Nov 12, 2023
Version 1
CRISPR knock-in (endogenous tagging) V.1
- 1University of California, San Diego
Protocol Citation: Leonardo A Parra-Rivas 2023. CRISPR knock-in (endogenous tagging). protocols.io https://dx.doi.org/10.17504/protocols.io.e6nvwdmqwlmk/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 12, 2023
Last Modified: November 12, 2023
Protocol Integer ID: 90814
Abstract
CRISPR knock-in (endogenous tagging)
Plasmid construction
Plasmid construction
For the C-terminus knock-in experiment, the sgRNAs and the homology-independent donor templates were generated
following strategies similar to those described previously
CITATION
Briefly, the coding sequence of SNCA1 –the gene encoding α-syn at exon 6 was targeted by a sgRNA, and the oScarlet tag (a variant of mScarlet that is engineered to reduce
aggregation; a gift from Karl Deisseroth, Addgene plasmid #137135) was knocked
in using a homology-independent mechanism .
The donor sequence was designed following the SATI knock-in vector
with slight modifications for the intron knock-in experiment. Briefly, the
following sequences were directly conjugated as a donor tag; SNCA1 intron 4
(only the sequence after the gRNA targeting site), SNCA1 exon 5 (with wild type
or mutation sequences; S129A or S129D), SNCA1 exon 6 (coding site until stop
codon), 3X GGGGS linker, oScarlet (without a start codon and with a stop codon
at the end), and SNCA1 3’ UTR. The SNCA1 intron 4 was targeted by a
sgRNA (TTCTAAGTGTACCAAACCAC),
and the donor tag was homology-independently knocked in. The plasmid PX552
(RRID:Addgene_60958) (a
gift from Feng Zhang) was digested with a NotI restriction enzyme (New England
Biolabs, Cat#R3189L) and used as a plasmid backbone.
Oligonucleotides were ordered from Sigma. The genomic sequence of SNCA1
was partially synthesized by Twist Bioscience, and for the rest, it was PCR
amplified from a purified genome of a C57BL/6J mouse. DNA fragments were
ligated together using the In-Fusion Snap Assembly Master Mix (Takara, Cat# 638947) or DNA Ligation Kit Mighty Mix (Takara, Cat#6023). The sgRNA sequence for knock-in is listed in the supplemental materials. The AAV-SpCas9 plasmid PX551 RRID:Addgene_60957 (a gift from Feng Zhang) was modified by removing the HA tag.
Adeno-associated virus (AAV) production, neuronal transduction, and quantification of synapses
Adeno-associated virus (AAV) production, neuronal transduction, and quantification of synapses
Small-scale AAV cell lysates were produced
using the AAVpro Purification Kit (All Serotypes) (Takara, Cat# 6666) with slight
modifications. Briefly, HEK293T cells (RRID:CVCL_0063)
were triple transfected with the AAV targeting plasmid, helper plasmid (Agilent Technologies, Cat # 240071), and serotype PHP.S plasmid pUCmini-iCAP-PHP.eB (RRID:Addgene_103005)(a gift from Viviana Gradinaru) with PEI Max (Polysciences,
Cat#24765).
The medium was changed the next day of transfection, and cells were
incubated for 3 days after transfection. HEK cells were then collected and
lysed with the AAV Extraction Solution A plus.
The extracted solution was
centrifuged at 10,000 x g for 10 min to remove debris and mixed with Extraction
Solution B. This small-scale AAV solution was stored at -80 until use. For
viral transduction, hippocampal
neurons were plated at 60,000 cells/cm2 density and infected 4 hours
later with 10ul of the AAVs expressing SpCas9 and sgRNAs/donor.
The media was replaced 2 days after infection. Before imaging or genomic analysis, the
transduced neurons were cultured to maturity (DIV-17-DIV-21).
For quantification of the knock-in α-syn:o-Scarlet fluorescence at synapses, images
were first background-corrected, small ROIs were manually placed over ~20-30
synapses on each image, and average intensities were calculated – all using
dropdown menus in MetaMorph Microscopy Automation and Image Analysis Software (RRID:SCR_002368)(https://www.moleculardevices.com/products/cellular-imaging-systems/acquisition-and-analysis-software/metamorph-microscopy#gref). The resulting datasets were
statistically analyzed using GraphPad Prism [(RRID:SCR_002798)
http://www.graphpad.com/].
Citations
Step 1
Ogawa Y, Rasband MN. Endogenously expressed Ranbp2 is not at the axon initial segment.
https://doi.org/10.1242/jcs.256180