Apr 08, 2022
FQ-LAMP Assay for Detection of CoV2 in Clinical Nasal Swabs
- Les Jones1,
- Hemant K. Naikare2,
- Yung-Yi C. Mosley2,
- and Ralph A. Tripp1
- 1Department of Infectious Disease, College of Veterinary Medicine, University of Georgia;
- 2Tifton Veterinary Diagnostic and Investigational Laboratory, University of Georgia
Protocol Citation: Les Jones, Hemant K. Naikare, Yung-Yi C. Mosley, and Ralph A. Tripp 2022. FQ-LAMP Assay for Detection of CoV2 in Clinical Nasal Swabs. protocols.io https://dx.doi.org/10.17504/protocols.io.14egn74bpv5d/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: April 08, 2022
Last Modified: April 08, 2022
Protocol Integer ID: 60503
Keywords: FQ-LAMP, RT-LAMP, fluorescence, SARS-CoV-2, diagnostics, variant, VOC
Abstract
COVID-19 is a public health challenge requiring rapid testing for detecting infections and transmission. Nucleic acid amplification tests (NAAT) targeting SARS-CoV-2 (CoV2) are used to detect CoV2 in clinical samples.Real-time reverse transcription-quantitative PCR (RT-qPCR) is the standard NAAT for CoV2, although Reverse Transcription Loop-mediated isothermal amplification (RT-LAMP) is used in diagnostics. We show a sequence-specific RT-LAMP-based NAAT assay that is finished within 30 min using minimally processed clinical nasal swab samples and describe a fluorescent-quenched RT-LAMP assay (FQ-LAMP) using labeled primers and a quencher oligo. This assay can achieve rapid (30 min) and sensitive (1000 PFU/ml) fluorescent detection of CoV2 (WA1/2020), B.1.1.7 (Alpha), and variants of concern Delta (B.1.617.2) and Omicron (B.1.1.529) in nasal samples.
Materials
1. WarmStart LAMP Kit (DNA & RNA) New England Biolabs (E1700)
2. Oligo Primers and detection from IDT
| COVID-F3 | TGGCTACTACCGAAGAGCT | |
| COVID-B3 | TGCAGCATTGTTAGCAGGAT | |
| COVID-LoopF | GCCATTTTACTTTCTAGAGTCAGGT | |
| COVID-FLB | [6FAM]ACTGAGGGAGCCTTGAATAC | |
| COVID-FIP (F1c) | GACGAATTCGTGGTGGTGA | |
| COVID-FIP (F2) | TCTGGCCCAGTTCCTAGGTAGT | |
| COVID-BIP (B1c) | CGGGTGCCAATGTGATCT | |
| COVID-BIP (B2) | AGACGGCATCATATGGGTTGCA | |
| COVID-QLB | GCTCCCTCAGT[IBHQ] |
Primers 5' - 3' from IDT
3. Molecular grade deionized water
4. Proteinase K Molecular Grade New England Biolabs (P8107S)
5. Guanidine-HCL Sigma
6. EDTA Sigma
7. Triton X-100 detergent Sigma
8. Tris-HCL pH 7.5 Sigma
FQ-LAMP Sample Preparation
FQ-LAMP Sample Preparation
mix 20ul of clinical swab material with 20 ul of SPS buffer containing Proteinase K.
Incubate at 37C for 15 minutes, then 95C for 5 minutes
Sample is ready to use in FQ-LAMP at 2ul / 25ul reaction
Prepare FQ-LAMP Master Mix
Prepare FQ-LAMP Master Mix
Determine the number of 25ul FQ-LAMP reactions needed and add 10%
Mix the following in clean tube per 25ul FQ-LAMP reaction
2X WarmStart LAMP reagent 12.5ul
10X Detection Oligo/Primer Mix 2.5ul
deionized water 8ul
Dispense 23ul of FQ-LAMP master mix to each required wells of a 96 well PCR plate
Add 2ul of prepared sample in SPS buffer per assay
Centrifuge the plate to settle all contents and seal the plate with appropriate cover material.
Run FQ-LAMP assay on real time PCR machine
Run FQ-LAMP assay on real time PCR machine
Set up the real time machine to measure fluorescence in the FAM channel.
Set up the real time machine amplification program:
HOLD 65C / 30 minutes
HOLD 25C / 30 seconds
measure fluorescence
Record results