Oct 28, 2020
Version 2
DAb-seq: Single-Cell DNA and Antibody Sequencing V.2
- Benjamin Demaree1,2,
- Cyrille Delley1,
- Harish N. Vasudevan3,
- Cheryl A.C. Peretz4,
- David Ruff5,
- Catherine C. Smith4,
- Adam R Abate1,2,6
- 1Department of Bioengineering and Therapeutic Sciences, University of California, San Francisco, San Francisco;
- 2UC Berkeley-UCSF Graduate Program in Bioengineering, University of California, San Francisco;
- 3Department of Radiation Oncology, University of California, San Francisco;
- 4Division of Hematology/Oncology, Department of Medicine, University of California, San Francisco;
- 5Mission Bio, Inc.;
- 6Chan Zuckerberg Biohub
- Benjamin Demaree: Equal contribution;
- Cyrille Delley: Equal contribution;
- Adam R Abate: Corresponding Author;
Protocol Citation: Benjamin Demaree, Cyrille Delley, Harish N. Vasudevan, Cheryl A.C. Peretz, David Ruff, Catherine C. Smith, Adam R Abate 2020. DAb-seq: Single-Cell DNA and Antibody Sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.bn4ymgxwVersion created by Benjamin Demaree
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: October 28, 2020
Last Modified: October 28, 2020
Protocol Integer ID: 43896
Keywords: single-cell, DNA sequencing, acute myeloid leukemia, droplet microfluidics, multiomics
Abstract
Studies of acute myeloid leukemia rely on DNA sequencing and immunophenotyping by flow cytometry as primary tools for disease characterization. However, leukemia tumor heterogeneity complicates integration of DNA variants and immunophenotypes from separate measurements. Here we introduce DAb-seq, a novel technology for simultaneous capture of DNA genotype and cell surface phenotype from single cells at high throughput, enabling direct profiling of proteogenomic states in tens of thousands of cells. To demonstrate the approach, we analyze the disease of three patients with leukemia over multiple treatment timepoints and disease recurrences. We observe complex genotype-phenotype dynamics that illustrate the subtlety of the disease process and the degree of incongruity between blast cell genotype and phenotype in different clinical scenarios. Our results highlight the importance of combined single-cell DNA and protein measurements to fully characterize the heterogeneity of leukemia.
Graphical overview of the DAb-seq protocol.
Guidelines
This protocol is compatible with Mission Bio V1 chemistry only.
Materials
Antibody conjugation reagents and supplies
- D-PBS
- Monoclonal antibodies (various suppliers)
- DBCO-PEG5-NHS Ester linker (Click Chemistry Tools, cat. no. A102P)
- Amicon 50 kDa filter (Millipore Sigma, cat. no. UFC505024)
- Agilent Bioanalyzer Protein 230 Kit
DAb-seq workflow reagents and supplies
- PBS-F (D-PBS + 5% FBS)
- 5 mL DNA LoBind tubes (Eppendorf, cat. no. 0030108310)
- Human TruStain FcX (BioLegend, cat. no. 422301)
- Dextran sulfate (Research Products International, cat. no. D20020)
- Salmon sperm DNA (Invitrogen, cat. no. 15632011)
- Mission Bio Tapestri instrument and AML kit
- Ampure XP beads (Beckman Coulter, cat. no. A63881)
- Dynabeads MyOne Streptavidin C1 beads (Thermo Fisher, cat. no. 65001)
- Agilent Bioanalyzer High Sensitivity DNA Kit
- Sequencing kit (Illumina)
Conjugation of antibodies to oligonucleotide barcodes
Conjugation of antibodies to oligonucleotide barcodes
1d
1d
Resuspend each monoclonal antibody to 100 µg in 100 µL PBS.
Note
Antibody must be ordered in protein-free, azide-free buffer, preferably plain PBS. Resuspended from lyophilized stock with trace amounts of trehalose (e.g. from R&D Systems) is also acceptable. For a list of antibodies used in the DAb-seq publication, see Supplemental Table 2 attachment.
Prepare 25 millimolar (mM) DBCO/PEG/NHS linker in DMSO. After adding DMSO, vortex at Room temperature for 00:10:00 to allow linker to dissolve completely.
Note
For long-term storage, aliquot DBCO linker in 5 µL volumes and store at -20 °C .
