Aug 23, 2022
BICCN_DART-FISH
- 1University of California, San Diego
Protocol Citation: Chien-Ju Chen 2022. BICCN_DART-FISH. protocols.io https://dx.doi.org/10.17504/protocols.io.yxmvmnd45g3p/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: August 22, 2022
Last Modified: August 23, 2022
Protocol Integer ID: 69012
Abstract
This protocol documents DART-FISH procedures used to generate spatial transcriptomic data from human brain section for BICCN.
Materials
Reagents
| A | B | C | |
| material | vendor | catalog number | |
| UltraPure™ DEPC-treated Water 1L | ThermoFisher Scientific | 750023 | |
| Pierce™ 16% Formaldehyde (w/v), Methanol-free | ThermoFisher Scientific | 28908 | |
| PBS - Phosphate-Buffered Saline (10X) pH 7.4, RNase-free | ThermoFisher Scientific | AM9624 | |
| Ethyl alcohol, Pure | Sigma-Aldrich | E7023 | |
| Triton™ X-100 solution | Sigma-Aldrich | 93443 | |
| pepsin | Sigma-Aldrich | 10108057001 | |
| SuperScript™ IV Reverse Transcriptase | ThermoFisher Scientific | 18090010 | |
| Advantage® UltraPure dNTP Combination Kit | ClonTech | 639132 | |
| RNase inhibitor | Enzymatics | Y9240L | |
| Aminoallyl dUTP, 4 mM in TE buffer *UltraPure Grade*, Anaspec Inc | Anaspec (VWR) | AS-83203 | |
| BS(PEG)9 | ThermoFisher Scientific | 21582 | |
| UltraPure™ DNase/RNase-Free Distilled Water | TheroFischer Scientific | 10977023 | |
| Ribonuclease; RNAse H; Conc. 5,000 U/mL; 5,000 U; incl. 10X buffer | Fisher Scientific | 50305945 | |
| RNase Cocktail™ Enzyme Mix | Invitrogen | AM2288 | |
| Ampligase® Enzyme and Buffer | VWR | 76081-598 | |
| SSC (20X), RNase-free | ThermoFisher Scientific | AM9763 | |
| Formamide (Deionized) | ThermoFisher Scientific | AM9342 | |
| BSA, Molecular Biology Grade | NEB | B9000S | |
| Phi29 DNA polymerase (10U/uL) | ThermoFisher Scientific | EP0094 | |
| Acryloyl-X, SE in DMSO | ThermoFisher Scientific | A20770 | |
| Acrylamide/Bis-acrylamide, BioReagent, for molecular biology, 37:1 (ratio) | Sigma-Aldrich | A6050-100ML | |
| Ammonium persulfate | Sigma-Aldrich | A3678 | |
| TEMED | Fisher Scientific | 17919 | |
| gel slick solution | Lonza | 50640 | |
| TrueBlack lipofuscin autofluorescence quencher | Biotium | 23007 | |
| Silicone Isolators JTR20R-2.5 20mm DIA x 2.4 mm Depth 25 x 25mm OD No PSA | Grace Bio-Labs | 664304 | |
| Coverslips, Glass, 18mm dia. | Ted Pella | 260369 | |
| Azer Scientific cover glass, No. 1.5, 24 x 60 mm | Neta Scientific | Azer-1152460 |
Probes
| A | B | C | |
| oligo name | vendor | sequence | |
| 5N_dc10-Cy5_N9 | IDT | /5AmMC12/CCGATAGTCACGATCTGTGGNNNNNNNN*N | |
| dT20_dc7-488 | IDT | CATGGATTCGCGGAGGATCATTTTTTTTTTTTTTTTTTT*T | |
| FISSEQ_ppRCA primer | IDT | GATATCGGGAAGCTGA*A*G | |
| DARTFISH_anchor_Cy3 | IDT | /5Cy3/CTTCAGCTTCCCGATATCCG | |
| dcProbe7-AF488 | IDT | /5Alex488N/TGATCCTCCGCGAATCCATG | |
| dcProbe10-ATTO647N | IDT | /5ATTO647NN/CCACAGATCGTGACTATCGG | |
| dcProbe0-AF488 | IDT | /5Alex488N/TGTATCGCGCTCGATTGGCA | |
| dcProbe0-Cy3 | IDT | /5Cy3/CGTATCGGTAGTCGCAACGC | |
| dcProbe0-ATTO647N | IDT | /5ATTO647NN/ACGCTACGGAGTACGCCACT | |
| dcProbe1-AF488 | IDT | /5Alex488N/TCTTGCGTGCGATACGGAGT | |
