Dec 13, 2022
Hepatitis C Virus (HCV) subtype 1b sequencing protocol v.1
- Ali F Ruiz-Higareda1,
- Kame Galan1,
- Julio C Garza-Cabello1,
- Ana G. Rivas-Estilla1
- 1Centro de Investigación e Innovación en Virología Médica, Departamento de Bioquímica y Medicina Molecular, Facultad de Medicina de la Universidad Autónoma de Nuevo León
Protocol Citation: Ali F Ruiz-Higareda, Kame Galan, Julio C Garza-Cabello, Ana G. Rivas-Estilla 2022. Hepatitis C Virus (HCV) subtype 1b sequencing protocol v.1. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvorkkzv4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 29, 2022
Last Modified: December 13, 2022
Protocol Integer ID: 73340
Abstract
Amplicon sequencing protocol for Hepatitis C virus subtype 1b using Oxford Nanopore Technologies.
Materials
| Component | Supplier | Part Number | |
| AMPure XP beads | Beckman | A63881 | |
| SuperScript IV Reverse Transcriptase | Invitrogen | 18090010 | |
| RNaseOUT Recombinant Ribonuclease Inhibitor | Invitrogen | 10777019 | |
| Random hexamers | Invitrogen | N8080127 | |
| Q5 Hot Start High-Fidelity Polymerase or | NEB | M0493 | |
| Q5 Hot Start High-Fidelity 2X Master Mix | NEB | M0494 | |
| Nuclease-free water (100 mL) | NEB | B1500 | |
| NEBNext Ultra II End Repair/dA-tailing module | NEB | E7546 | |
| NEBNext Quick Ligation Module | NEB | E6056S | |
| dNTP Solution Mix (10 mM ea.) | NEB | N0447 | |
| Blunt/TA Ligase Master Mix | NEB | M0367 | |
| Short Fragment Buffer Expansion Kit | ONT | EXP-SFB001 | |
| R9.4.1 flow cells | ONT | FLO-MIN106 | |
| Native Barcoding Expansion Kit 96 | ONT | EXP-NBD196 | |
| Flow Cell Wash Kit (optional) | ONT | EXP-WSH003 | |
| Flow Cell Priming Kit | ONT | EXP-FLP002 |
Primers used:
PRIMER NAME
TAGTATGAGTGTCGTGCAGCCT 1L
GATCCGGAGTAACTGCGACA 4R
CACATCAACAGAACTGCCCTGA 6L
ACCACCAAGTTCTCTAAGGCGG 8R
CATCAAGGGCAGGCTGGTCCC 9.5L
AGGTCCTGGTCTACATTGGTGT 12R
TTCCAAGTGGCCCATCTACAC 15L
CAGCCGACATACATGCCATGAT 18R
TACATCGAACAGGGAATGCAGC 20L
GGAACCGTTTTTGACATGTCCG 22R
TCCATGCTCACCGACCCCTCC 26L
CTTTGATTTCCAGGCATTCACCA 28R
TCACGAACGACTGCTCCAAC 4L
TTCATCCATGTACAGCCGAACC 6R
GACGTGCTGCTCCTCAACAA 7L
TGAGCGGACCGAGTATGGCGA 9.5R
TTAACGGCGTGTGTTGGACTG 13L
TCAGGACGAGTACCTTGTACCC 14R
TGTGTGAGTGCTATGACGCG 18L
ATGTCCACAAGCACCTTCCCA 20R
TCATGTCAACGTGGGTACAAGG 23L
TCTTTCTCCGTGGAGGTGGT 25R
AAGCCAGCTCGCCTTATCGT 29L
AGATGCCTACCCCTACAGAAAGT 32R
| Pool | Primers | |
| 1 | 1L, 4R, 6L, 8R, 9.5L, 12R, 15L, 18R, 20L, 22R, 26L, 28R | |
| 2 | 7L, 9.5R, 13L, 14R, 18L, 20R | |
| 3 | 4L, 6R, 23L, 25R, 15L, 18R, 29L, 32R |
Final concentration for each pool should be 10µM
cDNA synthesis
cDNA synthesis
Prepare the RNA-primer Mix following these instructions:
Mix the following components in a 0.2 mL tube:
| Component | Volume | |
| 10 mM dNTP mix (10mM each) | 1 µL | |
| 50 µM random hexamers | 1 µL | |
| Template RNA | 11 µL |
2m
Mix and briefly centrifugate the components.
