Aug 16, 2023
BARseq - BARseq-styled in situ sequencing for barcoded rabies virus
- 1Allen Institute for Brain Science
Protocol Citation: Xiaoyin Chen, Mara CP Rue 2023. BARseq - BARseq-styled in situ sequencing for barcoded rabies virus. protocols.io https://dx.doi.org/10.17504/protocols.io.n2bvj82q5gk5/v1
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: January 12, 2023
Last Modified: August 16, 2023
Protocol Integer ID: 75215
Keywords: BARseq, in situ sequencing, spatial transcriptomics, barcoding-based neuroanatomy
Funders Acknowledgement:
NIH
Grant ID: 1DP2MH132940
Abstract
This protocol describes the application of BARseq-style in situ sequencing adapted for barcoded rabies virus. Similar procedures for both trans-synaptic tracing and retrograde tracing experiments.
Guidelines
Standard precautions with RNA samples should be taken to reduce RNA degradation during tissue processing and library preparation. Pipetting and suctioning should be gentle throughout the whole procedure, and sample should not be left dried.
Materials
DNA oligos
| A | B | C | |
| YS220 | GATCGTCGGACTGTAGAACTCTGAACCTGTCG | sequencing primer | |
| YS221 | /5Alex594N/GATCGTCGGACTGTAGAACTCTGAACCTGTCG | Hybridization probe to visualize all genes | |
| XC1417 | GTTCAGAGTTCTACAGTCCGACGATC | RCA primer for SNAP25 RNA padlock | |
| XC2757 | /5AmMC12/NNNNNNNNNNNNNNNNNNNN | N20 for random priming | |
| XC2758 | /5Alex488N/AGTCAGCGTCGAGCACGCGGCACTTATTGCA | Hybridization probe to visualize Slc17a7 | |
| XC2759 | /5Alex532N/TGAGTAGAGTTGACTAAGAGCCGTTAGATGCC | Hybridization probe to visualize Gad1 | |
| XC2760 | /5Alex647N/TCGCTGTACTAATAGTTGTCGACAGATCGTCA | Hybridization probe to visualize B19G | |
| XCAI5 | /5phos/agctccggcattttgttattcaTCCTCTATGATTACTGACTGCGTCTATTTAGTGGAGCCATTGCTATCTTCTTggatatacacaatccgtagattgct | pRV-4mCherry-Nhel-N20 BC gapfilling padlock | |
| XCAI6 | /5AmMC6/g+ac+at+at+tc+ga+gt+gactcataagaagt | primer 1 for pRV-4mCherry-Nhel-N20 and pRV-4mCherry-CSCS2 | |
| XCAI7 | /5AmMC6/g+aa+gt+tg+aa+ta+ac+aaaatgccggagc | primer 2 for pRV-4mCherry-Nhel-N20 and pRV-4mCherry-CSCS2 | |
| XCAI63 | /5AmMC6/gggagtgactgacacctccctccctg | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI64 | /5AmMC6/tatcaacatcaaggcagtcagggccc | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI65 | /5AmMC6/tcctgagacctgattgtgcacatcgg | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI66 | /5AmMC6/aactccatatgttgctggaggaggga | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI67 | /5AmMC6/tgcttttccaaacccagggacaagtt | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI68 | /5AmMC6/tttcgtctgagcgaaagtcgtgcagg | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI69 | /5AmMC6/ttgcatcgagacccatgttccatcca | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI70 | /5AmMC6/aggcctctttcatctacaaagccgca | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI71 | /5AmMC6/acatccctagtctcggattctcgggc | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI72 | /5AmMC6/aagacaccgctactcctgagcacttc | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI73 | /5AmMC6/tggtttttacagttcgaagccagcgg | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI74 | /5AmMC6/caccggccatcttccagttgtacgcg | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI75 | /5AmMC6/agtgtaggtttcagcctccgtcacaa | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI76 | /5AmMC6/atgtaggagaaccctgacaggttggt | RV B19G RT primer, Hyb XC2760 for detection | |
| XCAI77 | /5phos/acacaatctcagagggacaggTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTcaatcgatcagaacctacgca | RV B19G padlock, Hyb XC2760 for detection, use with XC63 | |
| XCAI78 | /5phos/gggaagtatgtattactgagtgcTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTtgacttgggtctcccgaactgg | RV B19G padlock, Hyb XC2760 for detection, use with XC64 | |
| XCAI79 | /5phos/tgttgaagttcaccttcccgaTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTcggtgacgaggctgaggattt | RV B19G padlock, Hyb XC2760 for detection, use with XC65 | |
