Jan 15, 2023
Extraction of fungal DNA and PCR for identification using the Sigma-Aldrich REDExtract Plant PCR kit
This protocol is a draft, published without a DOI.
- 1University of Auckland
Protocol Citation: Siouxsie Wiles, Shara Van De Pas 2023. Extraction of fungal DNA and PCR for identification using the Sigma-Aldrich REDExtract Plant PCR kit. protocols.io https://protocols.io/view/extraction-of-fungal-dna-and-pcr-for-identificatio-cjrmum46
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 25, 2022
Last Modified: January 15, 2023
Protocol Integer ID: 73229
Keywords: DNA, fungi, fungus, DNA extraction, colony PCR, ITS
Abstract
This protocol describes how we use the REDExtract Plant PCR kit (Sigma-Aldrich) to extract DNA from fungal mycelium and PCR from the ITS region.
Guidelines
Make sure your fungal plates aren't contaminated!
Materials
Plasticware
| Description | Catalogue Number | Supplier | |
| PCR tubes | TFI0201 | Bio Rad laboratories | |
| Pipette tips |
Chemicals and Kits
| Description | Catalogue Number | Supplier | |
| REDExtract, Plant PCR Kit | XNAP | Sigma-Aldrich (New Zealand) | |
| Ultrapure water | 10977015 | Life Technologies New Zealand | |
| Agarose | A-1280-100 | pH Scientific Limited | |
| Sybrsafe DNA Gel Stain | S33102 | Thermo Fisher Scientific | |
| TAE buffer | PMV4271 | In vitro technologies | |
| 1kb ladder | SMO313 | Life Technologies New Zealand |
Primers:
| Primer | Sequence | |
| ITS1F | 5' CTTGGTCATTTAGAGGAAGTAA 3' | |
| ITS4 | 5' TCCTCCGCTTATTGATATGC 3' |
Equipment:
- Pipettes - various sizes
- Thermocycler PCR machine for cell lysis and colony PCR
- Micro centrifuge
- Powerpack for gel electrophoresis
Before start
You will need to prepare your fungal cultures so that you have visible mycelium for extraction.
DNA Extraction
DNA Extraction
Place 30 ul extraction solution into PCR tubes. Using a small sterile pipette tip place a small piece of mycelium so its only just visible on the tip into the tube. Vortex and briefly centrifuge.
Place PCR tubes into the PCR machine and run a cell break protocol (95 °C for 10 minutes).
Cool down and add 30µl dilution solution.
Dilute the samples as needed. Start with 1:20 and go to 1:10 or 1:5 if needed.
Store the extracted DNA at -20 °C until PCR.
PCR
PCR
Make a master mix based on 9 µl per single reaction
Recipe per PCR sample (single reaction = 9 µl)
| Component | Volume per single reaction | Volume based on 10 samples* | |
| Reaction mix | 5µl | 65µl | |
| Forward primer | 0.5µl | 6.5µl | |
| Reverse primer | 0.5µl | 6.5µl | |
| Dilution solution | 0.5µl | 6.5µl | |
| Extraction solution | 0.5µl | 6.5µl | |
| Ultrapure H2O | 2µl | 26µl |
*Total preparation amount = number of samples + 1 negative control + 2 extra to cover pipetting errors.
Aliquot 9µl of master mix into individual PCR tubes.
Add 1µl of extracted DNA sample to each aliquot of master mix.
Centrifuge samples briefly (just a few seconds) in a benchtop centrifuge to ensure they are at the bottom of the tube.
Place tubes into PCR machine and run using the following settings:
1x 94 °C - 3 minutes.
35-40x cycles of:
94 °C - 30 seconds
52 °C - 30 seconds
72 °C - 30 seconds (For LSU primers use 72 °C for 40 sec)
1x 72 °C - 7 minutes
Gel electrophoresis
Gel electrophoresis
Make a 1% molecular grade agarose gel using 1x fresh TAE. Microwave until the agar has just dissolved.
Note. 100ml for running 25 samples, 35ml for 13 samples
Add 2µL Sybrsafe stain per 50ml volume of agar
Pour into setup gel tray, add comb and leave for half an hour or until set.
Place the set gel into the gel tank (make sure the wells are at the negative end).
Fill the tank with waste TAE until entire gel is submerged - can top up with fresh TAE if needed.
Load 2-5µl of sample into each well including a 1kb ladder and negative controls
Set powerpack to run at 90v for 30mins
After gel is run gently lift the tray out of the tank and movie it onto a sybersafe tray view bands in the gel viewer.