Mar 23, 2022
Version 2
DNA metabarcoding protocol for siphonophore gut contents V.2
- 1University of Oregon
External link: https://docs.google.com/spreadsheets/d/1x71z9YLqxo9XszNcjAPB__p0cnHHYyMTEHNL4wb84j4/edit#gid=656913706
Protocol Citation: Alejandro Damian Serrano 2022. DNA metabarcoding protocol for siphonophore gut contents. protocols.io https://dx.doi.org/10.17504/protocols.io.5qpvo57o7l4o/v2Version created by Alejandro Damian Serrano
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: March 23, 2022
Last Modified: March 23, 2022
Protocol Integer ID: 59815
Disclaimer
DISCLAIMER – FOR INFORMATIONAL PURPOSES ONLY; USE AT YOUR OWN RISK
The protocol content here is for informational purposes only and does not constitute legal, medical, clinical, or safety advice, or otherwise; content added to protocols.io is not peer reviewed and may not have undergone a formal approval of any kind. Information presented in this protocol should not substitute for independent professional judgment, advice, diagnosis, or treatment. Any action you take or refrain from taking using or relying upon the information presented here is strictly at your own risk. You agree that neither the Company nor any of the authors, contributors, administrators, or anyone else associated with protocols.io, can be held responsible for your use of the information contained in or linked to this protocol or any of our Sites/Apps and Services.
Abstract
Protocol for the SiphWeb DNA metabarcoding of siphonophore gut content.
Starting with DNA extractions from pooled frozen gastrozooids, this protocol takes the user through the steps of PCR amplification, PCR cleanup and pooling of amplicons from six complementary 18S barcodes that can be submitted into an Illumina MiSeq Lane.
Materials
MATERIALS
GoTaq(R) Long PCR Master Mix, 10 ReactionsPromegaCatalog #M4020
Protocol materials
TAE Buffer, 10X, 1000mlPromegaCatalog #V4271
Step 12
AgaroseThermo FisherCatalog #75510019
Step 12
ExcelaPure™ 96-Well UF PCR Purification Plates (No Receivers)Edge BioCatalog #36181
Step 15
GoTaq(R) Long PCR Master Mix, 10 ReactionsPromegaCatalog #M4020
Materials
SYBR SAFE DNA stainInvitrogen - Thermo FisherCatalog #S33102
Step 12
DNA Extractionion
DNA Extractionion
4h
4h
Mainly identical to:
With the following modifications:
-Digestion at 56 °C 1-2h
-Elution using 2 rounds of incubation and centrifuge with 50 µL of AE buffer , incubating 00:10:00 at 56 °C , to a total of 100 µL
-Label 2 mL Eppendorf tubes to hold the extracted DNA. Include the extraction number, the siphonophore species, "GCDNA", the date of extraction, and your initials.
-Use Nanodrop to assess DNA yield (ng/µl) and 260:280 ratio.
Equipment
NanoDrop™ 3300 Fluorospectrometer
NAME
Fluorospectrometer
TYPE
NanoDrop™ 3300
BRAND
nd-3300
SKU
LINK
Store eluted DNA in -20 °C freezer.
4h
PCR
PCR
2h 52m
2h 52m
Based off Promega GoTaq protocol.
(Plan for a 96-well final plate [90 wells used for 13 templates, a positive, and a negative control, across 6 primer pairs (detailed in T1)], can be re-scaled as needed).
