Protocol Citation: DNA Pipelines R&D, Benjamin Farr, Diana Rajan, Emma Dawson, Lesley Shirley, Michael Quail, Naomi Park, Nicholas Redshaw, Iraad F Bronner, Louise Aigrain, Scott Goodwin, Scott Thurston, Stefanie Lensing, James Bonfield, Keith James, Nicholas Salmon, Charlotte Beaver, Rachel Nelson, David K. Jackson, Alex Alderton, Ian Johnston 2022. COVID-19 ARTIC v4.1 Illumina library construction and sequencing protocol - tailed method. protocols.io https://dx.doi.org/10.17504/protocols.io.j8nlk4b36g5r/v2Version created by Diana Rajan
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
This SOP describes the procedure for generating cDNA from SARS-CoV-2 viral nucleic acid extracts and subsequently producing 400nt amplicons tiling the viral genome using V4.1 nCov-2019 primers (ARTIC) in multiplex PCR. Illumina-compatible sequencing libraries are then made directly from these amplicons in a second PCR step, obviating the need for conventional library preparation. The products of these PCRs are then equivolume pooled and quantitated, prior to sequencing on the Illumina NovaSeq.
It is an adaptation of the COVID-19 ARTIC v3 amplicon protocol which can be found here:
It is vital cDNA setup is performed in a laboratory in which post-PCR COVID-19 amplicons are not present, to minimise any risk of sample contamination.
Note: Throughout the protocol we have indicated the liquid handling automation in use at Sanger for specific parts of the process. However, these steps could be performed on alternative liquid handlers or manually.
LunaScript RT SuperMix KitNew England BiolabsCatalog #
E3010L
Materials, Step 3
cDNA generation
cDNA generation
Important! This step must be performed in a RNase free, pre-PCR environment in which post PCR COVID-19 amplicons are not present, to minimise risk of sample contamination.
Decontaminate bench surfaces, pipettes and gloves with RNase ZAP before starting work. Keep reagents and samples chilled throughout the process.
Defrost PCR plate containing 10 µL extracted RNA On ice.
LunaScript RT SuperMix KitNew England BiolabsCatalog #
E3010L
Prepare RT mastermix in a dedicated UV treated pre-PCR area to minimise contamination risk.
RT Master Mix
Vol / RXN (µL)
Vol/384 RXN (µL) inc. excess
LunaScript Super Mix
4
1843
Nuclease-free water
6
2765
Total
10
4608
Mix thoroughly by vortexing.
Use the SPT Labtech Dragonfly Discovery to dispense 10 µLof RT mastermix into the PCR plate containing 10 µL extracted RNA.
Seal plate and place on a BioShake plate shaker for 30 seconds at 1500rpm to mix. Briefly centrifuge plate.
Place plate on a thermocycler and run the following program:
Temperature
Time
25°C
2 minutes
55°C
20 minutes
95°C
1 minute
4°C
∞
Lid temp: Tracking
PAUSE POINT cDNA can be stored at 4°C (same day) or -20°C (up to a week).
cDNA amplification (PCR1)
cDNA amplification (PCR1)
NEB Q5® Hot Start High-Fidelity 2X Master MixNew England BiolabsCatalog #M0494L
Prepare the following mastermixes:
Weighted PCR Primer Pool 1 Master Mix
Vol/PCR RXN (µl)
Vol/384 plate (µl) inc. excess
Q5 Hotstart 2X Master Mix
12.5
5760
Primer Pool 1 (mean 102nM)
3.6
1659
Nuclease-free water
2.9
1336
Total
19
8755
Weighted PCR Primer Pool 2 Master Mix
Vol/PCR RXN (µl)
Vol/384 plate (µl) inc. excess
Q5 Hotstart 2X Master Mix
12.5
5760
Primer Pool 2 (mean 102nM)
3.6
1659
Nuclease-free water
2.9
1336
Total
19
8755
Note
The equivolume primer pools used in the standard protocol are of 10 micromolar (µM)cumulative concentration, therefore each of the 98 primers in each pool is at 102 nanomolar (nM)in the pool and at 15 nanomolar (nM)in the final reaction. With the rebalanced primer pools, for equivalency we dilute them such that the average primer concentration is 102 nanomolar (nM), and therefore the average concentration of each primer in the final reaction is also 15 nanomolar (nM).
Mix thoroughly by vortexing.
Use the SPT Labtech Dragonfly Discovery to dispense 19 µLmastermix per well into 2x384 well plates.
Use the Agilent Bravo to add 6 µL of cDNA template to each primer pool reaction and mix.
Note
It is recommended to use filtered tips for this transfer to reduce risk of cross sample contamination via aerosolisation.
Heat seal and place the plates onto a thermocycler and run the following program.
Important! Heat seal to minimise evaporation.
Note: Amplification should ideally be performed in a different lab to minimise the risk of contaminating other samples.