| dcProbe1-Cy3 | IDT | /5Cy3/AACGGTATTCGGTCGTCATC | |
| dcProbe1-ATTO647N | IDT | /5ATTO647NN/CTGGTTCGGGCGTACCTAAC | |
| dcProbe2-AF488 | IDT | /5Alex488N/AGAACTTGCGCGGATACACG | |
| dcProbe2-Cy3 | IDT | /5Cy3/CTACTTCGTCGCGTCAGACC | |
| dcProbe2-ATTO647N | IDT | GACGAACGGTCGAGATTTAC/3ATTO647NN/ | |
| dcProbe3-AF488 | IDT | /5Alex488N/GAATTGTCCGCGCTCTACGA | |
| dcProbe3-Cy3_2 | IDT | /5Cy3/TCGTACTTCGACGGCACTCA | |
| dcProbe3-ATTO647N | IDT | /5ATTO647NN/AACTGCGACCGTCGGCTTAC | |
| dcProbe4-AF488 | IDT | /5Alex488N/CGGAATACGTCGTTGACTGC | |
| dcProbe4-Cy3 | IDT | /5Cy3/TACCATTCGCGTGCGATTCC | |
| dcProbe4-ATTO647N_2 | IDT | /5ATTO647NN/ACTCTACCGGCAATCGCGTC | |
| dcProbe5-AF488 | IDT | /5Alex488N/GAGTGTCGCGCAACTTAGCG | |
| dcProbe5-Cy3 | IDT | /5Cy3/ACGTCTGCGTACCGGCTTAG | |
| dcProbe5-ATTO647N | IDT | /5ATTO647NN/CATGCGATTAACCGCGACTG | |
| dcProbe6-AF488_2 | IDT | /5Alex488N/CTTGCGGCGACAGTCGAACA | |
| dcProbe6-Cy3 | IDT | /5Cy3/TCGTAACCCGTGCGAAGTGC | |
| dcProbe6-ATTO647N | IDT | /5ATTO647NN/CTCTCGTAGCGTGCGATGAG | |
| dcProbe7-AF488_2 | IDT | /5Alex488N/TTAGGTCGCCTACCGACTGC | |
| dcProbe7-Cy3 | IDT | /5Cy3/GCCACATCGACTCGGTCTAT | |
| dcProbe7-ATTO647N | IDT | GCTCAGCCGGACGAGTAGAT/3ATTO647NN/ |
preparation
preparation
10m
10m
Make sure that the padlock probes have 5' phosphate. In case they do not, run T4 PNK reaction and clean up the product using Zymo ssDNA/RNA clean up columns.
Wash, dry and UV the silicone isolators. UV the EasyDip jars. Move away unused stuff from the bench and clean and undust the working area. Set the HybEZ oven 37C.
permeabilization
permeabilization
Prepare 75ml of 4% formaldehyde in 1x PBS. Requires two vials of 16% formaldehyde.
| A | B | |
| component | volume (mL) | |
| DEPC-water | 52 | |
| 16% PFA | 20 | |
| 10X PBS | 8 |
Take the sections that are on 25mm*60mm coverslips out of -80C on dry ice, insert them into the slide holder, submerge the slide holder in the staining jar containing 4% PFA in PBS. Fix for 60mins at 4C.
01:00:00 4C
1h
Remove the DEPC-PSBT jar and the 4% PFA jar containing the samples from 4C. Insert the sample holder into the cold 1x PBST jar. Incubate for 3 minutes. Then insert the sample holder in the room temperature 1x PBST jar. Incubate for 3 minutes.
00:03:00 in 4C DEPC-PBST with occasional agitation
00:03:00 in RT DEPC-PBST with occasional agitation
6m
dehydration and mounting
dehydration and mounting
20m
20m
Prepare jars of 50%, 70% and two 100% ethanol. Dehydrate Section with
00:05:00 50% EtOH at room temperature
00:05:00 70% EtOH at room temperature
00:05:00 100% EtOH at room temperature
00:05:00 100% EtOH at room temperature
20m
Take the coverslips out of the sample holder.
00:05:00 Air drying at room temperature.
In the meantime, put 20mm diameter Press-To-Seal silicone isolators on a kipwipe on a flat surface. Carefully put the coverslips on silicone isolators, with the tissue sample in the hole. Gently press on the back of the coverslip to seal completely. You may want to stack a 20mm diameter isolator on top of the already mounted 20mm isolator to increase the volume.
