Feb 05, 2024
Version 2
Generating Ct cut-off values using gBlocks gene fragments V.2
This protocol is a draft, published without a DOI.
- 1CMC Vellore, India;
- 2Imperial College London;
- 3Imperial College London, UK
Protocol Citation: Dilip Abraham, Nick Grassly, Catherine Troman, Jonathan Rigby 2024. Generating Ct cut-off values using gBlocks gene fragments. protocols.io https://protocols.io/view/generating-ct-cut-off-values-using-gblocks-gene-fr-c8pyzvpwVersion created by Catherine Troman
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 05, 2024
Last Modified: April 10, 2024
Protocol Integer ID: 94680
Keywords: Salmonella, Typhi, Paratyphi, wastewater, environmental surveillance
Funders Acknowledgement:
Bill and Melinda Gates Foundation
Abstract
The following protocol describes the resuspension, dilution, and qPCR of gBlocks gene fragments. gBlocks gene fragments are synthesised double stranded DNA oligos, which can be used for standardisation.
In this protocol, the standard curves generated by the gBlocks in a triplex qPCR are used to determine a Ct cut-off value for the S.Typhi gene targets (ttr, tviB, staG) and the HF183 bacteroides rRNA gene.
Materials
TE BufferContributed by users
gBlocks gene fragments (see protocol)
Takyon Low ROX Probe 2x MasterMix dTTP blueEurogentecCatalog #UF-LPMT-B0701
Nuclease free waterContributed by users
qPCR DNA Extraction and Inhibition Control CY5-QXL670EurogentecCatalog #RT-SPCC-Q02
g-blocks details
g-blocks details
gBlocks gene fragments are synthesised double stranded DNA fragments which contain the sequence for the amplicon of interest, in this case for ttr, staG and tviB in S.Typhi, and HF183 bacteroides.
| A | B | C | |
| Gene target | Size (bp) | gblock sequence (5' - 3') | |
| ttr | 125 | GAAACGCTGAACGGACTCACCAGGAGATTACAACATGGCTAATTTAACCCGTCGTCAGTGGCTAAAAGTCGGTCTCGCCGTCGGTGGGATGGTCACTTTTGGTCTGAGCTACCGTGATGTGGCGA | |
| staG | 138 | CGGCGCGAAGTCAGAGTCGACATAGGCATAGATTTTCAGGCCATACATTAATTTGCCAAGGTTGCTATAAACATTTGTTCTGGAGCAGGCTGACGGAAATTCCGTGAACTCGCTGGTGATCGGCGTTGAGGTCTTATC | |
| tviB | 125 | CTTGATTTGACTTCCGATACCGGGATAATGCCATACTCTCGTCTTACCTCTTCGGCATCCACCCATGGATCAAAAATATCCACTTTACAACTATATTTACCGAGTTCCTTTACCACATCAATAAT | |
| HF183 | 132 | GGGATCATGAGTTCACATGTCCGCATGATTAAAGGTATTTTCCGGTAGACGATGGGGATGCGTTCCATTAGATAGTAGGCGGGGTAACGGCCCACCTAGTCAACGATGGATAGGGGTTCTGAGAGGAAGGTC |
Table1: Sequences for gBlocks gene fragments for S.Typhi gene targets and HF183.
Resuspending and diluting the gblocks
Resuspending and diluting the gblocks
gBlocks are supplied as a lyophilised pellet. Resuspend in TE buffer to achieve a stock of 10ng/uL.
Information on the ng provided, OD260, and molecular weight are given on the spec sheet provided with the gblocks.
The following online tools can be used to assist in these calculations:
Once resuspended, check the concentration via Qubit or Nanodrop.
If the concentration is not 10ng/ul, carry out your first dilution in step4 to make it 1ng/ul
Create serial dilutions of your stock solution adding 2uL of stock into 18uL of nuclease free water. We recommend carrying out 12 dilutions to create a series of 12 concentrations. We recommend at least 10 replicates split over at least two days.