See reference planning spreadsheet here: https://docs.google.com/spreadsheets/d/1x71z9YLqxo9XszNcjAPB__p0cnHHYyMTEHNL4wb84j4/edit#gid=656913706
Only select templates that have a DNA yield > 10ng/µl and a 260:280 > 1.7
| A | B | C | D | E | F | G | H | I | J | K | L | M | N | |
| Original Name | Type (F/R) | Barcode Region | Primer sequence | Length (bp) | TM © min | TM © max | %GC | Hairpin TMC | Self Dimer TMC | Pair Dimer TMC | Insert size (bp) | Start position | End position | |
| 152F | F | V5-V7S | TGACGGAAGGGCACCACCAG | 20 | 62.7 | 64.6 | 63.2 | 63 | 0.1 | None | 152 | 1187 | 1207 | |
| 152R | R | V5-V7S | TCCACCAACTAAGAACGGCC | 20 | 60 | 60 | 55 | None | None | None | 152 | 1319 | 1339 | |
| 166F | F | V3 | AACGGCTACCACATCCAAGG | 20 | 60 | 60 | 55 | None | None | None | 146 | 420 | 440 | |
| 166R | R | V3 | CACCAGACTTGCCCTCCAAT | 20 | 60 | 60 | 55 | 31.9 | None | None | 146 | 546 | 566 | |
| 272F | F | V5-V7L | AAACGATGCCGACTAGCGAT | 20 | 59.9 | 59.9 | 50 | 44.6 | 7.9 | 6.7 | 272 | 1067 | 1087 | |
| 272R | R | V5-V7L | TCCACCAACTAAGAACGGCC | 20 | 60 | 60 | 55 | None | None | 6.7 | 272 | 1319 | 1339 | |
| 179F | F | V7 | GGCCGTTCTTAGTTGGTGGA | 20 | 60 | 60 | 55 | None | None | 11 | 170 | 1319 | 1339 | |
| 179R | R | V7 | TGCGGCCCAGAACATCTAAG | 20 | 60.1 | 60.1 | 55 | None | None | 11 | 170 | 1469 | 1489 | |
| 261F | F | V7p+V8 | AACAGGTCTGTGATGCCCTT | 20 | 59.2 | 59.2 | 50 | 44.1 | 4.2 | 14 | 215 | 1472 | 1492 | |
| 261R | R | V7p+V8 | TGTGTACAAAGGGCAGGGAC | 20 | 59.9 | 59.9 | 55 | None | None | 14 | 215 | 1667 | 1687 | |
| 134F | F | V9 | CTTTGTACACACCGCCCGTC | 20 | 61.6 | 61.6 | 60 | None | None | None | 115 | 1675 | 1695 | |
| 134R | R | V9 | CCTTGTTACGACTTTTACTTCCTCT | 25 | 58.8 | 58.8 | 40 | None | None | None | 115 | 1765 | 1790 |
T1. Primer sequences and properties. Positions based on the 18S Gene of Lymnaea diaphana (GenBank JF909497.1).
-Pull all reagents in T2 from the freezer and let them thaw.
-Separate and label two PCR plates,
one for V9 (annealing at 48 °C for 00:00:45 per cycle)
one for V3, V5-V7S, V5-V7L, V7, and V7p+V8 (all annealing at 54 °C for 00:01:00 x30 cycles ). Divide and label each pair of rows that will contain each primer pair mix.
1m 45s
| Reagent | Volume (µm) | |
| Template (variable) | 2 | |
| Forward primer (10µM) | 0.5 | |
| Reverse primer (10µM) | 0.5 | |
| MgCl2 (25mM) | 2.5 | |
| dNTPs (10mM) | 1 | |
| GoTaq | 0.2 | |
| Buffer 5X (green) | 2.5 | |
| BSA | 1 | |
| H2O | 14.8 | |
| TOTAL | 25 |
T2. Reagent breakdown goal per well in the plate.
-Make master-mastermix for all primer pairs as in T3. Always vortex each reagent before pipetting, and vortex the mixture at the end.
| Reagent | Volume (µm) | |
| MgCl2 (25mM) | 350 | |
| dNTPs (10mM) | 140 | |
| GoTaq | 28 | |
| Buffer 5X | 350 | |
| BSA | 140 | |
| H2O | 2072 | |
| TOTAL | 3080 |
T3. Master-mastermix volumes for 6 primer pair mastermixes downstream.
10m
-Serve 440 µL of this master-mastermix into 6 2 mL Eppendorf tubes. Lable the tubes with the name of each primer pair.
-Add 10 µL of 10 micromolar (µM) Forward and 10 µL of 10 micromolar (µM) Reverse primer into each primer-specific mastermix to end up with T4.