5m
permeabilization
permeabilization
10m
10m
Permeabilize sample with 0.25% Triton X-100 in DEPC-1X PBS for 00:10:00 at Room temperature
875 µL DEPC-H2O 100 µL 10x PBS 25 µL 10% Triton-X 100
| A | B | |
| component | x1 volume (uL) | |
| DEPC-water | 875 | |
| 10X PBS | 100 | |
| 10% Triton X-100 | 25 |
10m
Wash thrice with DEPC-1X PBS and DEPC-Water
1 mL DEPC-1X PBS quick wash
1 mL DEPC-1X PBS quick wash
1 mL DEPC-water quick wash
pepsin digestion
pepsin digestion
10m
10m
Digest with 0.01% Pepsin in 0.1N HCl. Pre-warm the pepsin to 37 °C for at least 5 minutes before use.
100 µL 0.01% Pepsin in 0.1N HCl for00:01:30 at 37 °C
| A | B | |
| component | x1 volume (uL) | |
| 1% pepsin | 1 | |
| 0.1N HCl | 99 |
1m 30s
Wash twice with DEPC-1X PBS
1 mL DEPC-1X PBS quick wash
1 mL DEPC-1X PBS quick wash
reverse transcription
reverse transcription
15m
15m
Prepare Reverse Transcription Mix on Ice.
| A | B | |
| component | x1 volume (uL) | |
| DEPC-water | 90.75 | |
| 5X SSIV buffer | 30 | |
| 10mM dNTP | 3.75 | |
| 100uM N5_dc10-Cy5_N9 | 3.75 | |
| 100uM dT20_dc7-488 | 3.75 | |
| 0.1M DTT | 7.5 | |
| 4mM aminoallyl-dUTP | 1.5 | |
| RNase inhibitor (40U/uL) | 1.5 | |
| SuperScript IV Reverse Transcriptase | 7.5 | |
| total | 150 |
Incubate human brain sections with the Reverse Transcription Mix
150 µL Reverse Transcription Mix for 00:10:00 at 4 °C then Overnight at 37 °C
15m
Wash with 1X PBS twice.
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
cDNA crosslinking
cDNA crosslinking
1h 30m
1h 30m
Add the crosslinking mix to crosslink cDNAs with BS(PEG)9. Prepare 5mM BS(PEG)9 in PBS.
| A | B | |
| component | x1 volume (uL) | |
| 250mM BS(PEG)9 | 10 | |
| 10X PBS | 50 | |
| ultrapure water | 440 |
Crosslink cDNA with BS(PEG)9
500 µL 5 mM BS(PEG)9 in PBS for 01:00:00 at Room temperature
Wash with PBS twice
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
Quench unreacted crosslinker with 1M Tris, pH 8.0
1 mL 1M Tris pH8.0 for 00:30:00 at Room temperature
Wash with PBS twice
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
1h 30m
RNase digestion
RNase digestion
1h
1h
Prepare RNase Digestion Mix
| A | B | |
| component | x1 volume (uL) | |
| ultrapure water | 168 | |
| 10X RNase H buffer | 20 | |
| RNase H (5U/uL) | 10 | |
| RNase Cocktail | 2 |
Add 200 µL RNase Digestion Mix
Incubate at 37 °C for 01:00:00 . Cover the silicone wells.
1h
Wash samples with 1X PBS twice.
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
padlock probe hybridization
padlock probe hybridization
33m
33m
Prepare the 484-gene-Hybridization Mix according to the table below. Preheat the probe-water mix to 85 °C for 00:03:00 and immediately move them to a cold block or on ice. Then complete the Hybridization Mix.
484-gene-Hybridization Mix
| A | B | |
| component | x1 volume (uL) | |
| ultrapure water | 98.2 | |
| 10X Ampligase buffer | 15 | |
| HB_Feb2022 probes ( 27.2 ng/uL) | 25.3 | |
| 100nM PLP1 oligos | 1.5 | |
| Ampligase (5U/uL) | 10 |
add 150 µL 484-gene-Hybridization mix to human section
3m
Incubate samples in the Hybridization Mix at 37 °C for 00:30:00 , then at 55 °C Overnight .
For the overnight incubation, first set the Ez hyb oven to 60 °C and then change it to 55 °C as you put the samples in. Cover the sample well.
30m
Wash samples with 1x PBS twice.