| XCAI80 | /5phos/tcccagagatgcaatcatcccTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTgacctgacggcaatgtcttaa | RV B19G padlock, Hyb XC2760 for detection, use with XC66 | |
| XCAI81 | /5phos/gtttcagacgtctcagtcattTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTtcatgacaaccaagtcagtga | RV B19G padlock, Hyb XC2760 for detection, use with XC67 | |
| XCAI82 | /5phos/cccgataagttggtgaacctgTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTaatgaaaccaaatggtgccct | RV B19G padlock, Hyb XC2760 for detection, use with XC68 | |
| XCAI83 | /5phos/tggagttctaggacttagacttTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTgagcatgcaaactcaagttatg | RV B19G padlock, Hyb XC2760 for detection, use with XC69 | |
| XCAI84 | /5phos/ccaaagggagtgagacttgcgTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTatagtagagggaagagagcat | RV B19G padlock, Hyb XC2760 for detection, use with XC70 | |
| XCAI85 | /5phos/gattacaccatttggatgcccTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTacctactgctccactaaccac | RV B19G padlock, Hyb XC2760 for detection, use with XC71 | |
| XCAI86 | /5phos/agggtcttccctagcgggaagtTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTtatgacagatcccttcactcg | RV B19G padlock, Hyb XC2760 for detection, use with XC72 | |
| XCAI87 | /5phos/caatccgtaccctgactaccgTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTcccagatatgaagagtctctaca | RV B19G padlock, Hyb XC2760 for detection, use with XC73 | |
| XCAI88 | /5phos/ccagatgcatgtagagccgcgtTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTagaaagcatttccgcccaaca | RV B19G padlock, Hyb XC2760 for detection, use with XC74 | |
| XCAI89 | /5phos/gttcacttgcacaggcgttgtTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTtcttagccataaaagtgaacgg | RV B19G padlock, Hyb XC2760 for detection, use with XC75 | |
| XCAI90 | /5phos/tggaggacgaaggatgcaccaTCGCTGTACTAATAGTTGTCGACAGATCGTCACTTCGTTCCTgctgcccaaacaatttggtag | RV B19G padlock, Hyb XC2760 for detection, use with XC76 | |
| XCAI131 | TGGAGCCATTGCTATCTTCTTggatatacacaatccgtagattgct | sequencing primer for XCAI5 |
Reagents
Phusion high-fidelity PCR kitThermo ScientificCatalog #F553S
Tween-20Sigma-aldrichCatalog #P-7949
BS(PEG)9, 100 mg (Note: BS(PEG)9 loses its effectiveness 1 month after reconstitution in DMSO. Prepare a fresh batch every month, especially if it has been frozen and thawed repeatedly.Thermo ScientificCatalog #21582
FormamideThermo Fisher ScientificCatalog #AM9342
10x PBSThermo Fisher ScientificCatalog #AM9624
RNase-free water
dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 10mM) Thermo Fisher ScientificCatalog #R0192
phi29 DNA Polymerase (10 U/µL)Thermo ScientificCatalog #EP0091
RNAse HEnzymaticsCatalog #Y9220L
GlycerolSigma AldrichCatalog #G5516
EthanolMerck MilliporeCatalog #100983
Pierce™ MMTS (methyl methanethiosulfonate)Thermo FisherCatalog #23011
SSC (20X), RNase-freeThermo FisherCatalog #AM9770
RiboLock RNase Inhibitor (40 U/µL)Thermo FisherCatalog #EO0381
RevertAid H Minus Reverse Transcriptase (200 U/µL)Thermo FisherCatalog #EP0452
Paraformaldehyde 20%Electron Microscopy SciencesCatalog #15713
BSA Molecular gradeNew England BiolabsCatalog #B9000S
Ampligase DNA Ligase KitLucigenCatalog #A8101
KCl (2 M) RNase-freeThermo Fisher ScientificCatalog #AM9640G
Aminoallyl-dUTP Solution (50 mM)Thermo Fisher ScientificCatalog #R1101
Tris (1 M) pH 8.0 RNase-freeThermo Fisher ScientificCatalog #AM9855G
HiSeq SBS Kit v4illuminaCatalog #FC-401-4003
Grace Bio-Labs HybriWell-FL™ sealing system Fluor-friendly adhesive chamberSigma AldrichCatalog #GBL612204
Other equipment required include incubators set at 37 ″C, 45 ″C, and 60 ″C. All tubes should be RNase-free. RNase-free filter tips should be used. A Crest Xlight v3 spinning disk confocal on an Nikon Ti2E with Photometrics Kinetix, and Lumencor Celesta was used for imaging the sequencing steps. The filters and lasers used are indicated in Table 1.
