Jun 19, 2024
Detection of Bordetella holmesii and Bordetella bronchiseptica Using the ABI 7500 Real-time PCR System
- Martin Cheung1,
- Tracy Lee1,
- Robert B Azana1,
- Loretta Janz1,
- Natalie Prystajecky1,2,
- Linda Hoang1,2
- 1BCCDC Public Health Laboratory, Provincial Health Services Authority;
- 2UBC Department of Pathology and Laboratory Medicine
Protocol Citation: Martin Cheung, Tracy Lee, Robert B Azana, Loretta Janz, Natalie Prystajecky, Linda Hoang 2024. Detection of Bordetella holmesii and Bordetella bronchiseptica Using the ABI 7500 Real-time PCR System. protocols.io https://dx.doi.org/10.17504/protocols.io.36wgqn7zygk5/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 09, 2024
Last Modified: June 19, 2024
Protocol Integer ID: 99542
Abstract
This procedure provides instructions for how to perform qualitative PCR (qPCR) for the detection of the hIS1001 insertion sequence of Bordetella holmesii and the bfrZ gene of Bordetella bronchiseptica from appropriate direct specimens. This test is intended to be used as a secondary assay to differentiate B. pertussis (IS481 positive) from B. holmesii.
Guidelines
Perform all manipulations of samples and DNA in a genomic level PCR laboratory. Prepare all PCR master mixes in a Reagent Preparation Clean Room.
Materials
Samples
IS481 Positive lysates from the primary detection assay for Bordetella pertussis and Bordetella parapertussis on the ABI 7500 FAST.
Reagents, Materials, and Equipment
| Reagents | Materials | Equipment | |
| Life Technolgies Fast Advanced master mix (#4444557) | Microcentrifuge tubes | Pipettes (various volumes) | |
| PCR grade water | pipette tips (various volumes) | Biological Safety Cabinet Class 2 Type A/B3 | |
| IDTE 1x TE Buffer pH 8.0 | ABI 96-well optical plate | Fully equipped reagent and genomic preparation clean rooms | |
| hIS1001 primers and probe (B. holmesii) | optical plate adhesive film | Applied Biosystems 7500 Real-Time Analyzer | |
| bfrZ primers and probe (B. bronchiseptica) | adhesive film applicator | ||
| Instagene Matrix (BioRad) | tube racks | ||
| bfrZ-hIS1001 gBlock |
Primers
| Primer ID | Sequence | Product Size (bp) | Final Concentration (nM) | Target | Reference | |
| bfrZ-Qr (Bronch- R) | CCACCAAACGCAATGACCTG | 99 | 100 | bfrZ | Modified Jinnerot et al., 2015 | |
| bfrZ-Qf-mod (Bronch-F) | CGAATTGCGCCCATCCCATG | 100 | ||||
| BHIS41U20 (Holm-F) | GGCGACAGCGAGACAGAATC | 67 | 300 | hIS1001 | Tatti et al., 2011 | |
| BHIS91L17 (Holm-R) | GCCGCCTTGGCTCACTT | 300 |
Probes
| Probe ID | Sequence | Target | Dye/Quencher | Final Concentration (nM) | Reference | |
| bfrZ-Qp (Bronch- P) | TCGGGAAGGTGCAGCATGTCCTGGAAATA | bfrZ | FAM/ZEN | 100 | Jinnerot et al., 2015 | |
| BHIS62U28P (Holm-P) | CGTGCAGATAGGCTTTTAGCTTGAGCGC | hIS1001 | CY5/TAO | 150 | Tatti et al., 2011 |
Controls
| PCR Controls | Control Organism/Reagent | Comment | |
| bfrZ-hIS1001 gBlock | frozen aliquots of bfrZ and hIS1001 gblock diluted to 4.2 x 10^2 copies/ul | See below for sequence | |
| NTC: No Template Control | PCR grade water | Use the same lot of water as was used in the preparation of the master mix. Tests for the sterility of the master mix reagents. |
Note: Extraction controls are not required as sample lysate has already been run with these controls on the primary Pertussis PCR.
