Sep 25, 2024
FLAM-seq (with Kapa mRNA enrichment)_CMS_edit-2024-09-25
Forked from a private protocol
- 1University of Miami
Protocol Citation: Corneliu Sologon 2024. FLAM-seq (with Kapa mRNA enrichment)_CMS_edit-2024-09-25. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk8q46l5r/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: In development
We are still developing and optimizing this protocol
Created: September 25, 2024
Last Modified: September 25, 2024
Protocol Integer ID: 108373
Abstract
fork__CMS_edit-2024-09-25
Materials
Kapa mRNA HyperPre Kit Illumina (cat. KK8440, Roche; Replaces TruSeq mRNA)
- mRNA Capture Beads
- mRNA Bead Binding Buffer (BBB)
- mRNA Bead Wash Buffer(BWB)
Poly(A) Tail Length Assay Kit (cat. 764551KT, Thermo Fisher)
- 5X tail buffer mix
- 10X tail enzyme mix
- Universal Reverse (Univ. RV Primer; used in Sect 4: cDNA Amplification)
SMARTer PCR cDNA cDNA Synthesis Kit (cat. 634926, Takara)
- 5X First strand buffer
- DTT 20mM
- dNTP mix 10 mM
- RNase Inhibitor
- SMARTScribe RT
- 5' PCR Primer II A (used in Sect 4: cDNA Amplification)
Advantage 2 DNA polymerase mix (cat 639207, Takara)
- 10X Advantage 2SA PCR buffer
- dNTP Mix (10 mM each)
RNAClean XP Beads (cat. A63987, Beckman Coulter)
XP DNA beads (cat. A63881, Beckman Coulter)
Custom Oligonucleotides
isoTSO - Template switch oligo (where “i” indicates stereoisomers of dC and dG as in the associated
publication):
iCiGiCAAGCAGTGGTATCAACGCAGAGTACATrGrGrG
RT primer 1:
GGTAATACGACTCACTATAGCGAGANNNNNNNNNNCCCCCCCCCTTT
PCR primer 1 (to use in combination with RT primer 1; not used; replaced by 5' PCR Primer II A):
GGTAATACGACTCACTATAGCGAG
RT primer 2 (to use in alternative to 1):
TGAGTCGGCAGAGAACTGGCGAANNNNNNNNNNCCCCCCCCCTTT,
PCR primer 2 (to use in combination with RT primer 2; not used; replaced by 5' PCR Primer II A):
TGAGTCGGCAGAGAACTGGCGAA
Poly(A)+ RNA preparation (using Kapa mRNA Beads)
Poly(A)+ RNA preparation (using Kapa mRNA Beads)
10m 10s
10m 10s
Prepare mRNA Beads
52.5 µL mRNA Beads can be scaled for multiple samples
500 rpm, 00:01:00
Room temperature 00:05:00 magnet
Discard supernatant
5m
Remove from magnet
52.5 µL BBB
500 rpm, 00:01:00
Room temperature 00:05:00 magnet
Discard supernatant
Remove from magnet
52.5 µL BBB
500 rpm, 00:01:00
2-10 µg ds DNA in 0.2 mL PCR tube
50 µL QS; NAF
50 µL re-suspended mRNA Beads (from 1.5)
1000 rpm, 20°C, 00:01:00
65 °C 00:02:00
20 °C 00:05:00
undetermined, 00:00:10 , pulse
7m 10s
Room temperature 00:05:00 magnet
Discard supernatant
5m
Remove from magnet
200 µL BWB
1000 rpm, 20°C, 00:01:00
Room temperature 00:05:00 magnet
Discard supernatant
5m
50 µL NAF
1000 rpm, 20°C, 00:01:00
70 °C 00:02:00
20 °C 00:05:00
undetermined, 00:00:10 , pulse
7m 10s
50 µL BBB
1000 rpm, 20°C, 00:01:00
20 °C 00:05:00
5m
Room temperature 00:05:00 magnet
Discard supernatant
5m
Remove from magnet
200 µL BWB
1000 rpm, 20°C, 00:01:00
Room temperature 00:05:00 magnet
Discard supernatant
5m
Remove from magnet
16 µL NAF
1000 rpm, 20°C, 00:01:00
70 °C 00:02:00
2m
Room temperature 00:05:00 magnet
5m
16 µL ds DNA to new 0.2 mL PCR tube
GI Tailing (using USB poly(A) tail length assay, Thermo Fisher).
