Oct 14, 2024
Genomic Fragment Library Generation (Coaux-Seq)
- Bradley Biggs1,
- Adam M. Deutschbauer1,
- Adam Arkin1
- 1Lawrence Berkeley National Laboratory
- Arkin Lab_Biggs
Protocol Citation: Bradley Biggs, Adam M. Deutschbauer, Adam Arkin 2024. Genomic Fragment Library Generation (Coaux-Seq). protocols.io https://dx.doi.org/10.17504/protocols.io.q26g71311gwz/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 12, 2024
Last Modified: October 14, 2024
Protocol Integer ID: 103279
Funders Acknowledgement:
Department of Energy
Grant ID: DE-AC02-05CH11231
Abstract
Protocols for creation of genomic fragment libraries for complementation assay Coaux-Seq.
Strain growth and preparation
Strain growth and preparation
20m
20m
Streak out glycerol stock of desired strain on appropriate agar plate (typically LB or R2A, 1.5% agar). Grow at appropriate temperature (often 30°C or 37°C) and time (usually overnight) to obtain colonies.
10m
If colonies have formed, pick a colony and inoculate the strain into an appropriate liquid medium and scale volume of inoculation for necessary optical density (OD600) equivalent to satisfy following genome extraction (typically 15-50 mL should suffice). Grow strains overnight at appropriate temperature conditions. 150 rpm, 30-37°C
10m
Measure OD600 the next morning to perform cell count calculation/approximation.
NOTE: When working with non-model microbes (such as those isolated from the environment), their OD600 to cfu correlation is not inherently equal to model systems like Escherichia coli. Therefore, it can be valuable to separately run a dilution curve of OD600 and plate to perform cell counts to determine this relationship.
10m
If the desired cell count has been achieved, pellet an appropriate volume of cell for subsequent steps. Centrifugation conditions - 4000 rpm, 4°C, 00:05:00
5m
Genome extraction
Genome extraction
Use preferred Genomic DNA extraction kit, following the appropriate manufacturer instructions for gram-negative or gram-positive bacteria. Here, we used Thermo Scientific GeneJET Genomic DNA Extraction Kit (Thermo Scientific, K0721).
NOTE: For subsequent steps, it is preferred to elute into nuclease free water at the end of the manufacturer protocol instead of the kit provided elution buffer.
3h
Measure DNA concentration (Nanodrop, Qubit).
NOTE: If your DNA concentration is low, you may need to run multiple extractions, pool, and concentrate to achieve the required 2 μg of genomic DNA in a <200 μL volume of nuclease free water for subsequent steps. This is why it is better to elute in nuclease free water than elution buffer, so as not to concentrate the salts when evaporating. Alternatively, one can do an additional DNA clean up step and load multiple clean up reactions onto a single column and elute into a smaller volume of nuclease free water. If this option is chosen, be sure the column and protocol is suitable for high molecular weight DNA.
5m
Genome Shearing
Genome Shearing
32m
32m
Take 2-20 μg (2 μg is frequently used) of genomic DNA and combine with nuclease free water to a volume of 200 μL in a Covaris Blue miniTube (3 kb).
2m
Turn on Covaris 220 and chiller (add water to sonication components). Ensure that machine gets to appropriate temperature and all air is cleared from system (all system checks are passed).
15m
Add Blue miniTube containing genomic DNA to Covaris 220 using miniTube loading apparatus. Run 3 kb sonication protocol. (Covaris settings - SonoLab 7.2 software, temperature 4-25°C, Peak Power 3.0, Duty Factor 20.0, Cycles/Burst 1000, 600 seconds)
NOTE: Make sure there are no air bubbles under or around the tube before starting the protocol!
15m
Once sonication protocol is complete, remove Blue miniTube containing sheared genomic DNA (turn off machine, drain water thoroughly from sonication components) and utilize sheared genomic DNA for subsequent steps.
Genome fragment recovery and preparation for cloning
Genome fragment recovery and preparation for cloning
1h 5m
1h 5m
Add appropriate volume of DNA gel loading dye to Blue miniTube.