-Vortex .
| A | B | |
| Reagent | Volume (µl) | |
| Forward primer (10µM) | 10 | |
| Reverse primer (10µM) | 10 | |
| MgCl2 (25mM) | 50 | |
| dNTPs (10mM) | 20 | |
| GoTaq | 4 | |
| Buffer 5X | 50 | |
| BSA | 20 | |
| H2O | 296 | |
| TOTAL | 460 |
T4. Volumes in primer pair mastermix.
10m
In a set of 14 PCR tubes (can use two rows in either PCR plate too), serve an excess amount of template to seed each well with. I usually go for 20 µL . Serve the templates in the same spatial arrangement as they will be seeded in each set of rows for each primer pair.
Include the positive and negative controls. I tend to pick the elution AE buffer stock I used for extractions as negative control, and a previously successful template as positive control.
10m
Using a single 200 µL pipette tip on a multi-step pipette set to 23 µL doses in 4 steps, seed each primer-specific pair of rows. Remember to get rid of the excess (before or after serving the steps, depending on the model of the pipette). Change tips in between primer-pair-specific mastermix.
Using a multichannel 10-100µl, seed the 2 µL of template in each well. Be careful to not accidentally aspire air at the bottom of the tubes/wells and end up with un-seeded wells. Always visually inspect the tips defore serving into the wells. Change tips every time to avoid contamination.
30m
Seal the plates (00:00:06 under the plate press) with cellophane cover.
Vortex plates.
1000 rpm, 00:00:10 , Benchtop manual plate centrifuge and spin it down.
1m
Insert plates (V9) and (V3, V5-V7S, V5-V7L, V7, V7p+V8) in two separate thermocyclers. Run PCRs following the programs specified in T5A and T5B respectively.
Equipment
SimpliAmp Thermal Cycler
NAME
PCR
TYPE
Applied Biosystems
BRAND
A24811
SKU
LINK
Any standard PCR thermocycler will suffice
SPECIFICATIONS
| A | B | C | D | E | F | |
| Temperature (C) | 95 | 95 | 48 | 72 | 72 | |
| Time | 2m | 30s | 45s | 1m | 5m | |
| Cycles | x30 | x30 | x30 |
T5A. PCR program for barcode V9.
| A | B | C | D | E | F | |
| Temperature (C) | 95 | 95 | 54 | 72 | 72 | |
| Time | 2m | 30s | 1m | 1m | 5m | |
| Cycles | x30 | x30 | x30 |
T5B. PCR program for barcodes V3, V5-V7S, V5-V7L, V7, and V7p+V8.
1h 45m
Vortex plates.
1000 rpm, 00:00:10 , Benchtop manual plate centrifuge and spin it down.
Un-seal the plates (00:00:06 under the plate press)
1m
Gel Electrophoresis
Gel Electrophoresis
1h 25m
1h 25m
2 g of Agarose for every 100 mL of TAE buffer.
TAE Buffer, 10X, 1000mlPromegaCatalog #V4271
AgaroseThermo FisherCatalog #75510019
For 90 wells, we will need 3 gels with 2 16-well combs each.
For 3 gels, we need to make 200 mL of agar in one batch, and 100 mL in another batch.
In the double batch, add 4 g of agarose and 200 mL of TAE buffer. Microwave for 00:03:00 . Stir and microwave for another 00:01:00 if solids are still not dissolved. When cool, add 4 µL of SYBR-Safe.
In the single batch, add 2 g of agarose and 100 mL of TAE buffer. Microwave for 00:02:30 . Stir and microwave for another 00:01:00 if solids are still not dissolved. When cool, add 2 µL of SYBR-Safe.
SYBR SAFE DNA stainLife TechnologiesCatalog #S33102
Pour gels and let them cool until solid.
Annotate distribution of samples on wells. I usually arrange a row per primer pair ordered by amplicon size: V9:V5-V7S, V3:V7, V7p+V8:V5-V7L in 3 gels, and then the well sequence would go: Ladder, A1-B6 (letters vary with position in the PCR plate), -ve, +ve.
30m
Set up power source to 125V, 500mA, 00:45:00
Load 6 µL of 100bp ladder on the left side of each row of wells (2 per gel).
Use adjustable-spacer multichannel pipette to load 5 µL of PCR products onto the wells.