30s
Heat the RNA-primer mix at 65 °C for 00:05:00 and then incubate On ice for at least 00:01:00
6m
Prepare the RT reaction mix following the next steps:
Vortex and briefly centrifugate the 5X SSIV Buffer.
Combine the following components in a tube:
| Component | Volume | |
| 5X SSIV Buffer | 4 µL | |
| 100 mM DTT | 1 µL | |
| RNaseOUT Recombinant RNase Inhibitor | 1 µL | |
| SuperScript IV Reverse Transcriptase (200 U/µL) | 1 µL |
Combine and the RNA-primer and RT reaction mixes in a 0.2 mL tube, mix by pipetting and pulse spin the tube to collect liquid at the bottom of the tube.
Incubate the reaction as follows:
00:10:00 at 55 °C
00:10:00 at 80 °C
20m
Genome amplification
Genome amplification
3h
3h
The primer pools used in this section are described in "MATERIALS" Section.
In the mastermix hood set up the multiplex PCR reactions as follows in 0.2mL 8 PCR tubes:
| Component | Pool 1 | Pool 2 | Pool 3 | |
| Q5 Hot Start DNA Polymerase | 0.25 µL | 0.25 µL | 0.25 µL | |
| 10 mM dNTPs | 0.5 µL | 0.5 µL | 0.5 µL | |
| Primer Pool 1, 3 or 2 (10µM) | 1 µL | 1 µL | 1 µL | |
| 5X Q5 Reaction Buffer | 5 µL | 5 µL | 5 µL | |
| Nuclease-free water | 15.75 µL | 15.75 µL | 15.75 µL |
Add 2.5 µL cDNA to each tube and mix well by pipetting.
Pulse centrifuge the tubes to collect the contents at the bottom of the tube.
Set-up the following program on the thermal cycler:
Step Temperature Time Cycles
Heat Activation 94 °C 00:03:00 1
Denaturation 94 °C 00:00:30 35
Annealing 64 °C 00:00:45 35
Extension 72 °C 00:02:00 35
Final Extension 72 °C 00:10:00 1
Hold 8 °C ∞ 1
3h
PCR products can be verified using 1% agarose gels.
Sequencing library preparation
Sequencing library preparation
1h 20m
1h 20m
DNA repair and end-prep.
Incubate for 00:15:00 at 20 °C
1 µg of DNA* in 24 µL of nuclease free water
1.75 µL of NEB NextFFPE DNA Repair Buffer
1.75 µL of Ultra II End-prep reaction buffer
1 µL of NEB Next FFPE DNA Repair Mix
1 µL of NEB Next FFPE DNA Repair Mix
*DNA from previous step(PCR Products)
Inactivate the reaction for 00:15:00 at 65 °C .
30m
Barcode ligation
Incubate for 00:20:00 at 25 °C :
1.25 µL of Native Barcode
5 µL of Blunt/TA Ligase Master Mix
3.75 µL of end-prepped DNA
Inactivate the reaction for 00:10:00 at 65 °C .
Note
Use one native barcode from the EXP-NBD196 per sample.
30m
Mix all the barcoded samples into a single 1.5 ml tube.
Purify products with AMPureXP beads:
Add resuspended AMPure XP beads to the pooled barcoded sample in a 1:1 relation, mix by flicking the tube.
Incubate on a Hula mixer for 00:05:00 at Room temperature
5m
Pellet on a magnetic rack until eluate is clear and colorless, with the cap open. Keep the tube on the magnet, and pipette off the supernatant.
Note
Not to touch the pellet while discarding the supernatant is very important.
Wash the beads with 200 µL of SFB.