NOTE: Most loading dyes, including the one provided with the GeneRuler 1 kb+ kit (Thermo Scientific, SM1333/4), are 6x and would suggest adding 40 μL of dye to the sheared DNA. However, using less loading dye (~20 μL) will be sufficient and prevent dilution of fragmented genomic DNA.
5m
Cast a 1% agarose gel (in 1x TAE buffer) with appropriate amount of SybrSafe (Invitrogen, S33102) or equivalent DNA imaging reagent. Here, we use 50x TAE buffer and dilute (Omega, AC10089) and UltraPure Agarose (Invitrogen, 16500-500).
20m
Once gel is set, load ladder (Generuler 1 kb+) and genomic fragment material with loading dye added.
10m
Run gel at 100 v, 400 mA, for 25-30 minutes.
30m
Image gel with appropriate gel imaging equipment (e.g., Bio-RAD Gel Doc XR+). One should observe a smear of DNA with the strongest brightness centered at 3 kb.
5m
Cut desired segment of DNA from gel (recommend approximately 1-5 kb section).
10m
Store cut bands in 1.5 to 2 mL Eppendorf tubes. Use gel slices for following step.
1m
Use GeneJET Gel Extraction Kit (Thermo Scientific, K0691) or preferred gel extraction kit to extract genomic fragment DNA.
NOTE: When in doubt, use greater volumes of binding buffer to dissolve gel. In addition, add binding buffer to column and do an extra spin before loading genomic fragment DNA (helps retention as column is better equilibrated). Perform an extra loading buffer wash before ethanol-based wash steps. Elute into desired volume of nuclease free water (30-50 μL). Measure DNA concentration (NanoDrop or Qubit).
35m
Take gel extracted DNA and repairs ends and phosphorylate using Fast DNA End Repair Kit following manufacturer protocols (Thermo Fisher Scientific, FERK0771).
As a precaution, although the end repair kit should phosphorylate the ends of your fragmented genomic DNA, run one additional phosphorylation step, using manufacturer instructions with T4 Polynucleotide Kinase (PNK) kit (New England Biolabs, M0201S).
After phosphorylation, run a PCR clean up using GeneJET PCR Purification Kit (Thermo Scientific, K0701) or preferred alternative to prepare for subsequent ligation step. Measure DNA concentration (NanoDrop). The genomic fragment library is now prepared for cloning into expression vector.
Preparation of vector backbone for cloning
Preparation of vector backbone for cloning
1h 25m
1h 25m
To generate the vector backbone for library cloning, use plasmid pBWB514 (Addgene #209326) as a PCR template, with:
Forward primer BWB1471 (CTGTCTCTTATACACATCTGTCGACCTGCAGCGTACGNNNNNNNNNNNNNNNNNNNNAGAGACCTCGTGGACATCG)
Reverse primer BWB1472 (CTGTCTCTTATACACATCTTGGACTGAAGAGCttttctctatc).
Use PrimeSTAR Max 2x master mix (Takara, R045A) using manufacturers protocols. This PCR will both linearize the plasmid for blunt end cloning (conducted later) and add the barcode and other desired genetic parts (mosaic ends, U1, U2).
NOTE: Primers should not be phosphorylated (to prevent self-ligation in subsequent steps) and should be purified (such as by HPLC) when ordering to ensure full length primers are used during PCR.
NOTE: Use a low concentration of template plasmid DNA (~5 ng) to prevent false positives at the later transformation step (from DNA carryover).
NOTE: To prepare sufficient backbone for the creation of multiple genome libraries, run 4x 50 μL PCR reactions.
45m
As a precaution, to remove remaining template plasmid DNA, run a dpnI digest with the PCR reaction. Simple approach: Add 1 μL of dpnI (Thermo Scientific, ER1701) to 50 μL PCR reaction and run at 37°C for 1 hour. Alternatively, one can run a PCR cleanup such as with a GeneJET PCR Purification Kit (Thermo Scientific, K0701), and following run a dpnI digest according to manufacturer protocols.
After the PCR and dpnI digest is complete, run a 1% agarose gel as described previously.
40m
Gel extract the linearized plasmid band with a GeneJET Gel Extraction Kit (Thermo Scientific, K0691). The desired band should be 2976 bp (approximately 3kb). Elute and measure DNA concentration (NanoDrop, Qubit).