Expected result
Critical step: We strongly recommend performing a gradient PCR to determine the optimal annealing temperature for your thermocycler. Subtle differences in thermocycler calibration can result in specific amplicons dropping out. Reducing our annealing temperature from 65°C to 63°C for identical cDNA input recovered amplicon #64 as shown in the image below.
Step
Temperature
Time
1
98°C
30 seconds
2
95°C
15 seconds
3
63°C
5 minutes
4
Repeat steps 2 & 3 for a total of 35 cycles
5
4°C
∞
PAUSE POINT Amplified cDNA can be stored at 4°C (overnight) or -20°C (up to a week).
Library construction from amplified cDNA (PCR2)
Library construction from amplified cDNA (PCR2)
Note
Illumina-compatible libraries are generated from a small aliquot of the amplified cDNA using KAPA HiFi HotStart ReadyMix, unique dual indexed (UDI) barcoding primers and pools of tailed versions of the primers used for the cDNA amplification.
Note
The tailed primer pools used in this stage correspond to those used in the cDNA amplification stage, with the following modifications:
All primers are used at the same concentration in the pools; from the individual 500 micromolar (µM) primer stocks we create pool 1 and pool 2 stocks with each of the 98 primers in each pool @ 5 micromolar (µM)
The penultimate DNA base at the 3' end of the primer is replaced with its 2'-O-Methyl RNA equivalent (this reduces the formation of primer-dimers). Typically we use this modification for tailed multiplex PCR in the first (non barcoding) PCR. The use of non 2'-O-Methyl RNA modified tailed primers for use as detailed within this protocol is undergoing evaluation.
ACACTCTTTCCCTACACGACGCTCTTCCGATCT appended to the 5' end of all LEFT primers (this is the Illumina Multiplexing Read 1 sequence)
TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT appended to the 5' end of all RIGHT primers (this is the Illumina Multiplexing Read 2 sequence)
Both UDI barcoding primers and tailed primer pools are predispensed to plates and frozen down in advance for ease of processing. Starting from stock plates of the UDI barcoding primers (5 µL at10 micromolar (µM)), we dilute the UDIs and add the tail primers to create plates with a volume of 6.25 µL per well, with i5 and i7 indexing primers at 2 micromolar (µM)each and the tail primers at 4 nanomolar (nM).
Defrost two UDI tag plates (one containing each tail primer pool), both of which should contain the same i5 and i7 barcodes per well.
Use the SPT Labtech Mosquito LV to transfer 100 nl of amplified pool 1 cDNA into the UDI tag plate containing the pool 1 tailed primers and 100 nlof amplified pool 2 cDNA into the UDI tag plate containing the pool 2 tailed primers, maintaining the same well locations throughout. Immediately proceed to the next step.
Use the SPT Labtech Dragonfly Discovery to dispense 6.25 µL of Kapa HiFi 2X Mastermix into each well of both UDI tag plates, and place On iceimmediately. The dispense is sufficient to mix all the reagents.
Note
The final PCR volume is 12.5 µL
The final concentration of each tailing primer in the reaction will be 2 nanomolar (nM)
The final concentration of each barcoding primer in the reaction will be 1 micromolar (µM)
The amplified cDNA template forms 0.8 % (v/v) of the total PCR volume
Heat seal and place the two plates onto a thermocycler and run the following program.
Important! Heat seal to minimise evaporation.
Step
Temperature
Time
1
95°C
5 minutes
2
98°C
30 seconds
3
61°C
20 minutes
4
72°C
2 minutes
Repeat steps 2-4 once more
5
98°C
30 seconds
6
65°C
30 seconds
7
72°C
2 minutes
Repeat steps 5-7 six more times
8
72°C
5 minutes
9
4°C
∞
Note
The long annealing times of the first two cycles of PCR ensure efficient annealing of the tailed primers to their targets in the amplified cDNA (and therefore incorporation of the tail sequences) in spite of their very low concentration in the PCR. In the following seven cycles of PCR the much shorter annealing time and increased annealing temperature make the annealing of the tailed primers inefficient, therefore only the UDI barcoding primers participate in the PCR. This ensures that the vast majority of products formed at the end of the PCR are of full length.
PAUSE POINT Amplified cDNA can be stored at 4°C (overnight) or -20°C (up to a week).
Construction of equivolume pool
Construction of equivolume pool
In a post-PCR lab, use the Agilent Bravo to combine and mix 5 µL of pool 1 and pool 2 PCR2 reactions per sample into one plate.
Use the Hamilton STAR to combine 3 µL of each sample to form an equivolume pool of 384 samples.
Equivolume pool SPRI bead cleanup
Equivolume pool SPRI bead cleanup
Allow AMPure XP beads to equilibrate to room temperature (~30 minutes). Ensure solution is homogenous prior to use, mixing gently by inversion.