Pellet on a magnetic rack until eluate is clear and colorless, with the cap open. Keep the tube on the magnet, and pipette off the supernatant.
Note
Do not touch the pellet while discarding the supernatant.
Resuspend the pellet with 30 µL of nuclease free water and incubate it for 00:02:00 at Room temperature
2m
Pellet on a magnetic rack until eluate is clear and colorless, for at least 00:01:00 .
1m
Remove and retain 30 µL of the elute in a 1.5 mL tube.
Adapter Ligation
Incubate for 00:20:00 at Room temperature :
30 µL of pooled barcoded sample from previous step.
5 µL of Adapter Mix (AMII).
10 µL NEB NextQuick Ligation Reaction Buffer (X5).
5 µL Quick T4 DNA Ligase.
Incubate reaction for 00:20:00 at Room temperature .
40m
Purify product with AMPureXP beads:
Add 50 µL of resuspended AMPure XP beads to the reaction, mix by flicking the tube.
Incubate on a Hula mixer for 00:05:00 at Room temperature
Pellet on a magnetic rack until eluate is clear and colorless, with the cap open. Keep the tube on the magnet, and pipette off the supernatant.
Note
Not to touch the pellet while discarding the supernatant is very important.
Wash the beads with 250 µL of SFB.
Pellet on a magnetic rack until eluate is clear and colorless, with the cap open. Keep the tube on the magnet, and pipette off the supernatant.
Note
Do not touch the pellet while discarding the supernatant.
Resuspend the pellet with 13 µL of elution buffer(ONT) and incubate it for 00:10:00 at Room temperature
10m
Pellet on a magnetic rack until eluate is clear and colorless, for at least 00:01:00 .
Remove and retain 13 µL of the elute in a 1.5 mL tube.
Priming and loading the SpotON flow cell.
Priming and loading the SpotON flow cell.
Note
Thaw the Sequencing Buffer (SQB), Loading Beads (LB), Flush Tether (FLT) and one tube of Flush Buffer (FB) at Room temperature before mixing the reagents by vortexing, and pulse spin the tubes to collect liquid at the bottom of the tube.
Add 30 μl of Flush Tether (FLT) directly to the tube of the Flush Buffer (FB), and pulse spin the tube to collect liquid at the bottom of the tube.
Open the MinION device lid and slide the flow cell under the clip.
Slide the priming port cover to open the priming port.
Check for a small air bubble under the cover. Draw back a small volume to remove any bubbles (a few µL):
Set a P1000 pipette to 200 μl.
Insert the tip into the priming port.
Turn the wheel 220-230 µL, to draw back 20-30 µL, or until you can see a small volume of buffer entering the pipette tip.
Load 800 μl of the priming mix into the flow cell via the priming port.
Note
It is very important not to introduce any air bubble.
Wait for 5 minutes.
While waiting prepare the library as follows:
| Component | Volume | |
| DNA library | 12 µL | |
| Loading Beads (LB), mixed immediately before use | 25.5 µL | |
| Sequencing Buffer (SQB) | 37.5 µL |
Gently lift the SpotON sample port cover.
Load 200 μl of the priming mix into the flow cell via the priming port.
Note
It is very important not to introduce any air bubble.
Mix the prepared library gently by pipetting up and down.
Add 75 µL of sample to the flow cell via the SpotON port in a dropwise fashion.
Note
Ensure each drop flows into the port before adding the next.
Gently replace the SpotON sample port cover, making sure the bung enters the SpotON port, close the priming port and replace the MinION device lid.
MinION Software
MinION Software
While starting the sequencing run using MinKNOW, the following parameters are to be selected:
Kit: SQK-LSK109.
Barcode kit: EXP-NBD196, turn on Live basecalling, ensure to turn on double-ended barcoding in the basecalling settings
Run length: Set the run length to a minimum of 12 hours (you can stop the run once sufficient data has been collected or you can select more time if deemed necessary).
Basecalling: On and select 'fast basecalling'. High accuracy can be selected, however it would require to basecall more time since it is more demanding task for the computer.