GI Tailing (using USB poly(A) tail length assay, Thermo Fisher).
Prepare on ice (20 uL total):
14 µL RNA - poly(A)+
4 µL 5X tail buffer mix
2 µL 10X tail enzyme mix
37 °C 01:00:00
1h
1.5 µL Stop Solution
4 °C 00:02:00
2m
38.7 µL XP RNA Beads (1.8X)
Room temperature 00:05:00
5m
Room temperature 00:03:00 magnet
Discard supernatant
3m
50 µL 80% EtOH 00:00:30
Discard supernatant
30s
go to step #23 x1
undetermined, 00:00:10 , pulse
Discard supernatant
10s
Remove from magnet
17 µL NAF
1000 rpm, 20°C, 00:01:00
16 µL ds DNA to new 0.2 mL PCR tube
cDNA synthesis (using SMARTscribe reverse transcriptase kit, Clontech).
cDNA synthesis (using SMARTscribe reverse transcriptase kit, Clontech).
Prepare RT master mix at room temperature (22 uL total; 1.1X per sample):
8 µL 5X First STrand buffer
1.5 µL DTT (20 mM)
4 µL dNTP mix (10 mM)
2 µL RNAse Inhibitor
2 µL isoTSO (12 uM)
2 µL SMARTScribe RT
2.5 µL NAF
In 0.2 mL PCR tube from step 27
16 µL ds DNA
2 µL RT Primer 1 (10 uM); custom ds DNA
1000 rpm, Room temperature , 00:01:00
undetermined, 00:00:10 , pulse
10s
72 °C 00:03:00
42 °C HOLD - add 22 µL RT master mix
42 °C 01:00:00
70 °C 00:10:00
4 °C HOLD
1h 13m
24 µL XP DNA Beads (0.6X)
Room temperature 00:05:00
5m
Room temperature 00:03:00 magnet
Discard supernatant
50 µL 80% EtOH 00:00:30
Discard supernatant
go to step #23 x1
undetermined, 00:00:10 , pulse
Discard supernatant
Remove from magnet
42 µL NAF
1000 rpm, 20°C, 00:01:00
40 µL ds DNA to new 0.2 mL PCR tube
cDNA library amplification (using Advantage 2 PCR enzyme system, Clontech).
cDNA library amplification (using Advantage 2 PCR enzyme system, Clontech).
11m 25s
11m 25s
Prepare the cDNA library amplification rxn:
40 µL ds DNA
10 µL 10X Advantage 2SA PCR buffer
2 µL dNTP (10 mM)
2 µL 5' PCR Primer II A (SMARTer PCR kit)
2 µL Univ. RV Primer (Poly(A) Tail Kit)
42 µL NAF
2 µL Advantage 2 Polymerase Mix
Perform PCR
1. 98 °C HOLD - add cDNA rxn
2.98 °C 00:01:00
3.98 °C 00:00:10
4.63 °C 00:00:15
5.68 °C 00:03:00 repeat 40.3 -40.5 24X
6.68 °C 00:07:00
7.4 °C HOLD
11m 25s
60 µL XP DNA Beads (0.6X)
Room temperature 00:05:00
Room temperature 00:03:00 magnet
Discard supernatant
200 µL 80% EtOH 00:00:30
Discard supernatant
go to step #23 x1
undetermined, 00:00:10 , pulse
Discard supernatant
Remove from magnet
42 µL NAF
1000 rpm, 20°C, 00:01:00
40 µL ds DNA to new 0.2 mL PCR tube
Sequencing library preparation (using the SMRTbell™ Template Prep Kit)
Sequencing library preparation (using the SMRTbell™ Template Prep Kit)
Performed in PacBio sequencing core