As a precaution, run rSAP (Shrimp alkaline phosphatase) dephosphorylation reaction on backbone according to manufacturer protocols (New England Biolabs, M0371S).
Clean up DNA with GeneJET PCR Purification Kit (Thermo Scientific, K0701). Measure DNA concentration (NanoDrop). The backbone is now prepared for fragment library cloning.
Cloning fragment library
Cloning fragment library
1d 18h
1d 18h
Using a high concentration T4 DNA ligase (New England Biolabs, M0202M), run a blunt end ligation reaction following manufacturer protocols. Utilize 2:1 or 3:1 insert to backbone molar ratio. As the backbone (2976 bp) and mean insert size (3 kb) are approximately the same, one can use a mass ratio for this step. When running ligation, utilize the 16°C overnight option.
NOTE: Too high of insert amount will lead to a higher frequency of the insert ligating to insert. Too low of insert amount will lead to fewer successful ligation events.
16h
Because of the desired library size, run 4 parallel ligations (20 μL each) and pool using a single PCR clean up step with a GeneJET PCR Purification Kit (Thermo Scientific, K0701). Elute into 18 μL of nuclease free water to prepare for electroporation. If desired, measure DNA concentration and quality (NanoDrop or Qubit).
45m
Use ~3 μL of pooled and purified ligation product to transform 10-β high-efficiency electrocompetent E. coli cells following manufacturer protocols (New England Biolabs, C3020K). It is recommended to run 3 or 4 transformations for each library.
15m
After manufacturer specified recovery of transformed cells, create a dilution series in sterile 1x PBS and spot on LB+chloramphenicol plates (17 μg/mL chloramphenicol concentration) to determine transformation efficiency. Store recovered cells at 4°C overnight in recovery medium. Incubate dried, spotted plates at 37°C.
1h
The following morning, check the spotting plates to get colony forming unit (cfu) counts to determine transformation efficiencies for each transformation run. Based on the desired library size (calculated by total genome size, divided by 300 - 3 kb fragments, 10x coverage), combine volumes of the individual transformations to get to total desired cfu amount.
NOTE: cfus often overestimate library size. Thus, to be conservative, it is best to have slightly more volume than calculated.
16h
Transfer desired combination of individual transformation to 100 mL of liquid LB + chloramphenicol (17 μg/mL) in a non-baffled 500 mL shake flask. Grow for 8-10 hours.
8h
After outgrowth, make multiple (~10) glycerol stocks mixing cell culture and sterile 50% glycerol 1:1 (500 μL each) to make 1 mL stocks. Store glycerol stocks in appropriately labelled cryovials at -80°C.
Plasmid miniprep the entirety of the remaining culture with a GeneJET Plasmid Miniprep Kit (Thermo Scientific, K0502).
Mapping fragment libraries
Mapping fragment libraries
Take cloned, plasmid miniprepped genomic fragment library and use as template to prepare for PacBio sequencing. Following manufacturer protocols, use SMRTbell prep kit 3.0 to prepare library for PacBio Sequencing.
For PCR initial step, use HPLC purified primers (Forward primer BWB1473 - /5Phos/GTCCAAGATGTGTATAAGAGACAG and Rv primer BWB1474 - /5Phos/GACGATGTCCACGAGGTCTC) and run a 10x cycle PCR with 100 ng template DNA using PrimeSTAR Max.
NOTE: Run 4x 50 μL PCR reactions to obtain sufficient material.
After PCR, run agarose gel as described previously and extract 1-5 kb band from gel with kit.
Run an additional dpnI digestion reaction on extracted DNA (37°C, 1 hour). Clean up DNA with a GeneJET PCR purification kit.
Follow manufacturer protocols for SMRTbell prep kit 3.0 steps, including rigorous clean up steps and DNA quantification.
Send for PacBio sequencing. Barcode and pool as needed with SMRTbell prep kit components.
Map libraries with https://github.com/OGalOz/Boba-seq. (https://www.biorxiv.org/content/10.1101/2022.10.10.511384v3.abstract). Mapped libraries can now be used in Coaux-Seq complementation assays.