| A | B | C | D | |
| Channels | Laser | Dichroic | Emission filter | |
| G/YFP | 514 | Zt405/514/635rpc | FF01-565/24 | |
| T/RFP | 561 | FF421/491/567/659/776-Di01 | FF01-441/511/593/684/817 | |
| A | 640 | Zt405/514/635rpc | FF01-676/29 | |
| C | 640 | Zt405/514/635rpc | FF01-775/140 | |
| GFP | 488 | FF421/491/572-Di01 | 69401m | |
| DAPI | 405 | FF421/491/572-Di01 | 69401m | |
| TexasRed | 561 | FF421/491/572-Di01 | 69401m | |
| Cy5 | 640 | Zt405/514/635rpc | ZET532/640m |
Table 1. Laser and filter settings for sequencing imaging.
Safety warnings
Use caution when handling liquids containing formaldehyde and formamide.
Library preparation
Library preparation
Tissues with barcoded neurons should be cryo-sectioned to 20 μm and mounted on slides. Slides can be stored at -80 °C for up to a month.
DAY 1
Take slide(s) out of -80 °C and immerse immediately in 4% paraformaldehyde in 1x PBS (2 slides per 50mL falcon tube, back-to-back)
Incubate for 1 hour at room temperature on slow shaker
Wash the slides by immersing in 1x PBS (2 slides per 50ml falcon tube, back to back)
Wipe excess PBS off the surface of the chamber, then stick on the Hybriwell-FL chambers. Note that the ports on the chamber should be placed as far away from the tissue slices as possible.
Wash twice in PBST (1x PBS + 0.5% Tween-20)
Wash in 70% Ethanol for 5 mins
Wash in 85% Ethanol for 5 mins
Wash in 100% Ethanol for 5 mins
Replace with new 100% Ethanol, drop extra 100% Ethanol on top of slides and cover with ParaFilm to avoid evaporation. Incubate for at least 1.5 hrs at 4 °C (up to 3 hours)
Wash in PBST for 4-6 times, until all bubbles are cleared in the chamber and PBST flows in and out of the chamber smoothly.
Make reverse transription mix: 50 μM N20 primer (XC2757), 2 μM XCAI6, 2 μM XCAI7, 20 U/μL RevertAid H Minus M-MuLV reverse transcriptase, 500 μM dNTP, 0.2 μg/μL BSA, 1 U/μL RiboLock RNase Inhibitor, 1x RevertAid RT buffer.
For the monosynaptic tracing experiments, the RT primers additionally included 2 μM of primers for the rabies glycoprotein (XCAI63 through XCAI76).
Incubate in reverse transcription mix overnight at 37 °C. Create a humidity chamber to avoid the slides drying out using kim-wipes and DI water.
DAY 2:
Wash with PBST once
Incubate in a mixture of 1μL BS(PEG)9 per 4 μL PBST (e.g. 200ul BS(PEG)9 and 800ul PBST) for one hour at room temperature
Wash with 1M Tris pH 8.0, then incubate in new 1M Tris pH 8.0 for 30 mins
Wash twice in PBST
Make non-gap-filling ligation mix: 1x Ampligase buffer, 20 nM padlock probe each, 0.5 U/μL Ampligase, 0.4 U/μL RNase H, 1 U/μL RiboLock RNase Inhibitor, 50 mM KCl (extra of those already provided by the ampligase buffer), 20% formamide.
In the retrograde tracing experiments, the non-gap-filling padlock probe mix included all padlock probes for endogenous genes. In the monosynaptic tracing experiments, the non-gap-filling padlock probe mix included all padlock probes for endogenous genes except Slc30a3, and additionally included padlocks for the rabies glycoprotein (XCAI77 – XCAI90).
Incubate in ligation mix for at least 30 mins at 37 °C (can go longer but not shorter), then at least 45 mins at 45 °C (can go longer but not shorter).
Make the gap-filling ligation mix [same as the non-gap-filling mix with the rabies barcode padlock probe (XCAI5) as the only padlock probe, and with 50 μM dNTP, 0.2 U/μL Phusion DNA polymerase, and 5% glycerol]
1x Ampligase buffer, 20 nM padlock probe each, 0.5 U/μL Ampligase, 0.4 U/μL RNase H, 1 U/μL RiboLock RNase Inhibitor, 50 mM KCl (extra of those already provided by the ampligase buffer), 20% formamide, 50 μM dNTP, 0.2 U/μL Phusion DNA polymerase, and 5% glycerol.
