touch the instrument monitor except to pause/stop the run. It is wise to detach a mouse and keyboard from the machine.
When sequencing has been completed; Record the following on the screen in the table below;
| A | B | |
| Run ID | ||
| Operator | ||
| Time and Date | ||
| Cluster Density (k/mm2) | ||
| %>Q30 | ||
| Clusters Passing Filter | ||
| Estimated Yield |
Select the ‘Next’ button to continue with a MiSeq Post-run wash.
Data Analysis
Data Analysis
6h
6h
In-House Pipeline
HIV-DRIVES is a web resource for the in-house pipeline designed for HIV drug resistance profiling, variant evaluation, and surveillance. It provides an easy-to-read PDF report alongside other output files. HIV-DRIVES supports Illumina data in paired and single-ended Fastq formats, including Oxford Nanopore Technology, as well as Fasta and multiple Fasta files from Sanger data in ab1.seq format. It separates patient reads from viral reads before proceeding with downstream processes.
HIV-DRIVES is supported by the Stanford University HIV Drug Resistance Database (HIVdb Program: Mutations Analysis - Stanford Coronavirus Antiviral & Resistance Database (CoVDB)), Sierra-local (https://github.com/PoonLab/sierra-local), and Quasitools (https://phac-nml.github.io/quasitools/), specifically Hydra (Home - HyDRA Web). The Stanford HIVdb algorithm s ai widely used method for predicting HIV-1 drug resistance phenotypes based on genetic sequences. Sierra-local, a Python 3 implementation of the Stanford HIVdb Sierra web service, allows laboratories to generate drug resistance predictions from HIV-1 sequence data without transmitting patient data over the network, ensuring data control and security. Quasitools is a collection of tools for analyzing viral quasispecies data. HyDRA is a bioinformatics pipeline that analyzes next-generation sequencing data for HIV-1 drug resistance mutations, using an annotated HXB2 sequence for reference mapping by Bowtie2, stringent data quality assurance, and variant calling. It identifies HIV drug resistance mutations based on the Stanford HIV Drug Resistance Database and the 2009 WHO list for Surveillance of Transmitted HIVDR. All mutations found in the pol gene (protease, reverse transcriptase, and integrase) are reported according to the Stanford Surveillance Drug Resistance Mutation list.
On-line Pipeline
The Stanford University HIV Drug Resistance Database is a widely used tool for predicting HIV-1 drug resistance phenotypes. It has evolved to accommodate both Sanger and next generation sequencing (NGS) datasets. For NGS, the program accepts user-submitted protease, RT, and integrase codon frequency tables (CodFreq files) or AAVF files generated by the HYDRA pipeline. Additionally, it features a portal for converting Fastq files to CodFreq files, providing a comprehensive, online-based analysis platform for both Illumina and Oxford Nanopore Technology datasets. Link > (HIVdb Program: Sequence Reads (NGS) Analysis - Stanford Coronavirus Antiviral & Resistance Database (CoVDB))
Results presentation
Results presentation
Routine patient care results are presented in a standard report format. This format can be customized based on laboratory preferences or clinical team recommendations for optimal interpretation.
Expected result
Note
The result format is primarily generated as a JSON file for seamless integration between the in-house laboratory information management system and the national HIV drug resistance database. This database enables healthcare facilities to remotely access patient results and efficiently manage their clients.
Acknowledgements
Genomics Core Laboratory
Central Public Health Laboratories