Sep 21, 2023
HEK3/LINC01509 Library Preparation
- 1Walter and Eliza Hall Institute of Medical Research Melbourne
Protocol Citation: Mathew Chu 2023. HEK3/LINC01509 Library Preparation. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvorjxzv4o/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: May 24, 2023
Last Modified: September 21, 2023
Protocol Integer ID: 82388
Funders Acknowledgement:
Shalin Naik
Grant ID: 10771
Abstract
Library preparation for HEK3 recording site (LINC01509) using PCR and digestion.
Materials
- NGS primer F ("CTGGCCTGGGTCAATCCTTG")
- NGS primer R ("CCCAGCCAAACTTGTCAACC")
- Q5 HiFi polymerase 2X master mix (NEB)
- BccI (NEB)
- LMW agarose
- SYBR Safe gel stain
- Generuler 1kb PLUS
- SPRI beads (Nucleomag)
HEK293T Cell Lysis
HEK293T Cell Lysis
Make up 1:50 Thermolabile Proteinase K (NEB) in Viagen (cell).
Resuspend cells in 25 µL of Viagen/Proteinase K.
Quickly transfer cells into a PCR strip to avoid viscosity.
Perform lysis in a PCR machine:
37 °C 01:00:00
55 °C 00:30:00
On ice
Store lysates at -20 °C in the pre-PCR freezer.
1h 30m
PCR Amplification of Genomic DNA
PCR Amplification of Genomic DNA
Make up a 100 µL PCR reaction per sample (Q5) using 10 µL of cell lysate.
98 °C 00:00:30
30s
98 °C 00:00:05
68 °C 00:00:10
72 °C 00:00:20
35s
go to step #4.2 24 X
72 °C 00:02:00
2m
SPRI Bead Concentration
SPRI Bead Concentration
Purify amplicons by 1X SPRI bead cleanup, eluting in 10 µL of water.
Digestion of Zero-Length Recordings
Digestion of Zero-Length Recordings
Digest zero-length recordings with 5 µL BccI in 50 uL volume:
37 °C 01:00:00
65 °C 00:20:00
On ice
1h 20m
Gel Separation and Extraction of Recordings
Gel Separation and Extraction of Recordings
Perform gel electrophoresis in 4% LMP agarose at 3 V/cm for 01:00:00 .
1h
Extract the region from 300 bp to 500 bp and elute in 12 µL of water.
Store gel products at -20 °C in the post-PCR freezer.
Indexing PCR of Recombinant DNA
Indexing PCR of Recombinant DNA
Using 1 µL of gel product, perform indexing PCR in 12 µL volume with Nextera primers.
98 °C 00:00:30
30s
98 °C 00:00:05
67 °C 00:00:10
72 °C 00:00:20
35s
go to step #9.2 9 X
72 °C 00:02:00
2m
SPRI Bead Purification
SPRI Bead Purification
Purify amplicons by 1X SPRI bead cleanup, eluting in 10 µL of water.
D1000 Tapescreen
D1000 Tapescreen
Take 1 µL of each indexed amplicon to D1000 Tapescreen.
Expected result
Recordings should be above 158 + 67 (adaptors) + 69 (indexes) = 294 bp.
Pool indexed amplicons according to desired relative molarities for sequencing.