Wash twice in PBST
Incubate in ligation mix for 5 mins at 37 °C, then 45 mins at 45 °C. **exact timing on this step!**
Wash twice in PBST, then once in FISH Wash (2x SSC with 10% formamide)
Hybridize with 1 μM RCA primer (XC1417) in FISH wash for 10 mins at room temperature
Wash twice in FISH wash, then twice in PBST
Make RCA mix: 1 U/μL phi29 DNA polymerase, 1x phi29 polymerase buffer, 0.25 mM dNTP, 0.2 μg/μL BSA, 5% glycerol (extra of those from the enzymes), 125 μM aminoallyl dUTP
Incubate in RCA mix overnight at room temperature
DAY 3:
Wash with PBST once
Incubate in a mixture of 1μL BS(PEG)9 per 4 μL PBST (e.g. 200ul BS(PEG)9 and 800ul PBST) for one hour at room temperature
Wash with 1M Tris pH 8.0, then incubate in new 1M Tris pH 8.0 for 30 mins
Wash twice in PBST
Sequencing
Sequencing
Hybridization of Gene sequencing primer:
Wash with FISH wash (2x SSC with 10% formamide)
Hybridize sequencing primer (YS220) with a primer concentration of 1 μM in FISH wash for 10 mins at room temperature
Wash with FISH wash three times, 2 mins each
Wash with PBST twice
Sequence first cycle (genes and barcodes):
Do the following incubations. Unless noted with incubation temperature, each step is performed at room temperature. For steps without incubation time, treat these as quick washes. large flat metal blocks can be used to place sample slides to quickly cycle through high and low temperatures. This version uses MiSeq Nano v2 kit:
Incorporation Buffer 60 °C 3 mins x1
2% PBST x1
Idoacetamide blocker: For 9.3mg vial dilute pellet in between 2.5-3.5mL 2% PBST. Make fresh tube daily and store out of light.
Idoacetamide blocker 60 °C 3 mins x1
2% PBST x1
Incorporation Buffer x2
IRM 60 °C 3 mins x2
2% PBST x1
2% PBST 60 °C 3 mins x4
Replace PBST with USM and Image **if slides are dirty, clean with 70% Ethanol before adding USM**
Sequence subsequent cycles (genes and barcodes):
Do the following incubations. Unless noted with incubation temperature, each step is performed at room temperature. For steps without incubation time, treat these as quick washes. large flat metal blocks can be used to place sample slides to quickly cycle through high and low temperatures.
Incorporation buffer x2
CRM 60 °C 3 mins x2
Incorporation buffer x1 - Wipe ports after adding the incorporation buffer, to ensure that no CRM is left on the slide's surface
2% PBST x1
Idoacetamide blocker: For 9.3mg vial dilute pellet in between 2.5-3.5mL 2% PBST. Make fresh tube daily and store out of light.
Idoacetamide blocker 60 °C 3 mins x1
2% PBST x1
Incorporation buffer x2
IRM 60 °C 3 mins x2
2% PBST x1
2% PBST 60 °C 3 mins x4
Replace 2% PBST with USM and image **if slides are dirty, clean with 70% Ethanol before adding USM**
After completing all gene sequencing imaging cycles:
Hybridization cycle
Hybridize probes:
Make strip buffer: 60% formamide 2xSSC 0.01% Tween20
Strip buffer 60 ˚C 5 mins x3
Cool down quickly on metal plates between washes, place on metal plates in 60 ˚C oven to heat up quickly.
FISH wash (2x SSC with 10% formamide) 1x
Hybridize probes (YS221, XC2758, XC2759, XC2760) with a primer concentration of 1 μM in FISH wash at 60 ˚C for 2 minutes, then for 10 mins at room temperature. Rotate plates in holder to ensure they cool down slowly.
FISH wash x1
0.002 mg/ML DAPI in PBST, room temperature for 5 mins
Replace PBST with USM and image **if slides are dirty, clean with 70% Ethanol before adding USM**
After completing all gene sequencing imaging cycles and hybridization cycle:
Hybridize barcode sequencing primers
Strip buffer (60% formamide 2xSSC 0.01% Tween20)
60 ˚C 5 mins x3
Cool down quickly on metal plates between washes, place on metal plates in 60 ˚C oven to heat up quickly.
FISH wash (2x SSC with 10% formamide) 1x
Hybridize probe XCAI131 with a primer concentration of 1 μM in 2x SSC and FISH wash at 60 ˚C for 2 minutes, then for 10 mins at room temperature. Rotate plates in holder to ensure they cool down slowly.
FISH wash x1
Sequencing barcodes: The sequencing procedures are the same as those for gene sequencing (Steps 36 and 37)
After hybridizing barcode primers, go directly back to step 36, sequence first barcode imaging cycle. Then repeat step 37 for desired length of barcode sequence.