For example, performing four replicates of 12 dilutions three times on three separate days. This would be two plates each day to include all targets.
qPCR and generating a standard curve
qPCR and generating a standard curve
Prepare the triplex qPCR mastermix described below (or singleplex for HF183)
| A | B | |
| Reagent | Volume per reaction (uL) | |
| ttr_F (20uM) | 0.25 | |
| ttr_R (20uM) | 0.25 | |
| ttr_P (5uM) | 0.5 | |
| tviB_F (20uM) | 0.5 | |
| tviB_R (20uM) | 0.5 | |
| tviB_P (5uM) | 1 | |
| staG_F (20uM) | 0.5 | |
| staG_R (20uM) | 0.5 | |
| staG_P (5uM) | 1 | |
| 2x Mastermix with ROX | 12.5 | |
| Nuclease free water | 2.5 |
Table2: Mastermix composition for triplex S.Typhi qPCR. Primer and probe sequences are provided in the qPCR protocol in the TyphoidES workspace.
| A | B | |
| Reagent | Volume per reaction (uL) | |
| HF183_F | 0.5 | |
| HF183_R | 0.5 | |
| HF183_P | 1 | |
| 10x Control Mix (Eurogentec) | 2.5 | |
| 2xMastermix with ROX | 12.5 | |
| Nuclease free water | 3 |
Table3: Mastermix composition for the singleplex HF183 reaction. Primer and probe sequences are provided in the qPCR protocol in the TyphoidES workspace.
Aliquot 20uL of master mix for each reaction in a 96-well plate. Add 5uL of gBlock dilution to each reaction.
Ensure that although the reaction is designed as a triplex, you only put one target gBlock in each reaction.
Seal the plate carefully then spin down briefly to gather all reagents at the bottom of the wells and remove bubbles.
Load the plate into the real-time PCR machine after setting it up appropriately and carry out cycling using the following conditions:
| A | B | C | |
| Cycle | Temperature (C) | Duration | |
| 1 | 50 | 2 minutes | |
| 1 | 95 | 2 minutes | |
| 40 | 95 | 15 seconds | |
| 60 | 30 seconds | ||
| 72 | 30 seconds |
Table4: Cycling conditions for all qPCR reactions.
Analysis - determining Ct cut-off
Analysis - determining Ct cut-off
The limit of detection (LOD_95) is the genome copy number/uL and associated Ct value at which a qPCR amplification would be observed 95% of the time. This can be calculated from the results of the dilution series using PROBIT analysis.
We have provided an Excel file to calculate the LOD_95 for you from your data (resource: 
LOD calculation update 250124.xlsm35KB ). Make sure you allow macros to be run. You will also need to enable the Microsoft Solver add-in. Instructions for doing so are here.
LOD calculation update 250124.xlsm35KB ). Make sure you allow macros to be run. You will also need to enable the Microsoft Solver add-in. Instructions for doing so are here.Alternatively you can use the statistical programming language R to fit the PROBIT curve. Example code:
#fit the profit curve
mod=glm(Ct_bin ~ log_conc, data=subset(gblocks, target=="ttr"), family=binomial(link="probit"))
summary(mod)
#calculate the LOD_95 in log concentration (GC/uL)
LOD_est_ttr=(qnorm(0.95)-mod$coefficients[1])/mod$coefficients[2]
#predict the LOD_95 Ct and range
LOD_Ct_ttr=predict(lm(Ct ~ log_conc, data=subset(gblocks, target=="ttr")), newdata=list(log_conc=LOD_est_ttr), interval="prediction")
To calculate the GC/uL from the qPCR Ct values of actual samples you can use the equation:
log GC/uL = (Ct – intercept) / slope
where slope and intercept are from the linear regression of the Ct value on log GC/uL generated from the standard curves (e.g. as given in the Excel spreadsheet or from the linear model (lm) fit in R).