bfrZ-hIS1001 gBlock sequence (PCR gBlock)
CCGGTGGCGACAGCGAGACAGAATCCCGTGCAGATAGGCTTTTAGCTTGAGCGCGAAGTGAGCCAAGGCGGCGATGCCGCTGCCCTGAGCCTGGGAAGACCCACTGGCCGCCGCCACCAAACGCAATGACCTGAACCTGTATTTCCAGGACATGCTGCACCTTCCCGACGAGAAGACGCGCCTGCTGCTGGCCATGGGATGGGCGCAATTCGACAGCCGCCCGCCCGACAA
Reconstitute the gBlock as per the manufacturers instructions, and then dilute to desired working concentration (copies/ul) using 1 part Carrier RNA to 5 parts IDTE buffer.
Note: dilutions of gBlock are best kept stored in 0.5 mL lo-bind PCR tubes at -20 °C
Safety warnings
Method Limitations:
1. Coinfections of B. pertussis with B. holmesii will be called B. holmesii positive with the use of this assay in combination with the IS481 assay.
2. High Ct IS481 positive and negative for hIS1001 may be false negative for B. holmesii.
Procedure A: Preparing 20X PCR Master Mix
Procedure A: Preparing 20X PCR Master Mix
All primer and probe sequences are listed in the materials section of this protocol.
Order all necessary primers and probes; if received lyophilized reconstitute as per the manufacturers instructions before making the desired stock dilutions.
Turn on the Biological Safety Cabinet (BSC) in the Reagent Preparation Clean Room. Allow the BSC to stabilize, ensure it is functioning as expected, and decontaminate prior to using.
Inside the BSC, prepare 20X HOLM mix as per the following table. Prepare 1 mL total volume for each batch.
| Primer/Probe | Stock Concentration (uM) | Final PCR Concentration (nM) | Volume (uL) for 1000 reactions | |
| bfrZ-Qp (FAM) (Bronch-P) | 100 | 100 | 20 | |
| bfrZ-Qf-mod (Bronch-F) | 100 | 100 | 20 | |
| bfrZ-Qr (Bronch-R) | 100 | 100 | 20 | |
| BHIS62U28P (CY5) (Holm-P) | 100 | 150 | 30 | |
| BHIS41U20 (Holm-F) | 100 | 300 | 60 | |
| BHIS91L17 (Holm-R) | 100 | 300 | 60 | |
| IDTE Volume | 790 | |||
| Final Volume | 1000 |
Pipette the 20X Holm mix into 100 µL aliquots. Label each aliquot with 20X Holm Mix.
Store the 20X Holm aliquots in 4 °C fridge for short-term storage
and a -20 °C freezer in side a Reagent Preparation Clean Room for long-term storage.
Procedure B: Setting up the Real-Time PCR Reactions
Procedure B: Setting up the Real-Time PCR Reactions
Turn on the BSC in the Reagent Preparation Clean Room. Allow the BSC to stabilize, and decontaminate before use.
Remove an aliquot of the 20X Holm Mix from its place of storage.
If frozen let thaw completely before using.
When the 20X mix is completely thawed vortex briefly and spin down.
In a 1.7 mL microcentrifuge tube prepare the master mix cocktail as follows:
| Reagent | 1x reaction (uL) | |
| PCR Grade Water | 4 | |
| Fast Advanced Master Mix | 10 | |
| 20X Holm Mix | 1 |
Make enough master mix to account for the total number of reactions on your PCR plate + 15% to account for pipetting errors.
Vortex and briefly spin down the master mix before pipetting
Aliquot 15 µL of master mix into the required number of wells of a 96-well optical plate
Seal the 96-well optical plate with adhesive film using a seal applicator and place in a clear plastic bag for transport to a Genomic PCR Room.