10m
Dilute DBCO linker to2.5 millimolar (mM) in water.
To each 100 uL antibody solution, add 1.07 µL of 2.5 mM DBCO linker. Pipet up and down to mix.
Incubate linker/antibody solution for 02:00:00 at Room temperature .
2h
Add 400 µL PBS to linker/antibody solution and transfer to 50 kDA Amicon filter.
Centrifuge 14000 x g, 00:10:00 . Discard flow-through.
Add 180 µL PBS to filter and invert filter in new collection tube. Centrifuge 1500 x g, 00:05:00 to elute.
Resuspend lyophilized oligonucleotide to 200 micromolar (µM) in PBS.
Note
Oligos must have 5’ azide group (IDT code: /5AzideN/) and be HPLC-purified. For full oligo sequence, including barcodes, see Supplemental Table 2 attachment.
Add 6.67 µL oligo to the approximately 200 µL of filtered antibody solution.
Incubate at 4 °C Overnight .
Note
16-20 h is an acceptable incubation time.
2h
Add 300 µL PBS to antibody-oligo conjugate and transfer to 50 kDa Amicon filter.
Centrifuge 14000 x g, 00:10:00 . Discard flow-through.
Repeat Step 13 two additional times, adding 500 µL PBS for each wash. This is a total of three washes.
Add 30 µL PBS to filter and invert filter in new collection tube. Centrifuge 1500 x g, 00:05:00 to elute.
Collect ~50 uL eluant and store in Protein LoBind tube at 4 °C .
Verify conjugation using a Bioanalyzer Protein 230 kit or equivalent gel electrophoretic assay. A representative Bioanalyzer Protein 230 trace is shown below. A peak representing the unconjugated antibody is visible at ~155 kDa. Larger peaks represent antibodies conjugated to one, two, or more oligos.
Representative Bioanalyzer Protein 230 trace for oligo-antibody conjugate. Non-denaturing conditions were used in this run.
Staining cells
Staining cells
1d
1d
Collect cells from culture or thaw from frozen according to cell-specific protocols. Resuspend cells in 5-10 mL PBS-F (D-PBS + 5% FBS) and count. It is highly recommended to measure cell viability with trypan blue or other exclusion assay.
Note
Cells should be >90% viable before staining to ensure minimal cell loss during the washing steps.
Spin down 2 million cells in a 15 mL DNA LoBind tube for 400 x g, 00:04:00 . Aspirate the supernatant and resuspend the cell pellet in 180 µL PBS-F.
Note
It is helpful to grate the tube gently against the TC hood to loosen the cell pellet prior to the addition of buffer.
Add 10 µL BioLegend Human TruStain FcX blocking solution, 4 µL of a 1 % (m/v) dextran sulfate solution, and 4 µL of 10 mg/mL salmon sperm DNA. Pipet gently to mix.
Incubate 00:10:00 On ice .
10m
Add 0.5 µg of each antibody-oligo conjugate and incubate 00:30:00 On ice .
30m
Perform five washes to remove excess unbound antibody. For each wash, add 5 mL PBS-F to the tube and centrifuge 400 x g, 00:04:00 .
After final wash, resuspend cells in Mission Bio Cell Buffer at a final concentration of 3M cells/mL.
Cell encapsulation and barcoding on the Tapestri instrument
Cell encapsulation and barcoding on the Tapestri instrument
1d
1d
Follow cell encapsulation and barcoding procedure as described in the attached Mission Bio document: "Tapestri Single-Cell DNA AML User Guide".
Note
Follow sections "Encapsulate Cells" (page 18) through "UV Treatment and Targeted PCR Amplification" (page 31). The DAb-seq protocol for these sections are unchanged from the conventional DNA-only workflow.
Cleanup barcoded DNA and antibody products
Cleanup barcoded DNA and antibody products
Perform Steps 6.1 through 6.7 in the attached Mission Bio protocol. DO NOT discard the Ampure XP supernatant in Step 6.8, as this contains the short antibody tags. Instead, for each tube, transfer the supernatant to a new 1.5 mL DNA LoBind tube.
Finish DNA library cleanup as described in the Mission Bio protocol. Elute in 30 uL water and use a Qubit hsDNA assay to measure the concentration of barcoded DNA product in each tube. Transfer the DNA product to PCR tubes and store at -20 °C prior to library PCR.