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
RCA
RCA
6h
6h
Prepare RCA Primer Mix
| A | B | |
| component | x1 volume (uL) | |
| ultrapure water | 119 | |
| 20X SSC | 20 | |
| formamide | 60 | |
| 100 uM FISSEQ_ppRCA primer | 1 |
add 200 µL RCA Primer Mix to each sample and incubate at 37 °C for 01:00:00
1h
Wash samples with 2xSSC.
1 mL 2X SSC quick wash
1 mL 2X SSC quick wash
Prepare RCA Enzyme Mix on ice.
| A | B | |
| component | x1 volume (uL) | |
| ultrapure water | 119.25 | |
| 10X Phi29 polymerase buffer | 15 | |
| 10mM dNTP | 3.75 | |
| 4mM aminoallyl-dUTP | 1.5 | |
| NEB BSA (20mg/mL) | 7.5 | |
| ThermoFisher Phi29 polymerase | 3 | |
| total | 150 |
Add 150 µL RCA Enzyme Mix to each sample
Incubate samples in RCA Enzyme Mix at 30 °C for 05:00:00
5h
Wash samples with 1x PBS twice.
1 mL 1X PBS quick wash
1 mL 1X PBS quick wash
rolony crosslinking
rolony crosslinking
1h 30m
1h 30m
Crosslink with Acryloyl-X Mix and embed the sample in gel.
Prepare Acryloyl-X Mix
| A | B | |
| Component | x1 volume (uL) | |
| 10X PBS | 50 | |
| 10mg/mL Acryloyl-X, SE in DMSO | 10 | |
| ultrapure water | 440 |
add 500 µL Acryloyl-X Mix to the sample and incubate for 00:30:00 at Room temperature
quick wash with 1xPBS.
1 mL 1X PBS quick wash
Incubate the sample with 300 µL Acrylamide Solution for 00:30:00 at Room temperature .
Prepare Acrylamide Solution.
| A | B | |
| Component | x1 volume (uL) | |
| 10X PBS | 50 | |
| 40% Acrylamide/Bis (37:1) | 50 | |
| ultrapure water | 400 |
Aspirate the Acrylamide Solution. Do not wash the samples!!!
Prepare Polymerization Mix.
Prepare 5% TEMED: 5 µL TEMED in 95 µL ultrapure water
Prepare 4% APS: 10 mg Ammonium Persulfate in 250 µL ultrapure water
RNaseZap and UV 18mm coverslips and treat them with Gel-Slick.
| A | B | |
| component | x1 volume (uL) | |
| Acrylamide solution | 138 | |
| 4% APS | 6 | |
| 5% TEMED | 6 |
Add 30 µL Polymerization Mix to the sample and cover with Gel-Slick-treated coverslip for 00:30:00 at Room temperature in an Argon tank.
wash with 1x PBST for 3min twice
1 mL 1X PBST for 00:03:00
1 mL 1X PBST for 00:03:00
Carefully remove the Gel-Slick-treated coverslip on the samples
wash with 1xPBST for 3min twice
1 mL 1X PBST for 00:03:00
1 mL 1X PBST for 00:03:00
1h 42m
imaging
imaging
11m
11m
stain the sample with Probe Hybridization Mix with decoding probes (Take dcProbe0_AF488, dcProbe0_Cy3, dcProbe0_ATTO647N probes as an example).
Prepare Probe Hybridization Mix
| A | B | |
| component | x1 volume (uL) | |
| 100 uM dcProbe0_AF488 | 1 | |
| 100 uM dcProbe0_Cy3 | 1 | |
| 100 uM dcProbe0_ATTO647 | 1 | |
| 100% formamide | 60 | |
| 20X SSC | 20 | |
| ultrapure water | 117 |
add 200 µL Probe Hybridization Mix to each sample. Incubate for 00:08:00 at Room temperature
8m
Wash with10% formamide in 2X SSC twice. Then, image.
1 mL 10% formamide in 2X SSC for 00:03:00
1 mL 10% formamide in 2X SSC for 00:03:00
6m
Strip with 1 mL 80% formamide in 2X SSC for 00:05:00 .
Wash with 1 mL 2X SSC buffer once.
Repeat the decoding imaging with the next decoding probes (dcProbe1, dcProbe2, dcProbe3, dcProbe4, dcProbe5, dcProbe6, and dcProbe7).
5m
After images of samples stained with dcProbe0, 1, 2, 3, 4, 5, 6, 7 were taken, take the nuclei staining images with Draq5 staining.
add 500 µL Draq5 solution to the sample. Incubate for 00:05:00 at Room temperature
wash the sample with 1x PBS twice. Then, image.
1 mL 1X PBS for 00:02:00
1 mL 1X PBS for 00:02:00
9m