Turn on the BSC in a Genomic PCR Room. Allow the BSC to stabilize, ensure it is functioning as expected and decontaminate before use.
Pipette samples from the sample extract plate and controls in the following order:
1. NTC: 5 µL of the same lot PCR grade water that was used to prepare the master mix.
2. Patient Samples: 5 µL of each sample extract from the extract plate
3. HOLM/BRONCH (bfrZ-hIS1001) gBlock: 5 µL
Apply an optical adhesive film to the plate using a plate seal applicator, taking care to seal the plate edges and avoid touching the top of the film.
Note: any fingerprints or residue on the film will alter the optical readings
| If | Then | |
| Plate will not be run immediately | Store plate in a 4C fridge until ready to perform PCR | |
| Plate will be run immediately | Proceed to load and run the plate on the ABI 7500 |
On the ABI 7500 instrument create a new experiment for the current run as per the ABI 7500 User Manual
Check that the following reaction conditions are correctly programmed:
| Temperature (°C) | Time | Number of Cycles | |
| 50 | 2 min | Hold | |
| 95 | 20 sec | Hold | |
| 95 | 3 sec | 40 | |
| 60 | 30 sec |
Either input your samples and controls into the current run file manually or import the data from a saved run file on a memory stick.
Ensure all wells are assigned correctly on the run file as per the pipetting of the sample plate.
Check that each sample well has the correct target, dye, and quencher assigned to it.
| Target | Dye | Quencher | |
| bfrZ (Bronch) | FAM | None | |
| hIS1001 (Holm) | CY5 | None |
Load the plate onto the ABI 7500 instrument.
Save the run on the instrument and start the run as per the ABI 7500 user manual.
Procedure C: 7500 FAST Run Analysis
Procedure C: 7500 FAST Run Analysis
Ensure the run has completed successfully. Click OK.
Select the Analysis tab after the run has completed, and then select the "Amplification Plot" tab.
To view all samples, click on the small square at the top left of the plate map to select all the wells on the plate at once. Curves should appear on the graph.
Under Options (at the bottom of the screen), select "hIS1001" (B. holmesii)
Unclick "Auto Threshold" and enter a manual value of 0.1 in the box. Click Auto Baseline.
Repeat steps 25 and 26 but for the target "bfrZ" (B. bronchiseptica)
Click on the "Analyze" button.
Ensure that under "Plot Settings" the "Delta Rn vs. Cycle" option is selected and plot colour is set to "target".
View the results of all run controls and ensure they have produced acceptable values before proceeding with clinical sample analysis.
Examine the results for hIS1001 and bfrZ targets for each clinical sample.
Note: All Ct values must be confirmed by viewing the amplification curve and multicomponent plot for appropriate graphing of positive result.
See the Applied Biosystems 7500 Fast Real-Time PCR System Presence/Absence Experiments manual at:
Interpretation Table
POS: Ct < or = 35
NEG: Ct = Undetermined
If Ct >35 sample is indeterminate and may require retesting or recollection.
| IS481 | pIS1001 | hIS1001 | bfrZ | Interpretation | |
| POS | NEG | NEG | NEG | B. pertussis Positive | |
| POS/NEG | NEG | POS | NEG | B. holmesii Positive | |
| POS/NEG | POS/NEG | NEG | POS | B. bronchiseptica Positive | |
| NEG | POS | NEG | NEG | B. parapertussis Positive |
Protocol references
1. Jinnerot, T., Malm, K., Eriksson, E., & Wensman, J. J. (2015). Development of a Taqman Real-Time PCR Assay for Detection of Bordetella bronchiseptica. Veterinary Sciences: Research and Reviews, 14-20.
2. Tatti, K. M., Sparks, K. N., Boney, K. O., & Tondella, M. L. (2011). Novel Multitarget Real-Time PCR Assay for Rapid Detection of Bordetella Species in Clinical Specimens. Journal of Clinical Microbiology, 4059-4066.