Oct 02, 2023
Gene editing of YIPF4 in hESCs V3
- 1Harvard Medical School
Protocol Citation: Harper JW, Kelsey Hickey, sharan_swarup 2023. Gene editing of YIPF4 in hESCs V3. protocols.io https://dx.doi.org/10.17504/protocols.io.rm7vzxy44gx1/v1
Manuscript citation:
https://www.biorxiv.org/content/10.1101/2022.12.06.519342v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 01, 2023
Last Modified: May 31, 2024
Protocol Integer ID: 85798
Keywords: ASAPCRN
Funders Acknowledgement:
ASAP
Grant ID: 000282
Abstract
This protocol describes the creation of YIPF4 knockout hESCs.
Materials
anti-YIPF4 (Sino Biological 202844-T46)
Cell line maintenance
Cell line maintenance
Maintain H9 human embryonic stem cells (AAVS1-TRE3G-NGN2 hESCs) in complete (E8 media).
Targeted knock-out of YIPF4
Targeted knock-out of YIPF4
For YIPF4 knock-out, the following sgRNA sequences was designed and ordered from Synthego (5’ AAGAGGTTATGGCTGGCTTC 3').
0.6 μg sgRNA was incubated with 3 μg SpCas9 protein for 10 mins at room temperature and electroporated into 2 × 105 H9 cells using Neon transfection system (Thermo Fisher Scientific).
Deletions were verified by DNA sequencing with Illumina MiSeq (F: GTTCAATAGCATCCCCAGATGT and R: TCATCCCACAGACTAGCTCAAA) and by immunoblotting with a YIPF4 antibody (Sino Biological 202844-T46).