Well distance is 6.25 mm , PCR plate distance is 9 mm .
Run gels.
55m
Place gels under UV light, take photograph, print.
Expected result
You should see a band over each well except the negative control. The bands should land at approximately the height (in bp) of the ladder corresponding to the name (expected amplicon length) of each primer pair.
2m
PCR Cleanup
PCR Cleanup
47m 6s
47m 6s
Put some nuclease-free water to warm up to 56 °C .
ExcelaPure™ 96-Well UF PCR Purification Plates (No Receivers)Edge BioCatalog #36181
Add 55 µL of water into each PCR well (except controls and failed reactions) using a multichannel 20-200µl and filter tips. Mix by pipetting up and down ~5 times. Transfer mix to ExcelaPure purification plate. Change tips every time.
10m
5000 rpm, 00:07:00 Centrifuge the purification plate with a collecting plate underneath.
Make sure to balance the plate centrifuge with a couple of adequately weighted collecting plates.
7m
Add 50 µL of warm (56 °C ) water to each well in the purification plate. Mix by pipetting up and down ~15 times with the multichannel pipette and filter tips. Change tips every time.
10m
Incubate at 56 °C for 00:10:00 .
Prepare a final clean product PCR plate: Label and annotate adequately to preserve sample location. I recommend drawing a line between each pair of rows, segregating primer pairs for barcodes V3 to V9.
10m
Mix the warm eluted clean products in the purification plates by pipetting up and down ~15 times with the multichannel pipette and filter tips.
Transfer clean products to the final plate.
Change tips every time.
10m
Seal the plates (00:00:06 under the hot plate press) with cellophane cover. Store in -20 °C freezer.
6s
Amplicon isomolar poolingling
Amplicon isomolar poolingling
2h 50m
2h 50m
The goal here is to obtain an equal concentration of each barcode for each sample, so they can be pooled with equal representation for MiSeq Illumina sequencing.
First step is to quantify the DNA content in each cleaned PCR product well using Qubit HS.
Equipment
new equipment
NAME
Qubit 2.0 Fluorometer instrument
BRAND
Q33226
SKU
with Qubit RNA HS Assays
SPECIFICATIONS
If you have the pre-mixed mastermix, just run the standards at 190 µL of mastermix and 10 µL of standard.
Vortex mix and incubate for 1min.
Prepare the assay tubes with 198 µL MM and 2 µL of template.
Vortex mix and incubate for 1min.
Pick the ng/µl units.
40m
-Calculate amount of template to seed in each pooling well.
-Pool target concentrations are equal to the lowest concentration across barcodes for a sample excluding those that are <2ng/µl, which is the minimum required by YCGA for amplicon sequencing.
| A | B | C | D | E | F | |
| V9 | V5-V7S | V3 | V7 | V7p+V8 | V5-V7L | |
| 0.5 | 0.5 | 0.6 | 0.6 | 0.9 | 1 |
T6. Molar correction factors for each barcode based on the molecular weight of each expected amplicon length.
Template volume to add = (50 µL /(Qubit ng/µl value of original PCR product/Pool target concentration))*Molar_correction_factor
~ See T6 for Molar correction factors ~
-Calculate amount of water to add in each pooling well.
Water volume to add = (50 µL *Molar_correction_factor) - Template volume to add
Prepare a pooling PCR plate, labeled.
Add the water and template quantities for each well. Change the pipette tip every time when handling PCR products.
2h
Label Eppendorf 2 mL tubes to hold to final amplicon pools. Include the extraction number, the genus of the siphonophore, "GC DNA pooled", and your initials.
Using a multichannel pipette of 20-200µl, proceed to pool the amplicons by sample. If the volumes do not fit in a row on the pooling PCR plate, you can make 2 semi-pools, one combining V9:V5-V7S:V3, and one combining V7:V7p+V8:V5-V7L.
Safety information
Be very careful on this step, since mistakes during pooling will result in having to re-do the whole protocol for the samples affected.
Using a single-channel 20-200µl pipette, transfer the pooled amplicons to the Eppendorf tubes. Vortex and close caps.
Store the amplicon pools in a -20 °C freezer.
10m