The Hamilton STAR will perform a 0.8X SPRI clean-up and elute the final pool in 1ml elution buffer as follows:
Add 0.8X volume of SPRI beads per pool tube, mix well by pipetting.
Incubate for 00:06:00 at Room temperature.
6m
Transfer the tube to a magnet, allow 00:04:00for the beads to form a pellet.
4m
Carefully remove and discard the supernatant, taking care not to disturb the bead pellet.
Wash the beads with 500 µL 75% ethanol for 00:00:15 then carefully remove ethanol and discard.
(First wash)
15s
Wash the beads with 500 µL 75% ethanol for 00:00:15 then carefully remove ethanol and discard.
(Second wash)
15s
Wash the beads with 500 µL 75% ethanol for 00:00:15 then carefully remove ethanol and discard.
(Third wash)
15s
Allow beads to dry for 00:05:00.
Remove tube from magnet and resuspend beads in 200 µL elution buffer, mix well by pipetting.
Incubate for 00:03:00 at Room temperature
Transfer tube to magnet, allow 00:05:00for the beads to form a pellet.
Carefully transfer supernatant into a new tube, taking care not to disturb the bead pellet.
Equivolume pool quantification
Equivolume pool quantification
Note
Equivolume pools may be quantified by qPCR, Agilent Bioanalyzer or Agilent TapeStation. Pools are then diluted to 1nM for sequencing.
qPCR
Quantify samples in triplicate using the KAPA Complete kit (Universal) for Illumina (KK4824) plus the KAPA Library Quantification Dilution Control (KK4906).
We use the SPT Labtech Mosquito LV to stamp library pools in triplicate into a 384 assay plate, and the Agilent Bravo to setup the qPCR reactions (1:1600 dilution).
qPCR is performed on the Roche LightCycler 480.
Agilent Bioanalyzer
Prepare 3 dilutions of the equivolume pool (1:10, 1:100, 1:1000). Run 1µl of each dilution in triplicate using the High Sensitivity DNA assay kit.
Confirm size distribution is as expected, check there is no primer-dimer present.
Agilent TapeStation
Run 1µl of each pool in triplicate using the Agilent D5000 ScreenTape System.
Confirm size distribution is as expected, check there is no primer-dimer present.
Set the region size range to 250-1500bp to quantify the pool.
Sequencing
Sequencing
Note
We currently sequence samples on an Illumina NovaSeq SP flow cell, using the XP workflow.
Alternatively, samples may be sequenced on an Illumina MiSeq using either v2 (500 cycle) or v3 (600 cycle) reagent kits. We have plexed up to 96 samples per run, this could be increased further depending on coverage requirements. Loading concentration will need to be optimised for MiSeq.
MiSeq run parameters: Read length 212 paired end + 16bp.
The following protocol is for loading a NovaSeq. We currently plex up to 384 samples per NovaSeq SP lane.
Steps must be performed within a given timeframe or data quality may be affected. Therefore, ensure the instrument is washed, waste containers emptied and ready for use prior to beginning step 46.
Defrost Illumina NovaSeq SP SBS and cluster reagent cartridges for 2-4 hours in a Room temperature water bath. Use a lint free tissue to blot any water present on the foil seal. Gently mix cartridges 10X by inversion. Gently tap the bottom of the cartridges on the bench to reduce air bubbles.
Defrost components DPX1, DPX2 and DPX3 from a NovaSeq XP-2 lane kit, then keep On ice
Bring flow cell to Room temperature (~10 minutes) prior to use.
18 µL of each 1 nanomolar (nM) pool is required per SP lane.
Denature pools by adding4 µL 0.2N NaOH per 18µl. Vortex briefly to mix.
Incubate at Room temperature for 00:08:00
Add 5 µL 400mM Tris-HCl, pH8.0 to each tube to neutralise the reaction. Vortex briefly to mix, then keep On ice.
Note
For the following steps, keep samples and mastermix On ice until ready for loading onto the flow cell.
Important! Use mastermix within 01:00:00of preparation for optimal sequencing performance.
Prepare ExAmp mastermix on ice:
ExAmp Master Mix
Volume per SP flow cell (µl)
DPX1
126
DPX2
18
DPX3
66
Total
210
Vortex00:00:30to mix, then centrifuge briefly up to 280 x g
Add 63 µL ExAmp mastermix to each denatured pool, mix well by pipetting.
Prepare the flowcell for sample loading by placing into the flow cell dock with the 2-lane manifold clamped in place.
Pipette 80 µL of library + ExAmp pool mix per manifold well. Wait for approximately 2 minutes to allow the solution to fill the lane.
Important! The sequencing run must be started within 00:30:00 of libraries being loaded onto the flow cell.
Unclamp the flow cell dock and discard the manifold. Load the flow cell onto the NovaSeq flow cell stage.