Expected result
Typical concentrations are between 0.5 and 2.0 ng/μl.
For antibody tag cleanup, add biotinylated capture oligonucleotide to the tube supernatants from Step 26 to a final concentration of 0.6 micromolar (µM) .
Note
The capture probe sequence is /5Biosg/GGCTTGTTGTGATTCGACGA/3C6/, using IDT codes.
Heat the supernatant-probe solution to 95 °C for 00:05:00 to denature the PCR product, then snap cool on ice for probe hybridization. Allow tubes to cool for 00:05:00 on ice.
10m
For each sample tube, wash 10 µL of magnetic streptavidin beads two times in 1 mL D-PBS, allowing beads to bind to the magnet between washes. Resuspend beads in 10 µL D-PBS and add to each tube. Pipet to mix.
Incubate tubes 00:15:00 at Room temperature with rotation to allow streptavidin-biotin binding.
15m
Place the tubes on a magnet and allow beads to separate.
Wash beads two times in 1 mL D-PBS and resuspend in 30 μL water. Transfer the bead solutions to PCR tubes and store at -20 °C prior to library PCR.
Library preparation PCR
Library preparation PCR
Prepare50 µL library PCR reactions for each tube, and for each of the DNA and antibody tag libraries:
DNA panel libraries:
- 25 µL Mission Bio Barcoding Mix
- 5 µL P5 primer (4 micromolar (µM) )
- 5 µL P7 primer (4 micromolar (µM) ) - DNA panel specific
- 4 ng of barcoded DNA product in 15 µL water
Antibody tag libraries:
- 25 µL Mission Bio Barcoding Mix
- 5 µL P5 primer (4 micromolar (µM) )
- 5 µL P7 primer (4 micromolar (µM) ) - Antibody tag specific
- 15 µL bead-bound antibody tag product
Note
Ensure all combinations of DNA panel and antibody tag libraries have unique P5 and P7 barcodes. The DNA panel and antibody tag libraries have different P7 primers, which are listed in the attachment "Supplementary Table 6: Library preparation primer sequences".
Amplify the DNA panel and antibody tag libraries according to the following protocol, using 10 cycles for the DNA panel and 20 cycles for the antibody tags.
Library preparation PCR protocol.
Library cleanup and quantification
Library cleanup and quantification
Perform library cleanup for both the DNA panel and antibody tag libraries as described in the attached Mission Bio document (Steps 7.10 to 7.25): "Tapestri Single-Cell DNA AML User Guide". In Step 7.13, use 35 µL Ampure XP beads instead of 31.5 µL .
Quantify the concentration of DNA panel and antibody tag libraries using the Qubit hsDNA assay.
Expected result
Typical concentrations are between 5 and 20 ng/uL.
Run 1 ng of each library on a Bioanalyzer High-Sensitivity DNA chip or comparable TapeStation assay.
Expected result
All libraries should be free of primer-dimers (<80 bp). The antibody tag library fragment should appear as a sharp peak around 250 bp. For the DNA panel libraries, the fragments should be distributed between 400 and 500 bp.
Representative DNA panel library, run on a Bioanalyzer High-Sensitivity DNA chip.
Representative antibody tag library, run on a Bioanalyzer High-Sensitivity DNA chip.
Next-generation sequencing
Next-generation sequencing
Pool the libraries for sequencing, the protocol for which varies depending on Illumina sequencing platform. It is most cost-effective to sequence the DNA panel and antibody libraries using separate kits, as the antibody tags require fewer cycles (~80 cycles for antibody tags vs. 300 for DNA panel). A custom Read 1 primer is required in both libraries (see note below).
The amount of reads to allot for each library depends on the number of cells sequenced and number of targets in the DNA and antibody panels. As a rule of thumb, allotting 100X coverage for each DNA and antibody target per cell should yield sufficient depth for genotyping and antibody tag counting.
Note
Mission Bio V1 chemistry requires a custom Read 1 primer with the following sequence: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG. It should be HPLC purified.
Data processing
Data processing
The raw FASTQ files are analyzed by the DAb-seq pipeline available at: https://github.com/AbateLab/DAb-seq. See the README for detailed instructions on setting up and running the pipeline.